Structured Review

GE Healthcare exonuclease i
Schematic presentation of the microsphere-based single base chain extension assays. DNA fragments containing the polymorphic site to be typed were amplified either individually or by multiplexed PCR (step 1 ). The PCR products containing a SNP site were pooled and treated with SAP and <t>exonuclease</t> I (step 2 ). After heat inactivation of the enzymes, the PCR products were used in the SBCE reactions (step 3 ) as described in Methods. For every SNP, one capture oligonucleotide probe with a unique ZipCode sequence was designed and used to assay the two alleles in each of two separate wells with a different labeled ddNTP per well. Multiplexed SNP analysis could be achieved by the employment of different ZipCode sequences for different SNPs in the presence of pooled PCR products. After the completion of the SBCE reaction, ∼1200 of each type of microsphere [with an attached oligonucleotide encoding the complement to the ZipCode sequences and a common luciferase sequence (SeqLUC)] were added to the completed SBCE reactions. The hybridization reactions were carried out at 40°C in the presence of NaCl for > 2 hr (step 4 ). The microspheres were then subjected to flow cytometric analysis (step 5 ). Minimums of 100 of each type of microsphere were read and the mean value of MESF was used for determining the genotypes. The fluorescence signal of the corresponding microsphere without SBCE reactions (microsphere alone) or SBCE reactions without AmpliTaq FS were subtracted from the MESF values.
Exonuclease I, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/exonuclease i/product/GE Healthcare
Average 93 stars, based on 191 article reviews
Price from $9.99 to $1999.99
exonuclease i - by Bioz Stars, 2020-08
93/100 stars

Images

1) Product Images from "A Microsphere-Based Assay for Multiplexed Single Nucleotide Polymorphism Analysis Using Single Base Chain Extension"

Article Title: A Microsphere-Based Assay for Multiplexed Single Nucleotide Polymorphism Analysis Using Single Base Chain Extension

Journal: Genome Research

doi:

Schematic presentation of the microsphere-based single base chain extension assays. DNA fragments containing the polymorphic site to be typed were amplified either individually or by multiplexed PCR (step 1 ). The PCR products containing a SNP site were pooled and treated with SAP and exonuclease I (step 2 ). After heat inactivation of the enzymes, the PCR products were used in the SBCE reactions (step 3 ) as described in Methods. For every SNP, one capture oligonucleotide probe with a unique ZipCode sequence was designed and used to assay the two alleles in each of two separate wells with a different labeled ddNTP per well. Multiplexed SNP analysis could be achieved by the employment of different ZipCode sequences for different SNPs in the presence of pooled PCR products. After the completion of the SBCE reaction, ∼1200 of each type of microsphere [with an attached oligonucleotide encoding the complement to the ZipCode sequences and a common luciferase sequence (SeqLUC)] were added to the completed SBCE reactions. The hybridization reactions were carried out at 40°C in the presence of NaCl for > 2 hr (step 4 ). The microspheres were then subjected to flow cytometric analysis (step 5 ). Minimums of 100 of each type of microsphere were read and the mean value of MESF was used for determining the genotypes. The fluorescence signal of the corresponding microsphere without SBCE reactions (microsphere alone) or SBCE reactions without AmpliTaq FS were subtracted from the MESF values.
Figure Legend Snippet: Schematic presentation of the microsphere-based single base chain extension assays. DNA fragments containing the polymorphic site to be typed were amplified either individually or by multiplexed PCR (step 1 ). The PCR products containing a SNP site were pooled and treated with SAP and exonuclease I (step 2 ). After heat inactivation of the enzymes, the PCR products were used in the SBCE reactions (step 3 ) as described in Methods. For every SNP, one capture oligonucleotide probe with a unique ZipCode sequence was designed and used to assay the two alleles in each of two separate wells with a different labeled ddNTP per well. Multiplexed SNP analysis could be achieved by the employment of different ZipCode sequences for different SNPs in the presence of pooled PCR products. After the completion of the SBCE reaction, ∼1200 of each type of microsphere [with an attached oligonucleotide encoding the complement to the ZipCode sequences and a common luciferase sequence (SeqLUC)] were added to the completed SBCE reactions. The hybridization reactions were carried out at 40°C in the presence of NaCl for > 2 hr (step 4 ). The microspheres were then subjected to flow cytometric analysis (step 5 ). Minimums of 100 of each type of microsphere were read and the mean value of MESF was used for determining the genotypes. The fluorescence signal of the corresponding microsphere without SBCE reactions (microsphere alone) or SBCE reactions without AmpliTaq FS were subtracted from the MESF values.

Techniques Used: Amplification, Polymerase Chain Reaction, Sequencing, Labeling, Luciferase, Hybridization, Flow Cytometry, Fluorescence

Related Articles

Sequencing:

Article Title: Haplotype and Linkage Disequilibrium Architecture for Human Cancer-Associated Genes
Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. .. Direct sequencing of each PCR product was carried out using ABI dye terminator cycle sequencing kit and run on an ABI 373A for RAD51, BRCA1 , and BRCA2 .

Article Title: A High-Throughput Arabidopsis Reverse Genetics System
Article Snippet: .. Before sequencing, secondary TAIL-PCR products were purified by treatment with exonuclease I (2.5 units; Amersham) and shrimp alkaline phosphatase (0.5 units; Amersham) for 20 min at 37°C, followed by 15 min at 80°C. .. Sequencing reactions were performed in a 384-well format using the T-DNA LB3 primer and one-eighth of the suggested amount of BigDye terminators and run on Applied Biosystems 3700 sequencers.

Article Title: Genetic predictors of MEK-dependence in non-small cell lung cancer
Article Snippet: .. All PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced directly using Applied Biosystems PRISM dye terminator cycle sequencing method (Perkin-Elmer Corp., Foster City, CA). .. All the sequence variants were confirmed by independent PCR amplifications and sequenced in both directions.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Polymerase Chain Reaction:

Article Title: Haplotype and Linkage Disequilibrium Architecture for Human Cancer-Associated Genes
Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. .. Direct sequencing of each PCR product was carried out using ABI dye terminator cycle sequencing kit and run on an ABI 373A for RAD51, BRCA1 , and BRCA2 .

Article Title: A large-scale mutation search reveals genetic heterogeneity in 3M syndrome
Article Snippet: .. We purified the PCR product with exonuclease I (ExoSAPIT; Amersham Bioscience) according to the manufacturer's instructions. .. Sequencing reactions were run on an ABI 3130 sequencer using a dye terminator cycle sequencing kit (Applied Biosystems) and analysed by sequencing analysis (Applied Biosystems).

Article Title: Parallel Genotyping of Human SNPs Using Generic High-density Oligonucleotide Tag Arrays
Article Snippet: .. All PCR products were cleaned with Exonuclease I (Amersham 0.15 μl of 10 U/μl per well) and Shrimp Alkaline Phosphatase (Amersham, 0.30 μl of 1 U/μl per well) in a volume of 10 μl. .. Dye terminator sequencing using an M13R primer (AACAGCTATGACCATG) or T7 primer (TAATACGACTCACTATAGGGAGA) on an ABI377 (Perkin Elmer) using Big Dye (Perkin Elmer) was performed to determine the genotype status for each SNP in each of the three individuals.

Article Title: Myasthenic syndrome caused by mutation of the SCN4A sodium channel
Article Snippet: .. PCR-amplified fragments of SCN4A were cleared of unincorporated dNTPs and primers by using shrimp alkaline phosphatase (Amersham Biosciences/United States Biochemical) and exonuclease I (Amersham Biosciences/United States Biochemical) and incubated at 37°C for 15 min. .. Plasmids were purified by the QIAprep Spin Miniprep kit (Qiagen).

Article Title: Genetic predictors of MEK-dependence in non-small cell lung cancer
Article Snippet: .. All PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced directly using Applied Biosystems PRISM dye terminator cycle sequencing method (Perkin-Elmer Corp., Foster City, CA). .. All the sequence variants were confirmed by independent PCR amplifications and sequenced in both directions.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Incubation:

Article Title: Haplotype and Linkage Disequilibrium Architecture for Human Cancer-Associated Genes
Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. .. Direct sequencing of each PCR product was carried out using ABI dye terminator cycle sequencing kit and run on an ABI 373A for RAD51, BRCA1 , and BRCA2 .

Article Title: Myasthenic syndrome caused by mutation of the SCN4A sodium channel
Article Snippet: .. PCR-amplified fragments of SCN4A were cleared of unincorporated dNTPs and primers by using shrimp alkaline phosphatase (Amersham Biosciences/United States Biochemical) and exonuclease I (Amersham Biosciences/United States Biochemical) and incubated at 37°C for 15 min. .. Plasmids were purified by the QIAprep Spin Miniprep kit (Qiagen).

Article Title: Genetic predictors of MEK-dependence in non-small cell lung cancer
Article Snippet: .. All PCR products were incubated using exonuclease I and shrimp alkaline phosphatase (Amersham Biosciences, Piscataway, NJ) and sequenced directly using Applied Biosystems PRISM dye terminator cycle sequencing method (Perkin-Elmer Corp., Foster City, CA). .. All the sequence variants were confirmed by independent PCR amplifications and sequenced in both directions.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Purification:

Article Title: A large-scale mutation search reveals genetic heterogeneity in 3M syndrome
Article Snippet: .. We purified the PCR product with exonuclease I (ExoSAPIT; Amersham Bioscience) according to the manufacturer's instructions. .. Sequencing reactions were run on an ABI 3130 sequencer using a dye terminator cycle sequencing kit (Applied Biosystems) and analysed by sequencing analysis (Applied Biosystems).

Article Title: A High-Throughput Arabidopsis Reverse Genetics System
Article Snippet: .. Before sequencing, secondary TAIL-PCR products were purified by treatment with exonuclease I (2.5 units; Amersham) and shrimp alkaline phosphatase (0.5 units; Amersham) for 20 min at 37°C, followed by 15 min at 80°C. .. Sequencing reactions were performed in a 384-well format using the T-DNA LB3 primer and one-eighth of the suggested amount of BigDye terminators and run on Applied Biosystems 3700 sequencers.

Article Title: DNA damage predicts prognosis and treatment response in colorectal liver metastases superior to immunogenic cell death and T cells
Article Snippet: .. Excess of primers and deoxynucleotides (dNTPs) was removed by incubation of 5 µL PCR product with 2.5 U exonuclease I (GE Healthcare Life Sciences, Vienna, Austria) and 2.5 U shrimp alkaline phosphatase (SAP; GE Healthcare Life Sciences) at 37°C for 1 h. Enzymes were further heat inactivated at 70°C for 15 min, following sequence analysis with 1-2 µL of the purified PCR product and 4 pmol primers using the BigDye™ Terminator Cycle Sequencing Kit (Applied Biosystems) according to the manufacturer's instructions. .. Excess of BigDye™ Terminator nucleotides was removed by centrifugation with Centri-Sep™ Spin Columns (Invitrogen, Fisher Scientific, Vienna, Austria).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    GE Healthcare exonuclase i
    Exonuclase I, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclase i/product/GE Healthcare
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    exonuclase i - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    93
    GE Healthcare exonuclease i
    Exonuclease I, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 93/100, based on 191 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i/product/GE Healthcare
    Average 93 stars, based on 191 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    85
    GE Healthcare exonuclease i shrimp alkaline phosphatase exosap it treatment
    Exonuclease I Shrimp Alkaline Phosphatase Exosap It Treatment, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 85/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i shrimp alkaline phosphatase exosap it treatment/product/GE Healthcare
    Average 85 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    exonuclease i shrimp alkaline phosphatase exosap it treatment - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    Image Search Results