escherichia coli jm109 high efficiency competent cells  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    Promega escherichia coli jm109 high efficiency competent cells
    Escherichia Coli Jm109 High Efficiency Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 7 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli jm109 high efficiency competent cells/product/Promega
    Average 91 stars, based on 7 article reviews
    Price from $9.99 to $1999.99
    escherichia coli jm109 high efficiency competent cells - by Bioz Stars, 2020-01
    91/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Mutualism breakdown in breadfruit domestication
    Article Snippet: .. These were purified using the QiAquick PCR purification kit (Qiagen) and cloned using the pGEM-T vector (Promega, USA) and Escherichia coli JM109 High Efficiency Competent cells (Promega). ..

    Article Title: Identification and Minisequencing-Based Discrimination of SHV ?-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia
    Article Snippet: .. Amplicons generated from the clinical isolates A1, F2, J1, J2, and L1 using primers SHV-F and SHV-R were cloned using the pGEMt plasmid kit (Promega) and JM109 High Efficiency competent Escherichia coli cells (Promega). .. Ten to twenty clones were selected for each isolate, and secondary PCR products were generated from these clones for sequencing and FNC analysis.

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI). .. Based on the PCR-DGGE analyses, cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, Netherlands).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
    Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA). ..

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced. .. The nucleotide sequence of the cloned Carassius auratus CB2 340 bp fragment is available at GenBank (accession number: ).

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions. .. The 16S rRNA clones sharing nucleotide sequence homology at more than 99% were grouped into one operational taxonomic unit (OTU) using DOTUR program ver.

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: .. After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions. .. DNA inserts from randomly selected clones were amplified by PCR with vector primers T7-1 and SP6, and sequenced as described previously ( ).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: Primary and secondary PCRs were carried out in 50‐μL reaction volumes containing 2.5 units Easy‐A High Fidelity PCR Cloning Enzyme (Stratagene, La Jolla, CA, USA), 1 × Easy‐A reaction buffer, 0.5 μ m adapter primers (AP1/AP2, Stratagene), 0.5 μ m ), 200 μ m of each dNTP and 1 μL of library DNA. .. Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Amplification:

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: Paragraph title: Amplification, Cloning, and Sequencing ... Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions.

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI). .. Barcoded amplicon pyrosequencing was used to analyze 16S rRNA genes of total J2-associated bacteria.

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The fungal ITS fragments were amplified using a nested PCR approach with primer pairs ITS1F / ITS4 and ITS1FGC / ITS2. .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: Integron gene cassettes from the pooled community DNA from all sites were amplified, using primers previously described , . .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: The 380 bp amplification product was cloned into pGEM-T-easy vector, using pGEM-T-easy Vector System (Promega, Madison, USA). .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: For clone library analysis, DNA and cDNA samples were amplified with the modified primers 27F and 1492R , Cd3aF and R3cd , F1aCu and R3Cu ( ) and nosZ-F-1181 and nosZ-R-1880 ( ) for the bacterial 16S rRNA gene, nirS , nirK and nosZ , respectively. .. The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions.

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: For culture-independent clone library analysis of the microbial community in the heavy fractions from 13SN and 13Su samples, the 16S rRNA gene and nosZ were PCR amplified using primers m-27F and m-1492R ( ) and nosZ-F-1181 and nosZ-R-1880 , respectively. .. After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions.

    Synthesized:

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: DNA contaminants were eliminated using TURBO DNA-free kit (Applied Biosystems, Foster City, USA). cDNA was synthesized from total RNA by using Multiscribe RT (Applied Biosystems) and random nonamers. .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Single‐stranded cDNA (cDNAss) was synthesized by reverse transcription with the SuperScript II Reverse Transcriptase from 1 μg of total RNA using an ADAPTER‐oligo(dT17), where ADAPTER means a sequence 5′‐AAGCAGTGGTATCAACGCAGAGTAC‐3′ added to the 5′‐end of the oligo(dT17), following the manufacturers’ directions (Invitrogen, Waltham, MA, USA). .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega).

    Construct:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: In order to construct the subtype reference plasmids, RNA was isolated from the viral reference culture supernatants with the Boom extraction method and used for RT‐PCR with Superscript‐III One‐Step Platinum Taq (Invitrogen, Carlsbad, CA, USA) and nested PCR with Platinum Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) using isolate‐specific primers (Tables ). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Incubation:

    Article Title: Sequence Determinants of DNA Binding by the Hematopoietic Helix-Loop-Helix Transcription Factor TAL1: Importance of Sequences Flanking the E-Box Core
    Article Snippet: The samples were then incubated with 10 μl of 50% protein A-Sepharose for 1 h at 4°C with constant rotation. .. The resuspended genomic DNA was ligated into Hin dIII linearized pB2SK+ vector (Stratagene) and used to transform high-efficiency Escherichia coli JM109 competent cells (Promega).

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: For samples with low concentrations of PCR template (nirK and nosZ amplicons from RNA samples and nirS amplicons from RNA samples extracted from the soil before incubation), a second PCR reaction was performed using a 10-fold diluted product of the first PCR reaction as the template. .. The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions.

    Modification:

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: For clone library analysis, DNA and cDNA samples were amplified with the modified primers 27F and 1492R , Cd3aF and R3cd , F1aCu and R3Cu ( ) and nosZ-F-1181 and nosZ-R-1880 ( ) for the bacterial 16S rRNA gene, nirS , nirK and nosZ , respectively. .. The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions.

    Transformation Assay:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen). .. Plasmids were digested using Eco RI and Buffer H (Roche, Basel, Switzerland) prior to diluting, in order to ensure the repeatability of the dilutions.

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA). ..

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced. .. The nucleotide sequence of the cloned Carassius auratus CB2 340 bp fragment is available at GenBank (accession number: ).

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: .. After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions. .. DNA inserts from randomly selected clones were amplified by PCR with vector primers T7-1 and SP6, and sequenced as described previously ( ).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: .. Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega). .. Purified plasmid DNA was sequenced by MWG Eurofins Operon (Ebersberg, Germany) using the primers M13uni(‐21) and M13rev(‐29).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Cell Culture:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen). .. Plasmids were digested using Eco RI and Buffer H (Roche, Basel, Switzerland) prior to diluting, in order to ensure the repeatability of the dilutions.

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Generated:

    Article Title: Mutualism breakdown in breadfruit domestication
    Article Snippet: We generated an experiment-wide clone library using amplicons pooled across the six cultivation sites. .. These were purified using the QiAquick PCR purification kit (Qiagen) and cloned using the pGEM-T vector (Promega, USA) and Escherichia coli JM109 High Efficiency Competent cells (Promega).

    Article Title: Identification and Minisequencing-Based Discrimination of SHV ?-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia
    Article Snippet: .. Amplicons generated from the clinical isolates A1, F2, J1, J2, and L1 using primers SHV-F and SHV-R were cloned using the pGEMt plasmid kit (Promega) and JM109 High Efficiency competent Escherichia coli cells (Promega). .. Ten to twenty clones were selected for each isolate, and secondary PCR products were generated from these clones for sequencing and FNC analysis.

    Polymerase Chain Reaction:

    Article Title: Mutualism breakdown in breadfruit domestication
    Article Snippet: .. These were purified using the QiAquick PCR purification kit (Qiagen) and cloned using the pGEM-T vector (Promega, USA) and Escherichia coli JM109 High Efficiency Competent cells (Promega). ..

    Article Title: Identification and Minisequencing-Based Discrimination of SHV ?-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia
    Article Snippet: Amplicons generated from the clinical isolates A1, F2, J1, J2, and L1 using primers SHV-F and SHV-R were cloned using the pGEMt plasmid kit (Promega) and JM109 High Efficiency competent Escherichia coli cells (Promega). .. Ten to twenty clones were selected for each isolate, and secondary PCR products were generated from these clones for sequencing and FNC analysis.

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: Amplicons were purified from PCR reactions with Qiaquick PCR Purification kit (Qiagen, Hilden, Germany), A‐tailed with DreamTaq DNA polymerase (Thermo Fisher Scientific), again purified with the Qiaquick PCR purification kit (Qiagen), ligated into vector pGEM‐T Easy (Promega, Madison, WI, USA) using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) and again purified with the Qiaquick PCR Purification kit (Qiagen). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI). .. Based on the PCR-DGGE analyses, cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, Netherlands).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
    Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: Paragraph title: DNA extraction, PCR, Cloning and Sequencing ... The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: PCR was performed for 40 cycles, at 45 °C annealing temperature, using Hot Start AmpliTaq Gold360 polymerase (Applied Biosystems). .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: .. The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions. .. The 16S rRNA clones sharing nucleotide sequence homology at more than 99% were grouped into one operational taxonomic unit (OTU) using DOTUR program ver.

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: .. After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions. .. DNA inserts from randomly selected clones were amplified by PCR with vector primers T7-1 and SP6, and sequenced as described previously ( ).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: .. Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega). .. Purified plasmid DNA was sequenced by MWG Eurofins Operon (Ebersberg, Germany) using the primers M13uni(‐21) and M13rev(‐29).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: In order to construct the subtype reference plasmids, RNA was isolated from the viral reference culture supernatants with the Boom extraction method and used for RT‐PCR with Superscript‐III One‐Step Platinum Taq (Invitrogen, Carlsbad, CA, USA) and nested PCR with Platinum Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) using isolate‐specific primers (Tables ). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Denaturing Gradient Gel Electrophoresis:

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: For the DGGE fingerprints of bacterial groups and fungal ITS fragments that showed nematode-specific bands, PCR products were cloned and sequenced to identify the corresponding microbial species by sequence comparison to the GenBank entries. .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
    Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Cellular Antioxidant Activity Assay:

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: The 5’ sense primer, corresponding to zebrafish CB2 bases 437–456 (considering position 1 as the first nucleotide of the coding sequence), was as follows: 5’-TTT GCA TCT ACC AGG CTT CC-3’; the 3’ antisense primer, corresponding to zebrafish CB2 bases 797–816, had the following sequence: 5’-CAG GAT TAG AAG GAT CAA AC-3’. .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    DNA Extraction:

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: Paragraph title: DNA extraction, PCR, Cloning and Sequencing ... The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: Paragraph title: DNA extraction and PbCYP51 sequencing ... Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Fluorescence:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Insert‐bearing plasmids for each 3′‐RACE fragment were DNA sequenced on both strands on an ABI prism multicolor fluorescence‐based DNA analysis system (Applied Biosystems, Foster City, CA, USA), using the Taq Dye‐Deoxy Terminator Cycle Sequencing kit from the same manufacturer.

    Isolation:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen). .. Plasmids were digested using Eco RI and Buffer H (Roche, Basel, Switzerland) prior to diluting, in order to ensure the repeatability of the dilutions.

    Purification:

    Article Title: Mutualism breakdown in breadfruit domestication
    Article Snippet: .. These were purified using the QiAquick PCR purification kit (Qiagen) and cloned using the pGEM-T vector (Promega, USA) and Escherichia coli JM109 High Efficiency Competent cells (Promega). ..

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: Amplicons were purified from PCR reactions with Qiaquick PCR Purification kit (Qiagen, Hilden, Germany), A‐tailed with DreamTaq DNA polymerase (Thermo Fisher Scientific), again purified with the Qiaquick PCR purification kit (Qiagen), ligated into vector pGEM‐T Easy (Promega, Madison, WI, USA) using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) and again purified with the Qiaquick PCR Purification kit (Qiagen). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: PCR-amplification products were purified and sequenced using the BigDye Terminator Cycle Sequencing Ready Reaction Kit v 3.1 and an automated 3730xl DNA analyzer (Applied Biosystems Inc., USA). .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: .. Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega). .. Purified plasmid DNA was sequenced by MWG Eurofins Operon (Ebersberg, Germany) using the primers M13uni(‐21) and M13rev(‐29).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Sequencing:

    Article Title: Identification and Minisequencing-Based Discrimination of SHV ?-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia
    Article Snippet: Amplicons generated from the clinical isolates A1, F2, J1, J2, and L1 using primers SHV-F and SHV-R were cloned using the pGEMt plasmid kit (Promega) and JM109 High Efficiency competent Escherichia coli cells (Promega). .. Ten to twenty clones were selected for each isolate, and secondary PCR products were generated from these clones for sequencing and FNC analysis.

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: Paragraph title: Amplification, Cloning, and Sequencing ... Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions.

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: The results were summarized by subtype or CRF and for each plasmid the sequence variants of the corresponding subtype or CRF were extracted. .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: For the DGGE fingerprints of bacterial groups and fungal ITS fragments that showed nematode-specific bands, PCR products were cloned and sequenced to identify the corresponding microbial species by sequence comparison to the GenBank entries. .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
    Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: Paragraph title: DNA extraction, PCR, Cloning and Sequencing ... The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: Paragraph title: Cloning and sequence analysis of goldfish CB2 partial coding sequence ... Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions. .. The 16S rRNA clones sharing nucleotide sequence homology at more than 99% were grouped into one operational taxonomic unit (OTU) using DOTUR program ver.

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: Paragraph title: PCR, cloning and sequencing ... After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions.

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: Paragraph title: DNA extraction and PbCYP51 sequencing ... Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: A primer oligonucleotide complementary to the ADAPTER–primer sequence was used for PCR in combination with the 26‐bp oligonucleotide corresponding to each of the 10 SuperSAGE tag sequences. .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega).

    Quantitative RT-PCR:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: Paragraph title: 3′‐RACE and qRT‐PCR experiments ... For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega).

    Nested PCR:

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: In order to construct the subtype reference plasmids, RNA was isolated from the viral reference culture supernatants with the Boom extraction method and used for RT‐PCR with Superscript‐III One‐Step Platinum Taq (Invitrogen, Carlsbad, CA, USA) and nested PCR with Platinum Taq DNA Polymerase High Fidelity (Thermo Fisher Scientific, Waltham, MA, USA) using isolate‐specific primers (Tables ). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The fungal ITS fragments were amplified using a nested PCR approach with primer pairs ITS1F / ITS4 and ITS1FGC / ITS2. .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    Rapid Amplification of cDNA Ends:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: First, longer cDNA fragments were recovered by 3′‐RACE (Rapid Amplification of cDNA Ends) method and sequences compared against those in H. virescens contigs database (Perera et al ., ) using the BLASTN algorithm. .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega).

    Plasmid Preparation:

    Article Title: Mutualism breakdown in breadfruit domestication
    Article Snippet: .. These were purified using the QiAquick PCR purification kit (Qiagen) and cloned using the pGEM-T vector (Promega, USA) and Escherichia coli JM109 High Efficiency Competent cells (Promega). ..

    Article Title: Identification and Minisequencing-Based Discrimination of SHV ?-Lactamases in Nosocomial Infection-Associated Klebsiella pneumoniae in Brisbane, Australia
    Article Snippet: .. Amplicons generated from the clinical isolates A1, F2, J1, J2, and L1 using primers SHV-F and SHV-R were cloned using the pGEMt plasmid kit (Promega) and JM109 High Efficiency competent Escherichia coli cells (Promega). .. Ten to twenty clones were selected for each isolate, and secondary PCR products were generated from these clones for sequencing and FNC analysis.

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: Sequence Determinants of DNA Binding by the Hematopoietic Helix-Loop-Helix Transcription Factor TAL1: Importance of Sequences Flanking the E-Box Core
    Article Snippet: .. The resuspended genomic DNA was ligated into Hin dIII linearized pB2SK+ vector (Stratagene) and used to transform high-efficiency Escherichia coli JM109 competent cells (Promega). .. Sequencing reactions were performed using an AmpliTaq dye terminator cycle sequencing kit (Perkin Elmer).

    Article Title: Development of sensitive dd PCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant formsDevelopment of sensitive ddPCR assays to reliably quantify the proviral DNA reservoir in all common circulating HIV subtypes and recombinant forms
    Article Snippet: Amplicons were purified from PCR reactions with Qiaquick PCR Purification kit (Qiagen, Hilden, Germany), A‐tailed with DreamTaq DNA polymerase (Thermo Fisher Scientific), again purified with the Qiaquick PCR purification kit (Qiagen), ligated into vector pGEM‐T Easy (Promega, Madison, WI, USA) using T4 DNA ligase (New England Biolabs, Ipswich, MA, USA) and again purified with the Qiaquick PCR Purification kit (Qiagen). .. Escherichia coli JM109 High Efficiency Competent Cells (Promega) were used for transformation, colonies were picked and cultured overnight at 37°C in 5 mL LB medium supplemented with ampicillin (40 μg/mL) and plasmids were isolated using the Qiaprep Spin Miniprep Kit (Qiagen).

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI). .. Based on the PCR-DGGE analyses, cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, Netherlands).

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA). .. Cloned amplicons corresponding in electrophoretic mobility to nematode-specific bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE
    Article Snippet: .. For the sequencing of the different bands of msp1 gene fragments observed at different positions in the DGGE gel, PCR products obtained with the primers msp410f and MImsp596r were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells according to the instructions of the manufacturer (Promega, Madison, WI). .. Based on PCR-DGGE, cloned amplicons corresponding in electrophoretic mobility to different bands were sequenced (Macrogen, Amsterdam, The Netherlands).

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA). ..

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: The 380 bp amplification product was cloned into pGEM-T-easy vector, using pGEM-T-easy Vector System (Promega, Madison, USA). .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced.

    Article Title: Identification of Active Denitrifiers in Rice Paddy Soil by DNA- and RNA-Based Analyses
    Article Snippet: .. The PCR products were ligated into the pGEM-T vector system (Promega, Madison, WI, USA) and transferred to Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer’s instructions. .. The 16S rRNA clones sharing nucleotide sequence homology at more than 99% were grouped into one operational taxonomic unit (OTU) using DOTUR program ver.

    Article Title: Identification and isolation of active N2O reducers in rice paddy soil
    Article Snippet: .. After removing excess primers and dNTP by using a Wizard DNA Cleanup system (Promega, Madison, WI, USA), PCR products were cloned into a pGEM-T Easy vector (Promega) and transformed into Escherichia coli JM109 high-efficiency competent cells (Promega) according to the manufacturer's instructions. .. DNA inserts from randomly selected clones were amplified by PCR with vector primers T7-1 and SP6, and sequenced as described previously ( ).

    Article Title: Alterations in the predicted regulatory and coding regions of the sterol 14α‐demethylase gene (CYP51) confer decreased azole sensitivity in the oilseed rape pathogen Pyrenopeziza brassicae
    Article Snippet: .. Purified PCR products were ligated to the pGEM‐Easy vector (Promega) and transformed into JM109 high efficiency competent Escherichia coli cells (Promega). .. Purified plasmid DNA was sequenced by MWG Eurofins Operon (Ebersberg, Germany) using the primers M13uni(‐21) and M13rev(‐29).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Software:

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA). .. The sequences were assembled using Chromas Pro software and identifications of cassettes were done using BLASTX ( http://blast.ncbi.nlm.nih.gov/Blast.cgi ).

    RNA Extraction:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For 3′‐RACE, total RNA extraction and preparation of RNA pools were carried out as described above on new dissected guts. .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega).

    Recombinant:

    Article Title: Cannabinoid receptors are widely expressed in goldfish: molecular cloning of a CB2-like receptor and evaluation of CB1 and CB2 mRNA expression profiles in different organs
    Article Snippet: .. Escherichia coli JM109 high efficiency competent cells (Promega) were transformed and recombinant colonies were identified by blue/white color screening and restriction digestion; 6 selected recombinant clones (pGEM-T-easy-CB2 Car ) were sequenced. .. The nucleotide sequence of the cloned Carassius auratus CB2 340 bp fragment is available at GenBank (accession number: ).

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: .. For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    Agarose Gel Electrophoresis:

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: PCR-amplification products were separated by agarose gel electrophoresis; bands of 1.0 kb and 1.5 kb for class 1 and 1.0 kb for class 2 integron gene cassettes respectively, were eluted from the gels using the Gene Elute Gel Extraction Kit (Sigma-aldrich, St Louis, USA). .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Produced:

    Article Title: Specific Microbial Attachment to Root Knot Nematodes in Suppressive Soil
    Article Snippet: For Alphaproteobacteria and Pseudomonas , PCR products obtained with the primer pair F984GC/R1378 were used; for Bacillus , products produced with the primer pair BacF/R1378 were used; for fungal profiles, products of the primer pair ITS1FGC/ITS2 were used (see Table S1 in the supplemental material). .. PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, WI).

    Concentration Assay:

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    DNA Purification:

    Article Title: HT‐SuperSAGE of the gut tissue of a Vip3Aa‐resistant Heliothis virescens (Lepidoptera: Noctuidae) strain provides insights into the basis of resistance
    Article Snippet: For cloning the 3′‐RACE products, each fragment was purified using the PCR Clean‐Up System (Promega), ligated into the pGEM‐T Easy vector (Promega) and the resultant recombinant plasmids DNA transformed into high‐efficiency JM109 Escherichia coli competent cells (Promega). .. Recombinant colonies were randomly picked and cultured in Luria–Bertani medium containing ampicillin at 100 mg/L, followed by plasmid DNA extraction using the Wizard Plus SV Minipreps DNA Purification System (Promega).

    High Throughput Screening Assay:

    Article Title: Microbiomes associated with infective stages of root-knot and lesion nematodes in soil
    Article Snippet: The concentration of the purified amplicon samples was measured using a Qubit Fluorometer (Life Technologies, Carlsbad, CA, USA), the samples were pooled and adjusted to equimolar concentrations, concentrated using the DNA Clean and Concentrator™-5 kit (Zymo Research, Irvine, CA, USA), and finally subjected to 2x250 bp paired-end high-throughput sequencing on an Illumina® MiSeq® platform (Illumina, San Diego, CA, USA). .. To identify the bacterial and fungal species corresponding to some of the bands of nematode associated DGGE profiles, PCR products were cloned using the vector pGEM-T and Escherichia coli JM109 high-efficiency competent cells (Promega, Madison, USA).

    Gel Extraction:

    Article Title: Together But Different: The Subgenomes of the Bimodal Eleutherine Karyotypes Are Differentially Organized
    Article Snippet: .. Polymerase chain reaction conditions were as follows 94°C 3 min, 30× (94°C 1 min, 55°C 1 min, 72°C 1 min), and 72°C 10 min. Polymerase chain reaction fragments were purified from a 1% agarose gel using the AxyPrep DNA gel extraction kit (Axygen Biosciences) and cloned with the pGEM® -T Vector cloning system (Promega) using JM109 Escherichia coli high-efficiency competent cells (Promega), following manufacturer’s instructions. .. One positive clone of each repetitive element was sequenced with a 3500 Genetic Analyzer Sanger sequencing platform at the Biosciences Center of the Federal University of Pernambuco for confirming its identity.

    Article Title: A Treatment Plant Receiving Waste Water from Multiple Bulk Drug Manufacturers Is a Reservoir for Highly Multi-Drug Resistant Integron-Bearing Bacteria
    Article Snippet: PCR-amplification products were separated by agarose gel electrophoresis; bands of 1.0 kb and 1.5 kb for class 1 and 1.0 kb for class 2 integron gene cassettes respectively, were eluted from the gels using the Gene Elute Gel Extraction Kit (Sigma-aldrich, St Louis, USA). .. The eluted products were cloned into the pGEM-T vector (Promega, Madison, USA) and transformed into Escherichia coli JM109 High Efficiency Chemical Competent cells (Promega, Madison, USA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Promega jm109 competent cells
    Jm109 Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 22 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/jm109 competent cells/product/Promega
    Average 90 stars, based on 22 article reviews
    Price from $9.99 to $1999.99
    jm109 competent cells - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    91
    Promega escherichia coli jm109 high efficiency competent cells
    Escherichia Coli Jm109 High Efficiency Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli jm109 high efficiency competent cells/product/Promega
    Average 91 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli jm109 high efficiency competent cells - by Bioz Stars, 2020-01
    91/100 stars
      Buy from Supplier

    Image Search Results