Structured Review

Fisher Scientific ex taq polymerase
Ex Taq Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 92/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ex taq polymerase/product/Fisher Scientific
Average 92 stars, based on 4 article reviews
Price from $9.99 to $1999.99
ex taq polymerase - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Clone Assay:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Amplification:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Docosahexaenoic acid in plasma phosphatidylcholine may be a potential marker for in vivo phosphatidylethanolamine N-methyltransferase activity in humans 1-methyltransferase activity in humans 1 2-methyltransferase activity in humans 1 2 3
Article Snippet: .. Successful amplification of the 1896–base pair DNA fragment of the PEMT gene was performed by using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ) with forward and reverse primers: 5′GAGCACGTGAGCTGTCAGTGCCTTTTG3′ and 5′CCAACCTCCTTCATACAACAGAGGTCC3′, respectively. .. A 3-step PCR was performed on an Applied Biosystems 2720 Thermal Cycler under the following conditions: 96°C for 2 min, 30 cycles (94°C for 30 s, 60°C for 1 min, and 72°C for 2 min), extend 72°C for 7 min, and soak at 4°C.

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: .. Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. Based on the GenBank sequence (accession number ), we designed a set of primers for amplification, as recommended by the manufacturers, and a set of primers for sequencing the overlapping segments in two directions ( ) using the Web primers design program ( ).

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Polymerase Chain Reaction:

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Article Title: Deafness and Retinal Degeneration in A Novel USH1C Knock-In Mouse Model
Article Snippet: .. PCR analysis was also used to detect the Cdh23753 genotypes (GG, GA, AA) ( ) with 1.25 U TaKaRa Ex Taq polymerase (Fisher Scientific, Waltham, MA) and 0.4 μM primers (CdhF 5′-ggacacccatcttcatcgtcaac-3′; CdhR 5′-gtcccttatcctggtccacagca-3′) flanking nucleotide 753 in exon 7. .. PCR products were gel purified and sequenced on an ABI 3100 using the fluorescent dideoxy terminator method.

Article Title: Novel virulence, antibiotic resistance and toxin gene-specific PCR-based assays for rapid pathogenicity assessment of Arcobacter faecis and Arcobacter lanthieri
Article Snippet: .. The PCR amplification reaction for each individual assay was carried out in the Mastercycler Gradient PCR system (Eppendorf, Hauppauge, NY), with a 25 μL reaction mixture containing 10-50 ng of A. faecis LMG 28519 DNA template, 1 U of Ex-Taq DNA polymerase and the compatible PCR reagents, including 1× buffer with MgCl2 , 200 μM each of the dNTPs (Fisher Scientific, Nepean, ON), 0.1 μM of each set of the forward and reverse primer pair by adjusting volume to 25 μl with sterile distilled water in each monoplex PCR assay. .. The PCR reactions were conducted with an initial template denaturation (94°C for 3 min) followed by 35 cycles of amplification (denaturation at 94°C for 30 s, annealing ranging from 54 to 59°C for 30 s and extension at 72°C for 30 s) ending with a 5 min extension at 72°C for individual target genes.

Activity Assay:

Article Title: Common genetic polymorphisms affect the human requirement for the nutrient choline
Article Snippet: .. Successful amplification of the 1896 bp DNA fragment of the PEMT gene was performed using Takara Ex Taq polymerase (Fisher Scientific, Fair Lawn, NJ, USA) with an efficient 3′-5′ exonuclease activity for increased fidelity. .. Based on the GenBank sequence (accession number ), we designed a set of primers for amplification, as recommended by the manufacturers, and a set of primers for sequencing the overlapping segments in two directions ( ) using the Web primers design program ( ).

Derivative Assay:

Article Title: CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy *
Article Snippet: .. Full-length coding regions of CYP82X1 and CYP82Y1 were amplified from cDNA derived from total stem RNA of the Bea's Choice chemotype using Takara Ex Taq DNA polymerase (Fisher Scientific, Ottawa, Canada) and the following primer sets: CYP82X1 , 5′-GCGGCCGCGCCATGGAGTTATTCATAAAG and 5′-CATACCTAGTGCAACCCATGAATAAGAGCCGC; CYP82Y1 , 5′-ATTAGCGGCCGCACCATGGCGTATTTGATGATCAA-3′ and 5′-CATAACTAGTGCATCTAGTGTGCGTGGGGTGA-3′. .. A synthetic CYP82X2 gene based on native nucleotide sequences was constructed (Genscript, Piscataway, NJ) by replacing the first 60 N-terminal amino acids of CYP82X2 with 43 N-terminal amino acids from lettuce germacrene A oxidase to improve heterologous expression in yeast ( ).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Arabidopsis LORELEI, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1, a Maternally Expressed Imprinted Gene, Promotes Early Seed Development 1 [OPEN]
Article Snippet: .. TaKaRa Ex Taq DNA Polymerase (Fisher Scientific; catalog no. TAK_RR01BM) was used to carry out RT-PCR as follows: 94°C (denaturation) for 15 s, 55°C (annealing) for 15 s, and 72°C (extension) for 1 min for 41 cycles. .. RNA isolation and RT-PCR for LRE expression in 8-d-old seedlings, including the roots, were performed similarly ( ).

Plasmid Preparation:

Article Title: Correlation of Autophagosome Formation with Degradation and Endocytosis Arabidopsis Regulator of G-Protein Signaling (RGS1) through ATG8a
Article Snippet: .. The coding regions of RGS1 were amplified with TaKaRa Ex Taq DNA Polymerase (Fisher Scientific, R001A) using specific primers containing Gateway attB sites and then cloned into pDONR207 ( ) entry vector using the BP Clonase II (Life Technologies) to create RGS1 entry clones. .. After verification by sequencing, each clone was mobilized using the LR Clonase II (Life Technologies) into the Gateway destination vector pK7RWG2 ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Fisher Scientific ex taq polymerase
    Ex Taq Polymerase, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 92/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq polymerase/product/Fisher Scientific
    Average 92 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    ex taq polymerase - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    86
    Fisher Scientific ex taq dna polymerase premix
    Ex Taq Dna Polymerase Premix, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ex taq dna polymerase premix/product/Fisher Scientific
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ex taq dna polymerase premix - by Bioz Stars, 2020-07
    86/100 stars
      Buy from Supplier

    Image Search Results