exonuclease i digestion  (GE Healthcare)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Name:
    illustra Exonuclease I
    Description:

    Catalog Number:
    E70073X
    Price:
    659.00 USD
    Size:
    5000 units
    Buy from Supplier


    Structured Review

    GE Healthcare exonuclease i digestion

    https://www.bioz.com/result/exonuclease i digestion/product/GE Healthcare
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    exonuclease i digestion - by Bioz Stars, 2021-07
    95/100 stars

    Images

    Related Articles

    Polymerase Chain Reaction:

    Article Title: Resequencing and Association Analysis of PTPRA, a Possible Susceptibility Gene for Schizophrenia and Autism Spectrum Disorders
    Article Snippet: Primers for 10 amplicons ranging from lengths of 700 to 3000 bps covering all the target exons were designed with the Primer-BLAST tool by NCBI ( http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and tested for validity with UCSC In-Silico PCR ( http://genome.ucsc.edu/cgi-bin/hgPcr ). .. The Takara LA taq Kit (Takara Bio Inc. Shiga, Japan) was used for PCR amplification, and products were cleaned up with Illustra Exonuclease I and Alkaline Phosphatase (GE Healthcare & Life Science, Little Chalfont, United Kingdom). .. After that, Sanger sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, United States).

    Article Title: Epitypification and re-description of the zombie-ant fungus, Ophiocordyceps unilateralis (Ophiocordycipitaceae)
    Article Snippet: .. Each 25 μL amplification reaction was cleaned by adding 3.75 μL of Illustra ExoProStar enzymatic PCR clean up (1:1 mix of Exonuclease I and alkaline phosphatase, GE Healthcare Life Sciences), incubated at 37 °C for 1 h and 80 °C for 15 min in the thermocycler. .. The purified PCR products were sequenced by Sanger DNA sequencing [Applied Biosystems 3730xl DNA Analyzer (Life Technologies, Carlsbad, CA, USA)] at the Genomics Core Facility service at Penn State University.

    Article Title: Haplotypes at ATM Identify Coding-Sequence Variation and Indicate a Region of Extensive Linkage Disequilibrium
    Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. Sequencing of each PCR product was performed with the Thermo Sequenase [33 P]-radiolabeled terminator-cycle sequencing kit (Amersham Pharmacia), according to the manufacturer’s instructions. .. Sequencing reactions were performed in a Perkin Elmer 9700 analyzer, with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min.

    Article Title: Copy Number Variant in the Region of Adenosine Kinase (ADK) and Its Possible Contribution to Schizophrenia Susceptibility
    Article Snippet: Genomic DNA was extracted from peripheral blood using standard methods, and amplicons were generated using standard PCR conditions. .. After PCR amplification, aliquots of PCR products were purified using Illustra Exonuclease I and alkaline phosphatase (GE Healthcare & Life Science) and sequenced using the Sanger method and a 3130XL Genetic Analyzer (Applied Biosystems). .. mRNA Expression Analysis To investigate the effect of deletion of ADK mRNA transcripts, we compared the relative expression of ADK in 32 SCZ patients (44.5 ± 11.5 years of age), including a SCZ patient with deletion of ADK , with 29 healthy controls (43.9 ± 11.4 years of age) using lymphoblastoid cell lines (LCLs).

    Article Title: Prediction of Psychosis Onset in Alzheimer Disease: The Role of Depression Symptom Severity and the HTR2A T102C Polymorphism
    Article Snippet: PCR was done by combining 30ng of genomic DNA with 5pmol of each primer (Forward- 5’tctgctacaagttctggctt 3’ and Reverse- 5’ ctgcagctttttctctaggg 3’), 1× PCR buffer, 0.5mM dNTP, 1.5mM MgCl2 , and 0.5U of Ampli-Taq DNA polymerase (ABI). .. The PCR reaction mix was incubated at 94°C for 10 min and subjected to 35 cycles of 94°C for 45 s, 60°C for 45 s and 72°C for 60 s, followed by a final extension at 72°C for 7 min. 2.5ul of PCR amplified product was treated for primer extension by incubating with 1 U exonuclease I (Amersham) and 1.25 U shrimp alkaline phosphatase (Amersham) for 1hr at 37°C on a thermocycler followed by 15 min at 85°C. .. Primer extension was performed in a 5 ul reaction by combining 1 µl treated PCR product with 1.5 µl SnaPshot Kit, 0.15 pmol extension primer (5’agagtcgactgtccagttaaatgcatcagaagtgttagcttctcc 3’).

    Amplification:

    Article Title: Resequencing and Association Analysis of PTPRA, a Possible Susceptibility Gene for Schizophrenia and Autism Spectrum Disorders
    Article Snippet: Primers for 10 amplicons ranging from lengths of 700 to 3000 bps covering all the target exons were designed with the Primer-BLAST tool by NCBI ( http://www.ncbi.nlm.nih.gov/tools/primer-blast/ ) and tested for validity with UCSC In-Silico PCR ( http://genome.ucsc.edu/cgi-bin/hgPcr ). .. The Takara LA taq Kit (Takara Bio Inc. Shiga, Japan) was used for PCR amplification, and products were cleaned up with Illustra Exonuclease I and Alkaline Phosphatase (GE Healthcare & Life Science, Little Chalfont, United Kingdom). .. After that, Sanger sequencing was performed using the BigDye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, California, United States).

    Article Title: Epitypification and re-description of the zombie-ant fungus, Ophiocordyceps unilateralis (Ophiocordycipitaceae)
    Article Snippet: .. Each 25 μL amplification reaction was cleaned by adding 3.75 μL of Illustra ExoProStar enzymatic PCR clean up (1:1 mix of Exonuclease I and alkaline phosphatase, GE Healthcare Life Sciences), incubated at 37 °C for 1 h and 80 °C for 15 min in the thermocycler. .. The purified PCR products were sequenced by Sanger DNA sequencing [Applied Biosystems 3730xl DNA Analyzer (Life Technologies, Carlsbad, CA, USA)] at the Genomics Core Facility service at Penn State University.

    Article Title: Overexpression of S100A4 in Pancreatic Ductal Adenocarcinomas Is Associated with Poor Differentiation and DNA Hypomethylation
    Article Snippet: .. After incubation with exonuclease I and shrimp alkaline phosphatase (Amersham, Arlington Heights, IL), both strands of amplified products were sequenced using the Sequitherm Excel kit, as recommended by the manufacturer (Epicentre Technologies, Madison, WI). .. The methylation status of each sequence was evaluated visually by determining the percentage of the intensity of the cytosine band versus thymine band for each CpG site.

    Article Title: Copy Number Variant in the Region of Adenosine Kinase (ADK) and Its Possible Contribution to Schizophrenia Susceptibility
    Article Snippet: Genomic DNA was extracted from peripheral blood using standard methods, and amplicons were generated using standard PCR conditions. .. After PCR amplification, aliquots of PCR products were purified using Illustra Exonuclease I and alkaline phosphatase (GE Healthcare & Life Science) and sequenced using the Sanger method and a 3130XL Genetic Analyzer (Applied Biosystems). .. mRNA Expression Analysis To investigate the effect of deletion of ADK mRNA transcripts, we compared the relative expression of ADK in 32 SCZ patients (44.5 ± 11.5 years of age), including a SCZ patient with deletion of ADK , with 29 healthy controls (43.9 ± 11.4 years of age) using lymphoblastoid cell lines (LCLs).

    Article Title: Prediction of Psychosis Onset in Alzheimer Disease: The Role of Depression Symptom Severity and the HTR2A T102C Polymorphism
    Article Snippet: PCR was done by combining 30ng of genomic DNA with 5pmol of each primer (Forward- 5’tctgctacaagttctggctt 3’ and Reverse- 5’ ctgcagctttttctctaggg 3’), 1× PCR buffer, 0.5mM dNTP, 1.5mM MgCl2 , and 0.5U of Ampli-Taq DNA polymerase (ABI). .. The PCR reaction mix was incubated at 94°C for 10 min and subjected to 35 cycles of 94°C for 45 s, 60°C for 45 s and 72°C for 60 s, followed by a final extension at 72°C for 7 min. 2.5ul of PCR amplified product was treated for primer extension by incubating with 1 U exonuclease I (Amersham) and 1.25 U shrimp alkaline phosphatase (Amersham) for 1hr at 37°C on a thermocycler followed by 15 min at 85°C. .. Primer extension was performed in a 5 ul reaction by combining 1 µl treated PCR product with 1.5 µl SnaPshot Kit, 0.15 pmol extension primer (5’agagtcgactgtccagttaaatgcatcagaagtgttagcttctcc 3’).

    Incubation:

    Article Title: Epitypification and re-description of the zombie-ant fungus, Ophiocordyceps unilateralis (Ophiocordycipitaceae)
    Article Snippet: .. Each 25 μL amplification reaction was cleaned by adding 3.75 μL of Illustra ExoProStar enzymatic PCR clean up (1:1 mix of Exonuclease I and alkaline phosphatase, GE Healthcare Life Sciences), incubated at 37 °C for 1 h and 80 °C for 15 min in the thermocycler. .. The purified PCR products were sequenced by Sanger DNA sequencing [Applied Biosystems 3730xl DNA Analyzer (Life Technologies, Carlsbad, CA, USA)] at the Genomics Core Facility service at Penn State University.

    Article Title: Overexpression of S100A4 in Pancreatic Ductal Adenocarcinomas Is Associated with Poor Differentiation and DNA Hypomethylation
    Article Snippet: .. After incubation with exonuclease I and shrimp alkaline phosphatase (Amersham, Arlington Heights, IL), both strands of amplified products were sequenced using the Sequitherm Excel kit, as recommended by the manufacturer (Epicentre Technologies, Madison, WI). .. The methylation status of each sequence was evaluated visually by determining the percentage of the intensity of the cytosine band versus thymine band for each CpG site.

    Article Title: Haplotypes at ATM Identify Coding-Sequence Variation and Indicate a Region of Extensive Linkage Disequilibrium
    Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. Sequencing of each PCR product was performed with the Thermo Sequenase [33 P]-radiolabeled terminator-cycle sequencing kit (Amersham Pharmacia), according to the manufacturer’s instructions. .. Sequencing reactions were performed in a Perkin Elmer 9700 analyzer, with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min.

    Article Title: Prediction of Psychosis Onset in Alzheimer Disease: The Role of Depression Symptom Severity and the HTR2A T102C Polymorphism
    Article Snippet: PCR was done by combining 30ng of genomic DNA with 5pmol of each primer (Forward- 5’tctgctacaagttctggctt 3’ and Reverse- 5’ ctgcagctttttctctaggg 3’), 1× PCR buffer, 0.5mM dNTP, 1.5mM MgCl2 , and 0.5U of Ampli-Taq DNA polymerase (ABI). .. The PCR reaction mix was incubated at 94°C for 10 min and subjected to 35 cycles of 94°C for 45 s, 60°C for 45 s and 72°C for 60 s, followed by a final extension at 72°C for 7 min. 2.5ul of PCR amplified product was treated for primer extension by incubating with 1 U exonuclease I (Amersham) and 1.25 U shrimp alkaline phosphatase (Amersham) for 1hr at 37°C on a thermocycler followed by 15 min at 85°C. .. Primer extension was performed in a 5 ul reaction by combining 1 µl treated PCR product with 1.5 µl SnaPshot Kit, 0.15 pmol extension primer (5’agagtcgactgtccagttaaatgcatcagaagtgttagcttctcc 3’).

    Sequencing:

    Article Title: Haplotypes at ATM Identify Coding-Sequence Variation and Indicate a Region of Extensive Linkage Disequilibrium
    Article Snippet: .. Preparation of DNA for sequencing included incubation of ∼60 ng of PCR product with shrimp alkaline phosphatase (2 U; Amersham) and exonuclease I (10 U; Amersham) at 37°C for 15 min, followed by enzymatic inactivation at 80°C for 15 min. Sequencing of each PCR product was performed with the Thermo Sequenase [33 P]-radiolabeled terminator-cycle sequencing kit (Amersham Pharmacia), according to the manufacturer’s instructions. .. Sequencing reactions were performed in a Perkin Elmer 9700 analyzer, with an initial denaturation at 95°C for 1 min, followed by 35 cycles of 95°C for 30 s, 55°C for 30 s, and 72°C for 1 min.

    Purification:

    Article Title: Copy Number Variant in the Region of Adenosine Kinase (ADK) and Its Possible Contribution to Schizophrenia Susceptibility
    Article Snippet: Genomic DNA was extracted from peripheral blood using standard methods, and amplicons were generated using standard PCR conditions. .. After PCR amplification, aliquots of PCR products were purified using Illustra Exonuclease I and alkaline phosphatase (GE Healthcare & Life Science) and sequenced using the Sanger method and a 3130XL Genetic Analyzer (Applied Biosystems). .. mRNA Expression Analysis To investigate the effect of deletion of ADK mRNA transcripts, we compared the relative expression of ADK in 32 SCZ patients (44.5 ± 11.5 years of age), including a SCZ patient with deletion of ADK , with 29 healthy controls (43.9 ± 11.4 years of age) using lymphoblastoid cell lines (LCLs).

    Article Title: DNA-based identification reveals illegal trade of threatened shark species in a global elasmobranch conservation hotspot
    Article Snippet: .. Amplicons were purified using Illustra Exo Prostar (GE Healthcare Life Sciences) or PEG 8000. .. Sequencing was carried out using BigDye terminator v3.1 kit (Applied Biosystems) in an ABI XL 3500 (Applied Biosystems).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    GE Healthcare exonuclease i
    Exonuclease I, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/exonuclease i/product/GE Healthcare
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    exonuclease i - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results