Structured Review

Promega strain tecb1
(A) Reductive dechlorination of 1,2,4-TCB by strain <t>TeCB1,</t> error bars represent standard deviation ( n = 3). Dechlorination products (●) MCB, (▼) 1,2-DCB, (■)1,3-DCB, (▲) 1,4-DCB, (◆) 1,2,4-TCB. No dechlorination was observed in the abiotic control. (B) Growth determined by 16S rRNA gene qPCR and chloride released ( n = 3) during 1,2,4-TCB respiration. ( ) Growth and ( ) chloride released.
Strain Tecb1, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 42244 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/strain tecb1/product/Promega
Average 91 stars, based on 42244 article reviews
Price from $9.99 to $1999.99
strain tecb1 - by Bioz Stars, 2020-08
91/100 stars

Images

1) Product Images from "Isolation and Characterization of Dehalobacter sp. Strain TeCB1 Including Identification of TcbA: A Novel Tetra- and Trichlorobenzene Reductive Dehalogenase"

Article Title: Isolation and Characterization of Dehalobacter sp. Strain TeCB1 Including Identification of TcbA: A Novel Tetra- and Trichlorobenzene Reductive Dehalogenase

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2017.00558

(A) Reductive dechlorination of 1,2,4-TCB by strain TeCB1, error bars represent standard deviation ( n = 3). Dechlorination products (●) MCB, (▼) 1,2-DCB, (■)1,3-DCB, (▲) 1,4-DCB, (◆) 1,2,4-TCB. No dechlorination was observed in the abiotic control. (B) Growth determined by 16S rRNA gene qPCR and chloride released ( n = 3) during 1,2,4-TCB respiration. ( ) Growth and ( ) chloride released.
Figure Legend Snippet: (A) Reductive dechlorination of 1,2,4-TCB by strain TeCB1, error bars represent standard deviation ( n = 3). Dechlorination products (●) MCB, (▼) 1,2-DCB, (■)1,3-DCB, (▲) 1,4-DCB, (◆) 1,2,4-TCB. No dechlorination was observed in the abiotic control. (B) Growth determined by 16S rRNA gene qPCR and chloride released ( n = 3) during 1,2,4-TCB respiration. ( ) Growth and ( ) chloride released.

Techniques Used: Standard Deviation, Real-time Polymerase Chain Reaction

Maximum likelihood 16S rRNA gene tree of Dehalobacter sp. strain TeCB1, along with other Dehalobacter strains, OHRB and bacterial species. Sequence alignment and tree construction were performed with MEGAv.6 ( Tamura et al., 2013 ). Numbers adjacent to tree branches represent percentage of branch support based on 1000 bootstrap re-sampling. Scale bar shows an evolutionary distance 0.05 nucleotide substitutions per site. Numbers adjacent to bacterium names indicate GenBank accession numbers, the project version and the location of 16S rRNA gene within the genome. Dehalococcoides mccartyi (strains CBDB1 and 195) and Azospira restricta strain SUA2 were used as outgroups.
Figure Legend Snippet: Maximum likelihood 16S rRNA gene tree of Dehalobacter sp. strain TeCB1, along with other Dehalobacter strains, OHRB and bacterial species. Sequence alignment and tree construction were performed with MEGAv.6 ( Tamura et al., 2013 ). Numbers adjacent to tree branches represent percentage of branch support based on 1000 bootstrap re-sampling. Scale bar shows an evolutionary distance 0.05 nucleotide substitutions per site. Numbers adjacent to bacterium names indicate GenBank accession numbers, the project version and the location of 16S rRNA gene within the genome. Dehalococcoides mccartyi (strains CBDB1 and 195) and Azospira restricta strain SUA2 were used as outgroups.

Techniques Used: Sequencing, Sampling

Reductive dechlorination of 1,2,4,5-TeCB by different OHRB, including: Dehalobacter sp. strain TeCB1 and Dehalobacter sp. strains 12DCB1, 13DCB1, 14DCB1 ( Nelson et al., 2014 ), and Dehalococcoides mccartyi CBDB1 ( Adrian et al., 2000 ). Note, chlorobenzene production by strain TeCB1 is co-metabolic.
Figure Legend Snippet: Reductive dechlorination of 1,2,4,5-TeCB by different OHRB, including: Dehalobacter sp. strain TeCB1 and Dehalobacter sp. strains 12DCB1, 13DCB1, 14DCB1 ( Nelson et al., 2014 ), and Dehalococcoides mccartyi CBDB1 ( Adrian et al., 2000 ). Note, chlorobenzene production by strain TeCB1 is co-metabolic.

Techniques Used:

Neighbor-joining tree of TcbA in Dehalobacter sp. strain TeCB1 along with other OHRBs RDases. All RdhAs in the tree are shown with their NCBI version numbers. Sequence alignment was generated using the MUSCLE algorithm and tree construction were performed with MEGA6: Molecular Evolutionary Genetics Analysis v.6 ( Tamura et al., 2013 ). Numbers next to branches indicate percentage of branch support based on 1000 bootstrap re-sampling. The scale bar indicates an evolutionary distance of 0.1 nucleotide substitutions per site.
Figure Legend Snippet: Neighbor-joining tree of TcbA in Dehalobacter sp. strain TeCB1 along with other OHRBs RDases. All RdhAs in the tree are shown with their NCBI version numbers. Sequence alignment was generated using the MUSCLE algorithm and tree construction were performed with MEGA6: Molecular Evolutionary Genetics Analysis v.6 ( Tamura et al., 2013 ). Numbers next to branches indicate percentage of branch support based on 1000 bootstrap re-sampling. The scale bar indicates an evolutionary distance of 0.1 nucleotide substitutions per site.

Techniques Used: Sequencing, Generated, Sampling

2) Product Images from "Succession of Internal Sulfur Cycles and Sulfur-Oxidizing Bacterial Communities in Microaerophilic Wastewater Biofilms"

Article Title: Succession of Internal Sulfur Cycles and Sulfur-Oxidizing Bacterial Communities in Microaerophilic Wastewater Biofilms

Journal:

doi: 10.1128/AEM.71.5.2520-2529.2005

Phylogenetic distance tree showing the affiliations of 16S rRNA gene clone sequences related to SOB shown in Table . The nearly full-length sequences of 16S rRNA genes ( > 1,380 bp) were retrieved from the RDR1 biofilm (Biofilm-)
Figure Legend Snippet: Phylogenetic distance tree showing the affiliations of 16S rRNA gene clone sequences related to SOB shown in Table . The nearly full-length sequences of 16S rRNA genes ( > 1,380 bp) were retrieved from the RDR1 biofilm (Biofilm-)

Techniques Used:

3) Product Images from "Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE"

Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE

Journal: Journal of Nematology

doi:

Genetic differentiation of Meloidogyne incognita populations based on variants of their pathogenicity gene msp1 . A. Denaturing gradient gel electrophoresis (DGGE) of the msp1 genes amplified by PCR from two Egyptian populations (E1, E2), two German populations
Figure Legend Snippet: Genetic differentiation of Meloidogyne incognita populations based on variants of their pathogenicity gene msp1 . A. Denaturing gradient gel electrophoresis (DGGE) of the msp1 genes amplified by PCR from two Egyptian populations (E1, E2), two German populations

Techniques Used: Denaturing Gradient Gel Electrophoresis, Amplification, Polymerase Chain Reaction

4) Product Images from "Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE"

Article Title: Identification of msp1 Gene Variants in Populations of Meloidogyne incognita Using PCR-DGGE

Journal: Journal of Nematology

doi:

Genetic differentiation of Meloidogyne incognita populations based on variants of their pathogenicity gene msp1 . A. Denaturing gradient gel electrophoresis (DGGE) of the msp1 genes amplified by PCR from two Egyptian populations (E1, E2), two German populations
Figure Legend Snippet: Genetic differentiation of Meloidogyne incognita populations based on variants of their pathogenicity gene msp1 . A. Denaturing gradient gel electrophoresis (DGGE) of the msp1 genes amplified by PCR from two Egyptian populations (E1, E2), two German populations

Techniques Used: Denaturing Gradient Gel Electrophoresis, Amplification, Polymerase Chain Reaction

5) Product Images from "Isolation and Characterization of Dehalobacter sp. Strain TeCB1 Including Identification of TcbA: A Novel Tetra- and Trichlorobenzene Reductive Dehalogenase"

Article Title: Isolation and Characterization of Dehalobacter sp. Strain TeCB1 Including Identification of TcbA: A Novel Tetra- and Trichlorobenzene Reductive Dehalogenase

Journal: Frontiers in Microbiology

doi: 10.3389/fmicb.2017.00558

(A) Reductive dechlorination of 1,2,4-TCB by strain TeCB1, error bars represent standard deviation ( n = 3). Dechlorination products (●) MCB, (▼) 1,2-DCB, (■)1,3-DCB, (▲) 1,4-DCB, (◆) 1,2,4-TCB. No dechlorination was observed in the abiotic control. (B) Growth determined by 16S rRNA gene qPCR and chloride released ( n = 3) during 1,2,4-TCB respiration. ( ) Growth and ( ) chloride released.
Figure Legend Snippet: (A) Reductive dechlorination of 1,2,4-TCB by strain TeCB1, error bars represent standard deviation ( n = 3). Dechlorination products (●) MCB, (▼) 1,2-DCB, (■)1,3-DCB, (▲) 1,4-DCB, (◆) 1,2,4-TCB. No dechlorination was observed in the abiotic control. (B) Growth determined by 16S rRNA gene qPCR and chloride released ( n = 3) during 1,2,4-TCB respiration. ( ) Growth and ( ) chloride released.

Techniques Used: Standard Deviation, Real-time Polymerase Chain Reaction

Maximum likelihood 16S rRNA gene tree of Dehalobacter sp. strain TeCB1, along with other Dehalobacter strains, OHRB and bacterial species. Sequence alignment and tree construction were performed with MEGAv.6 ( Tamura et al., 2013 ). Numbers adjacent to tree branches represent percentage of branch support based on 1000 bootstrap re-sampling. Scale bar shows an evolutionary distance 0.05 nucleotide substitutions per site. Numbers adjacent to bacterium names indicate GenBank accession numbers, the project version and the location of 16S rRNA gene within the genome. Dehalococcoides mccartyi (strains CBDB1 and 195) and Azospira restricta strain SUA2 were used as outgroups.
Figure Legend Snippet: Maximum likelihood 16S rRNA gene tree of Dehalobacter sp. strain TeCB1, along with other Dehalobacter strains, OHRB and bacterial species. Sequence alignment and tree construction were performed with MEGAv.6 ( Tamura et al., 2013 ). Numbers adjacent to tree branches represent percentage of branch support based on 1000 bootstrap re-sampling. Scale bar shows an evolutionary distance 0.05 nucleotide substitutions per site. Numbers adjacent to bacterium names indicate GenBank accession numbers, the project version and the location of 16S rRNA gene within the genome. Dehalococcoides mccartyi (strains CBDB1 and 195) and Azospira restricta strain SUA2 were used as outgroups.

Techniques Used: Sequencing, Sampling

Related Articles

Clone Assay:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Amplification:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Agarose Gel Electrophoresis:

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Purification:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Polymerase Chain Reaction:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Characterization of Mycoplasma arthritidis Variable Surface Protein MAA2
Article Snippet: .. The full-length maa2 gene was amplified from strain H606 chromosomal DNA by PCR with primers F3 and HMPR and cloned into pGEM-T Easy as described above. .. E. coli containing recombinant plasmids with inserts in both orientations were tested for ability to express recombinant MAA2 as described for 158p10p9.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Activity Assay:

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

DNA Sequencing:

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Sequencing:

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

Plasmid Preparation:

Article Title: The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-? receptor 1 and has a dominant-negative effect on interferon-? signal transduction
Article Snippet: .. The PCR products were cloned into pGEM‐T Easy vector (Promega, Madison, Wisonsin, USA). .. To generate the 818del4 mutant, we performed PCR‐based mutagenesis of the WT construct using the following mismatched PCR primers: sense 5′‐TTTATATTAAGAAAATCCATTGAAGGAAAA‐3′ and antisense, 5′‐TTTTCCTTCAATGGATTTTCTTAATATAAA‐3′.

Article Title: Effect of mesoporous silica under Neisseria meningitidis transformation process: environmental effects under meningococci transformation
Article Snippet: .. This fragment was cloned into the pGEM-T Easy Vector System II (Promega Corporation, Madison, WI, USA), to generate the plasmid pLAN6. .. E. coli strain Z501 was transformed with plasmid pLAN6 resulting in the plasmid pLAN7.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The AnrasA and AnrasB PCR products were purified using PCR clean up system (Fermentas, USA) and cloned in pGEM-T easy (Promega, USA) vector and confirmed by automated DNA sequencing. .. Double-standard RNA (dsRNA) preparation The dsRNAs were synthesized via in vitro transcription with the highscribe T7 in vitro transcription system (Fermentas, USA) using PCR products as templates for sGFP , AnrasA and AnrasB target genes.

Article Title: Targeting Fungal Genes by Diced siRNAs: A Rapid Tool to Decipher Gene Function in Aspergillus nidulans
Article Snippet: .. The sGFP gene was PCR amplified from the pMT-sGFP vector and cloned in pGEM T-easy vector. .. Then, the sGFP gene was sub-cloned in pSilent-1 vector in Xho I and Kpn I restriction sites by removing the spacer DNA and finally expression cassette was introduced into pCAMBIA1300 backbone at the Xba I restriction site. (TIF) Click here for additional data file.

Article Title: Molecular Cloning and Characterization of P4 Nuclease from Leishmania infantum
Article Snippet: .. Gene Cloning The PCR product was purified by PCR product purification kit (Roche) and ligated into the pGEM-T easy vector (Promega). .. The ligation reaction was transformed into DH5α (Promega) competent cells and plated on Luria-Bertani (LB) agar, containing ampicillin (50 mg/mL), 5-bromo-4 chloro-3-indolyl-β -D-galactoside (X-gal: 20 mM), and Isopropyl thio-β -D-galactoside (IPTG: 200 mg/mL).

Article Title: Promoter Sequence of Shiga Toxin 2 (Stx2) Is Recognized In Vivo, Leading to Production of Biologically Active Stx2
Article Snippet: .. The pGEMT Easy vector carrying the sequence of Stx2 was digested and religated in order to delete the active site of Stx2, generating the plasmid pStx2ΔAB ( ) as a Stx2-specific biological activity control. ..

Article Title: Complementation of the Mycoplasma synoviae MS-H vaccine strain with wild-type obg influencing its growth characteristics
Article Snippet: .. Amplicons of expected size were confirmed by agarose gel electrophoresis ( ) and vlhA - obg amplicon was cloned into pGEM-T Easy vector according to the manufacturer’s instructions (Promega, Alexandria, New South Wales, Australia). .. A Pst I- Sac II fragment containing vlhA - obg was excised and inserted into the compatible sites of pBluescript II KS (+) phagemid (Thermo Fisher Scientific, Scoresby, Victoria, Australia).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    Promega high efficiency jm109 escherichia coli competent cells
    High Efficiency Jm109 Escherichia Coli Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/high efficiency jm109 escherichia coli competent cells/product/Promega
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    high efficiency jm109 escherichia coli competent cells - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    99
    Promega escherichia coli jm109 high efficiency chemical competent cells
    Escherichia Coli Jm109 High Efficiency Chemical Competent Cells, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli jm109 high efficiency chemical competent cells/product/Promega
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli jm109 high efficiency chemical competent cells - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results