Structured Review

Promega ecori enzymatic digestion
Ecori Enzymatic Digestion, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/ecori enzymatic digestion/product/Promega
Average 93 stars, based on 1 article reviews
Price from $9.99 to $1999.99
ecori enzymatic digestion - by Bioz Stars, 2020-08
93/100 stars

Images

Related Articles

Amplification:

Article Title: Structural characterization of the saxitoxin-targeting APTSTX1 aptamer using optical tweezers and molecular dynamics simulations
Article Snippet: .. The amplicon was then cut into two fragments of similar size using EcoRI enzymatic digestion (Promega, US) for 3 hours at 37 ºC. .. Both 5’ biotinylated fragments were purified from a 1% Agarose gel (UltraClean DNA Purification Kit, Qiagen, Germany) and ligated with T4 ligase (Promega, US) to the 5’ adapter of the aptamer by adding a complementary oligo (5’–ACGGTGTGAAATACCGCACAGATGCGCATG–3’) ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    Promega ecori enzymatic digestion
    Ecori Enzymatic Digestion, supplied by Promega, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ecori enzymatic digestion/product/Promega
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    ecori enzymatic digestion - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results