easy nanolc 1000 uplc system  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    Thermo Fisher easy nanolc 1000 uplc system
    Easy Nanolc 1000 Uplc System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/easy nanolc 1000 uplc system/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    easy nanolc 1000 uplc system - by Bioz Stars, 2020-09
    99/100 stars

    Images

    Related Articles

    SYBR Green Assay:

    Article Title: Proteomic and Metabolomic Analyses of a Tea-Tree Oil-Selected Staphylococcus aureus Small Colony Variant
    Article Snippet: .. All RNA samples were treated with the DNA-free Kit (Ambion-Thermo Fischer Scientific, Waltham, MA) and cDNA samples were produced utilizing SuperScript III Reverse Transcriptase per the manufacturer’s instructions (Invitrogen-Thermo Scientific, Waltham, MA). cDNA samples were then interrogated by real-time PCR using the LightCycler 96 Real-Time PCR system (Roche, Indianapolis, IN) and FastStart Universal SYBR Green Master (ROX) (Roche). .. Gene-specific primers used in the RT-PCR analysis are found in .

    Transfection:

    Article Title: Phosphatidylinositol 4,5-Bisphosphate Alters the Number of Attachment Sites between Ezrin and Actin Filaments
    Article Snippet: .. Pooled siRNA targeting ezrin sequences GCUVAAGAUAAUGCUAUGUU, GGCAACAGCUGGAAACAGAUU, GAAGAAGGCACCUGACUUUUU, and GAUCAGGUGGUAAAGACUAUU (SMART pool siGENOME EZR siRNA; Thermo Scientific) were transfected with Lipofectamine® RNAiMAX transfection reagent (Invitrogen) following the manufacturer's instructions. .. Cells were grown in Petri dishes (μ-Dish 35 mm; ibidi) to confluence and afterward fixed with 4% paraformaldehyde (Sigma-Aldrich) in phosphate-buffered saline lacking Ca2+ and Mg2+ (PBS− ; Biochrom) for 20 min. After fixation, cells were washed three times with PBS− .

    Real-time Polymerase Chain Reaction:

    Article Title: Proteomic and Metabolomic Analyses of a Tea-Tree Oil-Selected Staphylococcus aureus Small Colony Variant
    Article Snippet: .. All RNA samples were treated with the DNA-free Kit (Ambion-Thermo Fischer Scientific, Waltham, MA) and cDNA samples were produced utilizing SuperScript III Reverse Transcriptase per the manufacturer’s instructions (Invitrogen-Thermo Scientific, Waltham, MA). cDNA samples were then interrogated by real-time PCR using the LightCycler 96 Real-Time PCR system (Roche, Indianapolis, IN) and FastStart Universal SYBR Green Master (ROX) (Roche). .. Gene-specific primers used in the RT-PCR analysis are found in .

    BIA-KA:

    Article Title: Transcriptomic Analysis Reveals Priming of The Host Antiviral Interferon Signaling Pathway by Bronchobini® Resulting in Balanced Immune Response to Rhinovirus Infection in Mouse Lung Tissue Slices
    Article Snippet: .. The Pierce™ BCA (bicinchoninic acid) total protein kit was purchased from Thermo Scientific/Life Technologies (Darmstadt, Germany). ..

    Sequencing:

    Article Title: Cut and Paste: Efficient Homology-Directed Repair of a Dominant Negative KRT14 Mutation via CRISPR/Cas9 Nickases
    Article Snippet: .. The library preparation, template preparation, and the sequencing run were performed according to manufacturer’s protocols (Thermo Fisher Scientific/Life Technologies, Carlsbad, CA, USA). ..

    Produced:

    Article Title: Proteomic and Metabolomic Analyses of a Tea-Tree Oil-Selected Staphylococcus aureus Small Colony Variant
    Article Snippet: .. All RNA samples were treated with the DNA-free Kit (Ambion-Thermo Fischer Scientific, Waltham, MA) and cDNA samples were produced utilizing SuperScript III Reverse Transcriptase per the manufacturer’s instructions (Invitrogen-Thermo Scientific, Waltham, MA). cDNA samples were then interrogated by real-time PCR using the LightCycler 96 Real-Time PCR system (Roche, Indianapolis, IN) and FastStart Universal SYBR Green Master (ROX) (Roche). .. Gene-specific primers used in the RT-PCR analysis are found in .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher easy nanolc 1000 uplc system
    Easy Nanolc 1000 Uplc System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/easy nanolc 1000 uplc system/product/Thermo Fisher
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    easy nanolc 1000 uplc system - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    93
    Thermo Fisher easy nanolc 1000 ultra performance liquid chromatography uplc system
    Easy Nanolc 1000 Ultra Performance Liquid Chromatography Uplc System, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/easy nanolc 1000 ultra performance liquid chromatography uplc system/product/Thermo Fisher
    Average 93 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    easy nanolc 1000 ultra performance liquid chromatography uplc system - by Bioz Stars, 2020-09
    93/100 stars
      Buy from Supplier

    Image Search Results