ecori xbai  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91

    Structured Review

    New England Biolabs ecori xbai
    Ecori Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai/product/New England Biolabs
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    ecori xbai - by Bioz Stars, 2020-03
    91/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: Paragraph title: Cloning and Mutagenesis of GTPase-GED Fusion Constructs ... These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA).

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: .. The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs).

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs). .. The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly.

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Amplification:

    Article Title: Cofactor recycling for co-production of 1,3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum
    Article Snippet: Plasmids and strains construction The yqhD gene encoding alcohol dehydrogenase and pduCDEGH gene encoding diol dehydratase and its activator were amplified from the genome of E. coli K12 and K. pneumoniae DSM 2026 using primers 11-F/11-R and 12-F/12-R. .. The two fragments were inserted into the restriction site of EcoRI/XbaI of pEC-K18mob2 by Gibson Assembly Master Kit (NEB) , giving recombinant plasmid pEC-yqhD-pdu.

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: .. These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. The pMAL c2xP_5D plasmid was generated by removing the Factor Xa site from the parent pMAL c2x plasmid (New England Biolabs) with Blp1 and EcoRI restriction enzymes and replacing it with a new DNA fragment that included a PreScission protease site (LEVLFQGP) followed by an additional five aspartate residues.

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs).

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. .. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct.

    Ligation:

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Mutagenesis:

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: Paragraph title: Cloning and Mutagenesis of GTPase-GED Fusion Constructs ... These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA).

    Conjugation Assay:

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. For the allelic replacement of wildtype pmrB and mexZ , 1.4-kb DNA fragments were amplified by PCR using primers oVT468/469, oVT470/471 and oVT472/473 on the evolved populations GEN-3, GEN-10, and STR-2, which respectively contained the PmrB_V136E, PmrB_P254L and MexZ_Q95stop mutations.

    Polymerase Chain Reaction:

    Article Title: Cofactor recycling for co-production of 1,3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum
    Article Snippet: The two fragments were inserted into the restriction site of EcoRI/XbaI of pEC-K18mob2 by Gibson Assembly Master Kit (NEB) , giving recombinant plasmid pEC-yqhD-pdu. .. To construct plasmid pEC-dhaT-pdu, the dhaT gene encoding 1,3-PDO dehydrogenase was PCR amplified from the genome of K. pneumoniae DSM 2026 using primers 13-F/13-R.

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: .. These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. The pMAL c2xP_5D plasmid was generated by removing the Factor Xa site from the parent pMAL c2x plasmid (New England Biolabs) with Blp1 and EcoRI restriction enzymes and replacing it with a new DNA fragment that included a PreScission protease site (LEVLFQGP) followed by an additional five aspartate residues.

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly.

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs). .. The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs).

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. .. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct.

    Construct:

    Article Title: Cofactor recycling for co-production of 1,3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum
    Article Snippet: The two fragments were inserted into the restriction site of EcoRI/XbaI of pEC-K18mob2 by Gibson Assembly Master Kit (NEB) , giving recombinant plasmid pEC-yqhD-pdu. .. To construct plasmid pEC-dhaT-pdu, the dhaT gene encoding 1,3-PDO dehydrogenase was PCR amplified from the genome of K. pneumoniae DSM 2026 using primers 13-F/13-R.

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: Paragraph title: Cloning and Mutagenesis of GTPase-GED Fusion Constructs ... These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA).

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. .. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct.

    Modification:

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: .. These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. The pMAL c2xP_5D plasmid was generated by removing the Factor Xa site from the parent pMAL c2x plasmid (New England Biolabs) with Blp1 and EcoRI restriction enzymes and replacing it with a new DNA fragment that included a PreScission protease site (LEVLFQGP) followed by an additional five aspartate residues.

    Generated:

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. The pMAL c2xP_5D plasmid was generated by removing the Factor Xa site from the parent pMAL c2x plasmid (New England Biolabs) with Blp1 and EcoRI restriction enzymes and replacing it with a new DNA fragment that included a PreScission protease site (LEVLFQGP) followed by an additional five aspartate residues.

    Selection:

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. For the allelic replacement of wildtype pmrB and mexZ , 1.4-kb DNA fragments were amplified by PCR using primers oVT468/469, oVT470/471 and oVT472/473 on the evolved populations GEN-3, GEN-10, and STR-2, which respectively contained the PmrB_V136E, PmrB_P254L and MexZ_Q95stop mutations.

    Sequencing:

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. All point mutations were introduced by Quikchange mutagenesis (Stratagene, La Jolla, CA) and confirmed by sequencing.

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: .. pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ). .. Human embryonic kidney cells (HEK-293, American Type Culture Collection CRL-1573) were cultivated in Dulbecco's modified Eagle's medium (DMEM; Invitrogen) supplemented with 10% FCS (Pan Biotech GmbH, catalog no. 3302, lot P231902) and 1% of a penicillin/streptomycin solution (Sigma, catalog no. 4458).

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. .. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct.

    Recombinant:

    Article Title: Cofactor recycling for co-production of 1,3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum
    Article Snippet: .. The two fragments were inserted into the restriction site of EcoRI/XbaI of pEC-K18mob2 by Gibson Assembly Master Kit (NEB) , giving recombinant plasmid pEC-yqhD-pdu. .. To construct plasmid pEC-dhaT-pdu, the dhaT gene encoding 1,3-PDO dehydrogenase was PCR amplified from the genome of K. pneumoniae DSM 2026 using primers 13-F/13-R.

    Transformation Assay:

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly.

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were introduced into pVT77 previously digested with EcoRI/XbaI using NEBuilder HiFi DNA assembly (New England Biolabs). .. The obtained plasmids were transformed into E. coli conjugative strains MFDpir or S17-1 and transferred into P. aeruginosa PA14 as described previously ( ).

    Binding Assay:

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. .. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5′-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5′-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct.

    Plasmid Preparation:

    Article Title: Cofactor recycling for co-production of 1,3-propanediol and glutamate by metabolically engineered Corynebacterium glutamicum
    Article Snippet: .. The two fragments were inserted into the restriction site of EcoRI/XbaI of pEC-K18mob2 by Gibson Assembly Master Kit (NEB) , giving recombinant plasmid pEC-yqhD-pdu. .. To construct plasmid pEC-dhaT-pdu, the dhaT gene encoding 1,3-PDO dehydrogenase was PCR amplified from the genome of K. pneumoniae DSM 2026 using primers 13-F/13-R.

    Article Title: An Intramolecular Signaling Element that Modulates Dynamin Function In Vitro and In Vivo
    Article Snippet: .. These fragments were amplified from cDNA by PCR and subcloned sequentially into a modified N-terminal MBP fusion vector (pMAL c2xP_5D) using EcoRI/XbaI and XbaI/HindIII restriction enzymes (New England Biolabs, Beverly, MA). .. The pMAL c2xP_5D plasmid was generated by removing the Factor Xa site from the parent pMAL c2x plasmid (New England Biolabs) with Blp1 and EcoRI restriction enzymes and replacing it with a new DNA fragment that included a PreScission protease site (LEVLFQGP) followed by an additional five aspartate residues.

    Article Title: Alternative Evolutionary Paths to Bacterial Antibiotic Resistance Cause Distinct Collateral Effects
    Article Snippet: The resulting DNA fragments were cloned into pVT77, digested with EcoRI/XbaI, using NEBuilder HiFi DNA assembly. .. For the allelic replacement of wildtype pmrB and mexZ , 1.4-kb DNA fragments were amplified by PCR using primers oVT468/469, oVT470/471 and oVT472/473 on the evolved populations GEN-3, GEN-10, and STR-2, which respectively contained the PmrB_V136E, PmrB_P254L and MexZ_Q95stop mutations.

    Article Title: A synthetic mammalian gene circuit reveals antituberculosis compounds
    Article Snippet: Paragraph title: Vector Design. ... pWW489 (PSV40 - ethR-vp16 -pA) was constructed by PCR-mediated amplification of ethR from genomic M. bovis DNA by using oligonucleotides OWW400 (5′-gcatccatatgaattccaccatgaccacctccgcggcca-3′) and OWW401 (5′-cgatcgcgcgcggctgtacgcggagcggttctcgccgtaaatgc-3′) followed by restriction and ligation (EcoRI/BssHII) into pWW35 ( ). pWW491 (OethR -Phsp70min -SEAP-pA) was obtained by direct cloning of a synthetic OethR sequence (5′-gacgtcgatccacgctatcaacgtaatgtcgaggccgtcaacgagatgtcgacactatcgacacgtagcctgcagg-3′) (AatII/SbfI) into pMF172 ( ). pWW488 (PT7 - ethR-vp16-his 6 ) was constructed by PCR-mediated amplification of ethR-vp16 from pWW489 by using oligonucleotides OWW400 and OWW60 (5′-gctctagagcaagcttttaatggtgatggtgatgatgcccaccgtactgtcaattccaag-3′) followed by cloning (NdeI/HindIII) into pRSETmod ( ). pWW856 (PethR - gfp -pA) was constructed in three steps: ( i ) gfp was PCR-amplified from pLEGFP-N1 (Clontech) by using oligonucleotides OWW848 (5′-ggcttgaattcaaaggagatataccatggtgagcaagggcgag-3′) and OWW849 (5′-ggctttctagacaaaaaacccctcaagacccgtttagaggccccaaggggttatgctagttacttgtacagctcgtccatgccg-3′) and cloned (EcoRI/XbaI) into pWW56 ( ) (pWW854). ( ii ) A synthetic OethR sequence was directly cloned (HindIII/EcoRI) into pWW854 (pWW855). ( iii ) PethR - gfp was excised (BamHI/StuI) from pWW855 and ligated (BamHI/ScaI) into pACYC177 (NEB) (pWW856). pWW862 (PT7 - ethR-his 6 ) was assembled by annealing oligonucleotides OWW479 (5′-cgcgcatcatcatcatcatcattaagcggccgca-3′) and OWW480 (5′agcttgcggccgcttaatgatgatgatgatgatg-3′) and cloning the double-stranded DNA BssHII/HindIII into pWW488. pWW871 (5′LTR-Ψ+ - ethR-vp16 -PPGK - neoR -3′LTR) was designed by cloning ethR-vp16 of pWW489 (EcoRI/BamHI) into pMSCVneo (Clontech). pWW35 (PSV40 - E-vp16 -pA), pWW37 (ETR-PhCMVmin - seap -pA) and pWW313 (PT7 -E-his6 -pA) have been described ( ).

    Article Title: The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells
    Article Snippet: Multiple-step constructions were carried out to generate the plasmid pDB-Rho39Tr. .. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5′CG GAATTC CGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5′-ATGC TCTAGA AGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    New England Biolabs xbai ecori restriction sites
    Xbai Ecori Restriction Sites, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/xbai ecori restriction sites/product/New England Biolabs
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    xbai ecori restriction sites - by Bioz Stars, 2020-03
    85/100 stars
      Buy from Supplier

    91
    New England Biolabs ecori xbai
    Ecori Xbai, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 91/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori xbai/product/New England Biolabs
    Average 91 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    ecori xbai - by Bioz Stars, 2020-03
    91/100 stars
      Buy from Supplier

    79
    New England Biolabs 1 6 kb ecori xbai insert
    1 6 Kb Ecori Xbai Insert, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1 6 kb ecori xbai insert/product/New England Biolabs
    Average 79 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1 6 kb ecori xbai insert - by Bioz Stars, 2020-03
    79/100 stars
      Buy from Supplier

    Image Search Results