escherichia coli one shot top10 cells  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88

    Structured Review

    Thermo Fisher escherichia coli one shot top10 cells
    Escherichia Coli One Shot Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli one shot top10 cells/product/Thermo Fisher
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    escherichia coli one shot top10 cells - by Bioz Stars, 2020-09
    88/100 stars

    Images

    Related Articles

    Selection:

    Article Title: sCD4-17b bifunctional protein: Extremely broad and potent neutralization of HIV-1 Env pseudotyped viruses from genetically diverse primary isolates
    Article Snippet: .. Plasmids were transformed into E. coli One Shot Top10 cells (Invitrogen) and grown under kanamycin selection. .. DNA was prepared using a Plasmid Maxi Kit (Qiagen).

    Isolation:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    Article Title: Enhanced Bovine Herpesvirus Type 1 Neutralization by Multimerized Single-Chain Variable Antibody Fragments Regardless of Differential Glycosylation
    Article Snippet: .. The ligate was used to transform E. coli One Shot TOP10 cells (Invitrogen), and plasmids isolated from zeocin-resistant colonies (QIAprep miniprep; Qiagen Inc.) were sequenced (Mobix, McMaster University, Hamilton, Ontario, Canada). .. Electrocompetent P. pastoris strain KM71H (Muts Arg+ ; Invitrogen) cells were prepared according to the manufacturer's instructions for EasySelect.

    Polymerase Chain Reaction:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    other:

    Article Title: The transcriptome response of Neisseria gonorrhoeae to hydrogen peroxide reveals genes with previously uncharacterized roles in oxidative damage protection
    Article Snippet: Escherichia coli One Shot TOP10 cells (Invitrogen) were grown on Luria-Bertani (LB) broth or agar (Difco) at 37°C to propagate plasmids.

    DNA Sequencing:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    DNA Purification:

    Article Title: Characterizing the soil microbiome and quantifying antibiotic resistance gene dynamics in agricultural soil following swine CAFO manure application
    Article Snippet: .. Plasmids were transformed into Escherichia coli One Shot TOP10 Cells (Thermofisher, Waltham, MA) using the manufacturer’s instructions and were extracted using the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI) following the manufacturer’s instructions. .. Plasmid copy number was calculated using the NanoDrop One Microvolume UV-Vis Spectrophotometer (ThermoFisher, Waltham, MA).

    Sequencing:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    Transformation Assay:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    Article Title: Proteasomal Protein Degradation in Mycobacteria Is Dependent upon a Prokaryotic Ubiquitin-like Protein *Proteasomal Protein Degradation in Mycobacteria Is Dependent upon a Prokaryotic Ubiquitin-like Protein * S⃞
    Article Snippet: .. E. coli One Shot TOP10 cells (Invitrogen) were used for transformation, propagation, and storage. .. Primers spolyGf, TACCAAGCTTGGAGCCCCTGCGCGGGAG, and smeghis2, CATATGATGATGATGATGATGATGCATCGCTGCCTCCTGCAAAAGTC, were used to amplify about 200 bp upstream pup and introduce a 7× histidine tag at the amino terminus.

    Article Title: sCD4-17b bifunctional protein: Extremely broad and potent neutralization of HIV-1 Env pseudotyped viruses from genetically diverse primary isolates
    Article Snippet: .. Plasmids were transformed into E. coli One Shot Top10 cells (Invitrogen) and grown under kanamycin selection. .. DNA was prepared using a Plasmid Maxi Kit (Qiagen).

    Article Title: Characterization of immune response against Mycobacterium marinum infection in the main hematopoietic organ of adult zebrafish (Danio rerio).
    Article Snippet: .. Both plasmids were transformed into E. coli One Shot TOP10 cells (Invitrogen™, Thermo Fisher Scientific, Waltham, Massachusetts, USA). .. Plasmid DNA was extracted with QIAGEN Plasmid Plus Maxi Kit (Qiagen, Hilden, Germany) and sequenced to confirm successful transformation.

    Article Title: Characterizing the soil microbiome and quantifying antibiotic resistance gene dynamics in agricultural soil following swine CAFO manure application
    Article Snippet: .. Plasmids were transformed into Escherichia coli One Shot TOP10 Cells (Thermofisher, Waltham, MA) using the manufacturer’s instructions and were extracted using the Wizard Plus SV Minipreps DNA Purification System (Promega, Madison, WI) following the manufacturer’s instructions. .. Plasmid copy number was calculated using the NanoDrop One Microvolume UV-Vis Spectrophotometer (ThermoFisher, Waltham, MA).

    Plasmid Preparation:

    Article Title: Roles of the Redox-Active Disulfide and Histidine Residues Forming a Catalytic Dyad in Reactions Catalyzed by 2-Ketopropyl Coenzyme M Oxidoreductase/Carboxylase ▿
    Article Snippet: .. PCR products were then ligated into a pBAD Directional TOPO vector (Invitrogen) according to the manufacturer's protocol to generate plasmid pDW1, which was then transformed into Escherichia coli One Shot Top10 cells (Invitrogen). pDW1 was isolated and the insert sequence was confirmed by DNA sequencing at the Center for Integrated BioSystems, Utah State University. .. Site-directed mutagenesis of pDW1 was carried out by utilizing a QuikChange site-directed mutagenesis kit (Stratagene) according to the manufacturer's protocols.

    Article Title: Organization of Monoterpene Biosynthesis in Mentha. Immunocytochemical Localizations of Geranyl Diphosphate Synthase, Limonene-6-Hydroxylase, Isopiperitenol Dehydrogenase, and Pulegone Reductase 1
    Article Snippet: .. The cDNA encoding IPD was also subcloned into the pBAD-TOPO vector (Invitrogen, Carlsbad, CA) and expressed in E. coli One Shot TOP10 cells (Invitrogen) to generate a fusion protein bearing a C-terminal His6 tag. .. One-liter cultures were grown to an optical density of A 600 = 0.5, induced with 0.1% Ara, and then grown overnight at 17°C.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher one shot top10 cells
    One Shot Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 297 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one shot top10 cells/product/Thermo Fisher
    Average 99 stars, based on 297 article reviews
    Price from $9.99 to $1999.99
    one shot top10 cells - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    88
    Thermo Fisher escherichia coli one shot top10 cells
    Escherichia Coli One Shot Top10 Cells, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 88/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli one shot top10 cells/product/Thermo Fisher
    Average 88 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    escherichia coli one shot top10 cells - by Bioz Stars, 2020-09
    88/100 stars
      Buy from Supplier

    Image Search Results