Structured Review

Fisher Scientific ex taq polymerase
Ex Taq Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ex taq polymerase/product/Fisher Scientific
Average 86 stars, based on 3 article reviews
Price from $9.99 to $1999.99
ex taq polymerase - by Bioz Stars, 2020-04
86/100 stars

Images

Related Articles

Clone Assay:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: Paragraph title: Cloning and Expression of CYP82 Candidates ... Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′.

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of ATG8a were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, RR001A, Invitrogen, Waltham, MA, USA) using specific primers containing Gateway attB sites and then cloned into the pDONR207 entry vector ( ) using the BP Clonase II (rformed as described in the Life Technologies, Invitrogen) to create ATG8a entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pCL112_JO ( ) for BiFC.

Amplification:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively. .. A 3-step PCR was performed on an Applied Biosystems 2720 Thermal Cycler under the following conditions: 96°C for 2 min, 30 cycles (94°C for 30 s, 60°C for 1 min, and 72°C for 2 min), extend 72°C for 7 min, and soak at 4°C.

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: .. Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. Based on the GenBank sequence (accession number ), we designed a set of primers for amplification, as recommended by the manufacturers, and a set of primers for sequencing the overlapping segments in two directions ( ) using the Web primers design program ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of ATG8a were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, RR001A, Invitrogen, Waltham, MA, USA) using specific primers containing Gateway attB sites and then cloned into the pDONR207 entry vector ( ) using the BP Clonase II (rformed as described in the Life Technologies, Invitrogen) to create ATG8a entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pCL112_JO ( ) for BiFC.

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: .. The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA). .. The PCR conditions were as follows: an initial denaturation step at 94°C for 2 min; 30 subsequent cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min; and no final extension step.

Synthesized:

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively. .. We also designed forward primers specific to the rs12325817 allele using GeneFisher ( ) so that the SNP would be located at the 3′-end of the priming sequence, which allows for specific PCR products to be synthesized only if the primer is 100% complementary to its template DNA.

Construct:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: The 35S::AtRGS1-YFP construct was transformed into Agrobacterium EHA105, which was then used to transform WT, atg2 , and atg5 by the floral-dip method [ ], homozygous lines of transgenic plants were used in this study. .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones.

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′. .. A synthetic CYP82X2 gene based on native nucleotide sequences was constructed (Genscript, Piscataway, NJ) by replacing the first 60 N-terminal amino acids of CYP82X2 with 43 N-terminal amino acids from lettuce germacrene A oxidase to improve heterologous expression in yeast ( ).

Incubation:

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: Plates were read with an automated Biolog MicroStation reader after incubation at 30°C for 16 to 24 h. Identifications were made using the Biolog gram-negative database (release 4.20). .. The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA).

Activity Assay:

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: .. Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. Based on the GenBank sequence (accession number ), we designed a set of primers for amplification, as recommended by the manufacturers, and a set of primers for sequencing the overlapping segments in two directions ( ) using the Web primers design program ( ).

Expressing:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. The 35S::AtRGS1-RFP construct were transformed into Agrobacterium EHA105, which was then used to transform the transgenic Arabidopsis expressing GFP-ATG8a (Dr. Faqiang Li providing) by the floral-dip method [ ]; homozygous line RGS1-RFP/GFP-ATG8a of transgenic plants was used in this study ( ).

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: Paragraph title: Cloning and Expression of CYP82 Candidates ... Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′.

Article Title: Arabidopsis LORELEI, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1 [OPEN]
Article Snippet: TaKaRa Ex Taq DNA Polymerase (Fisher Scientific; catalog no. TAK_RR01BM) was used to carry out RT-PCR as follows: 94°C (denaturation) for 15 s, 55°C (annealing) for 15 s, and 72°C (extension) for 1 min for 41 cycles. .. RNA isolation and RT-PCR for LRE expression in 8-d-old seedlings, including the roots, were performed similarly ( ).

Transformation Assay:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: The 35S::AtRGS1-YFP construct was transformed into Agrobacterium EHA105, which was then used to transform WT, atg2 , and atg5 by the floral-dip method [ ], homozygous lines of transgenic plants were used in this study. .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones.

Derivative Assay:

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: .. Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′. .. A synthetic CYP82X2 gene based on native nucleotide sequences was constructed (Genscript, Piscataway, NJ) by replacing the first 60 N-terminal amino acids of CYP82X2 with 43 N-terminal amino acids from lettuce germacrene A oxidase to improve heterologous expression in yeast ( ).

Sequencing:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: Based on a comprehensive whole-genome sequence analysis of A. faecis LMG 28519 reference strain, six virulence ( cad F, cia B irg A, mvi N, pld A and tyl A), two antibiotic resistance [ tet (O) and tet (W)] and two cytolethal distending toxin ( cdt A and cdt C) genes were identified. .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay.

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: Sequence results were interpreted by using the program Sequencher (Gene Code Corp, Ann Arbor, MI). .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively.

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. Based on the GenBank sequence (accession number ), we designed a set of primers for amplification, as recommended by the manufacturers, and a set of primers for sequencing the overlapping segments in two directions ( ) using the Web primers design program ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: Gene-specific primers design, development and optimization of mono- and multiplex PCR assays for A. faecis Based on a comprehensive whole-genome sequence analysis of A. faecis LMG 28519 reference strain, six virulence (cad F, cia B irg A, mvi N, pld A and tyl A), two antibiotic resistance [tet (O) and tet (W)] and two cytolethal distending toxin (cdt A and cdt C) genes were identified. .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay.

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: The coding regions of ATG8a were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, RR001A, Invitrogen, Waltham, MA, USA) using specific primers containing Gateway attB sites and then cloned into the pDONR207 entry vector ( ) using the BP Clonase II (rformed as described in the Life Technologies, Invitrogen) to create ATG8a entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pCL112_JO ( ) for BiFC.

Polymerase Chain Reaction:

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Deafness and Retinal Degeneration in A Novel USH1C Knock-In Mouse Model
Article Snippet: .. PCR analysis was also used to detect the Cdh23753 genotypes (GG, GA, AA) ( ) with 1.25 U TaKaRa Ex Taq polymerase (Fisher Scientific, Waltham, MA) and 0.4 μM primers (CdhF 5′-ggacacccatcttcatcgtcaac-3′; CdhR 5′-gtcccttatcctggtccacagca-3′) flanking nucleotide 753 in exon 7. .. PCR products were gel purified and sequenced on an ABI 3100 using the fluorescent dideoxy terminator method.

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: DNA sequencing was performed on double-stranded DNA templates obtained from genomic DNA by polymerase chain reaction (PCR) amplification. .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively.

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. The forward and reverse primers were 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively, and a three-step PCR was performed on an Applied Biosystems 2720 Thermal Cycler under the following conditions: 96°C for 2 min; 30 cycles (94°C for 30 s, 60°C for 1 min, 72°C for 2 min); extend 72°C for 7 min, and soak at 4°C.

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: .. The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA). .. The PCR conditions were as follows: an initial denaturation step at 94°C for 2 min; 30 subsequent cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min; and no final extension step.

DNA Sequencing:

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: DNA sequencing was performed on double-stranded DNA templates obtained from genomic DNA by polymerase chain reaction (PCR) amplification. .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Arabidopsis LORELEI, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1 [OPEN]
Article Snippet: .. TaKaRa Ex Taq DNA Polymerase (Fisher Scientific; catalog no. TAK_RR01BM) was used to carry out RT-PCR as follows: 94°C (denaturation) for 15 s, 55°C (annealing) for 15 s, and 72°C (extension) for 1 min for 41 cycles. .. RNA isolation and RT-PCR for LRE expression in 8-d-old seedlings, including the roots, were performed similarly ( ).

Isolation:

Article Title: Deafness and Retinal Degeneration in A Novel USH1C Knock-In Mouse Model
Article Snippet: Tail snip DNA was isolated, and the Ush1c216 genotypes (GG, GA, AA) were detected by PCR as reported by . .. PCR analysis was also used to detect the Cdh23753 genotypes (GG, GA, AA) ( ) with 1.25 U TaKaRa Ex Taq polymerase (Fisher Scientific, Waltham, MA) and 0.4 μM primers (CdhF 5′-ggacacccatcttcatcgtcaac-3′; CdhR 5′-gtcccttatcctggtccacagca-3′) flanking nucleotide 753 in exon 7.

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: Briefly, genomic DNA was extracted from liver tissues by using TriZol (Invitrogen, Carlsbad, CA) and from peripheral lymphocytes isolated from blood by using PureGene (Gentra Systems, Minneapolis, MN) according to the manufacturer's instructions. .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively.

Article Title: Arabidopsis LORELEI, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1 [OPEN]
Article Snippet: The RNeasy Plant Mini Kit (Qiagen; catalog no. 74904), DNase I (RNase free; Life Technologies; catalog no. AM2222), and the RNeasy MinElute Cleanup Kit (Qiagen; catalog no. 74204) were used for RNA isolation, digestion of contaminating genomic DNA, and RNA purification, respectively. .. TaKaRa Ex Taq DNA Polymerase (Fisher Scientific; catalog no. TAK_RR01BM) was used to carry out RT-PCR as follows: 94°C (denaturation) for 15 s, 55°C (annealing) for 15 s, and 72°C (extension) for 1 min for 41 cycles.

Bimolecular Fluorescence Complementation Assay:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: Paragraph title: 4.4. BiFC ... The coding regions of ATG8a were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, RR001A, Invitrogen, Waltham, MA, USA) using specific primers containing Gateway attB sites and then cloned into the pDONR207 entry vector ( ) using the BP Clonase II (rformed as described in the Life Technologies, Invitrogen) to create ATG8a entry clones.

Multiplex Assay:

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: Paragraph title: Gene-specific primers design, development and optimization of mono- and multiplex PCR assays for A. faecis ... The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay.

Mouse Assay:

Article Title: Deafness and Retinal Degeneration in A Novel USH1C Knock-In Mouse Model
Article Snippet: Paragraph title: Genotyping mice for Ush1c216 and Cdh23753 alleles ... PCR analysis was also used to detect the Cdh23753 genotypes (GG, GA, AA) ( ) with 1.25 U TaKaRa Ex Taq polymerase (Fisher Scientific, Waltham, MA) and 0.4 μM primers (CdhF 5′-ggacacccatcttcatcgtcaac-3′; CdhR 5′-gtcccttatcctggtccacagca-3′) flanking nucleotide 753 in exon 7.

Transgenic Assay:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: Paragraph title: 4.2. Arabidopsis Thaliana Mutants and Transgenic Lines ... The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones.

Purification:

Article Title: Deafness and Retinal Degeneration in A Novel USH1C Knock-In Mouse Model
Article Snippet: PCR analysis was also used to detect the Cdh23753 genotypes (GG, GA, AA) ( ) with 1.25 U TaKaRa Ex Taq polymerase (Fisher Scientific, Waltham, MA) and 0.4 μM primers (CdhF 5′-ggacacccatcttcatcgtcaac-3′; CdhR 5′-gtcccttatcctggtccacagca-3′) flanking nucleotide 753 in exon 7. .. PCR products were gel purified and sequenced on an ABI 3100 using the fluorescent dideoxy terminator method.

Article Title: Arabidopsis LORELEI, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1 [OPEN]
Article Snippet: The RNeasy Plant Mini Kit (Qiagen; catalog no. 74904), DNase I (RNase free; Life Technologies; catalog no. AM2222), and the RNeasy MinElute Cleanup Kit (Qiagen; catalog no. 74204) were used for RNA isolation, digestion of contaminating genomic DNA, and RNA purification, respectively. .. TaKaRa Ex Taq DNA Polymerase (Fisher Scientific; catalog no. TAK_RR01BM) was used to carry out RT-PCR as follows: 94°C (denaturation) for 15 s, 55°C (annealing) for 15 s, and 72°C (extension) for 1 min for 41 cycles.

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA). .. Amplicons were extracted and purified using a QIAEX II gel extraction kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.

Plasmid Preparation:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′. .. For heterologous production of FLAG-tagged CYP82 cDNAs, the cognate cDNAs were ligated into the NotI and SpeI restriction sites of the dual plasmid pESC-leu2d::CPR ( , ) yielding pESC-Leu2d:: CYP82X1/CPR , pESC-Leu2d:: CYP82X2/CPR , and pESC-Leu2d:: CYP82Y1/CPR .

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of ATG8a were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, RR001A, Invitrogen, Waltham, MA, USA) using specific primers containing Gateway attB sites and then cloned into the pDONR207 entry vector ( ) using the BP Clonase II (rformed as described in the Life Technologies, Invitrogen) to create ATG8a entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pCL112_JO ( ) for BiFC.

Negative Control:

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′. .. Yeast harboring pESC-leu2d:: CPR was used as the negative control.

CTG Assay:

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: .. The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA). .. The PCR conditions were as follows: an initial denaturation step at 94°C for 2 min; 30 subsequent cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and elongation at 72°C for 1 min; and no final extension step.

Gel Extraction:

Article Title: Antimicrobial Susceptibilities of Aeromonas spp. Isolated from Environmental Sources ▿
Article Snippet: The gyrB gene from each isolate was amplified by PCR using primers GyrB3F (5′-TCC GGC GGT CTG CAC GGC GT-3′) and GyrB14R (5′-TTG TCC GGG TTG TAC TCG TC-3′) ( ) and TaKaRa Ex Taq polymerase (Fisher Scientific) in a GeneAmp PCR System 9600 (Perkin-Elmer, Wellesley, MA). .. Amplicons were extracted and purified using a QIAEX II gel extraction kit (QIAGEN, Valencia, CA) according to the manufacturer's instructions.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Fisher Scientific ex taq polymerase
    Ex Taq Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq polymerase/product/Fisher Scientific
    Average 86 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    ex taq polymerase - by Bioz Stars, 2020-04
    86/100 stars
      Buy from Supplier

    87
    Fisher Scientific ex taq dna polymerase premix
    Ex Taq Dna Polymerase Premix, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq dna polymerase premix/product/Fisher Scientific
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ex taq dna polymerase premix - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    Image Search Results