stx2eb his  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87

    Structured Review

    Millipore stx2eb his
    Construction of expression plasmids for Stx2e and mStx2e (A), <t>Stx2eB-His</t> (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.
    Stx2eb His, supplied by Millipore, used in various techniques. Bioz Stars score: 87/100, based on 10878 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/stx2eb his/product/Millipore
    Average 87 stars, based on 10878 article reviews
    Price from $9.99 to $1999.99
    stx2eb his - by Bioz Stars, 2020-04
    87/100 stars

    Images

    1) Product Images from "Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease"

    Article Title: Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.13-0118

    Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.
    Figure Legend Snippet: Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.

    Techniques Used: Expressing, Plasmid Preparation, Binding Assay, SDS Page, Purification, Derivative Assay, Staining

    Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.
    Figure Legend Snippet: Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.

    Techniques Used: Neutralization, Activity Assay, Mouse Assay

    A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.
    Figure Legend Snippet: A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.

    Techniques Used: Mouse Assay, Injection

    Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P
    Figure Legend Snippet: Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P

    Techniques Used: Mouse Assay

    2) Product Images from "Proteomic Analysis of and Immune Responses to Ehrlichia chaffeensis Lipoproteins "

    Article Title: Proteomic Analysis of and Immune Responses to Ehrlichia chaffeensis Lipoproteins

    Journal: Infection and Immunity

    doi: 10.1128/IAI.00056-08

    Four lipoproteins were expressed and induced humoral immune responses in E. chaffeensis -infected dogs. Either the serum from E. chaffeensis- infected dog A (Dog α-EC) was preabsorbed with a control E. coli BL21 lysate transformed with a blank pET29a(+)
    Figure Legend Snippet: Four lipoproteins were expressed and induced humoral immune responses in E. chaffeensis -infected dogs. Either the serum from E. chaffeensis- infected dog A (Dog α-EC) was preabsorbed with a control E. coli BL21 lysate transformed with a blank pET29a(+)

    Techniques Used: Infection, Transformation Assay

    3) Product Images from "Identification and Characterization of a Linear-Plasmid-Encoded Factor H-Binding Protein (FhbA) of the Relapsing Fever Spirochete Borrelia hermsii"

    Article Title: Identification and Characterization of a Linear-Plasmid-Encoded Factor H-Binding Protein (FhbA) of the Relapsing Fever Spirochete Borrelia hermsii

    Journal: Journal of Bacteriology

    doi: 10.1128/JB.186.9.2612-2618.2004

    Demonstration of factor H binding by recombinant FhbA. The gene encoding FhbA was amplified with primers containing tails that allow for LIC cloning and expression as an N-terminal S-tag fusion protein. The PCR fragment was annealed with pretreated pET32-Ek/LIC and propagated in NOVABlue cells, and the plasmid was isolated. The plasmid was transformed into E. coli BL21(DE3) cells, and colonies carrying the appropriate recombinant plasmids were grown in Luria-Bertani broth with ampicillin (50 μg ml −1 ). The cultures were induced with IPTG (or not induced), fractionated by SDS-PAGE, immunoblotted, and then tested for factor H binding by using the factor H ALBI assay or screened with S-protein-HRP conjugate (to confirm expression). For the factor H ALBI assay, the blots were incubated with purified human factor H, and then bound factor H was detected by using anti-human factor H antiserum and chemiluminescence.
    Figure Legend Snippet: Demonstration of factor H binding by recombinant FhbA. The gene encoding FhbA was amplified with primers containing tails that allow for LIC cloning and expression as an N-terminal S-tag fusion protein. The PCR fragment was annealed with pretreated pET32-Ek/LIC and propagated in NOVABlue cells, and the plasmid was isolated. The plasmid was transformed into E. coli BL21(DE3) cells, and colonies carrying the appropriate recombinant plasmids were grown in Luria-Bertani broth with ampicillin (50 μg ml −1 ). The cultures were induced with IPTG (or not induced), fractionated by SDS-PAGE, immunoblotted, and then tested for factor H binding by using the factor H ALBI assay or screened with S-protein-HRP conjugate (to confirm expression). For the factor H ALBI assay, the blots were incubated with purified human factor H, and then bound factor H was detected by using anti-human factor H antiserum and chemiluminescence.

    Techniques Used: Binding Assay, Recombinant, Amplification, Clone Assay, Expressing, Polymerase Chain Reaction, Plasmid Preparation, Isolation, Transformation Assay, SDS Page, Incubation, Purification

    4) Product Images from "Cell-Surface-Anchoring Role of N-Terminal Surface Layer Homology Domains of Clostridium cellulovorans EngE"

    Article Title: Cell-Surface-Anchoring Role of N-Terminal Surface Layer Homology Domains of Clostridium cellulovorans EngE

    Journal: Journal of Bacteriology

    doi: 10.1128/jb.184.4.884-888.2002

    Model showing attachment of EngE to the CbpA of C. cellulovorans and the cell surface. The three repeated SLH domains of the N terminus of EngE integrate into the cell wall layer containing peptidoglycan, while the C terminus of EngE is bound to CbpA through its dockerin domain. The question mark indicates that some interactions between SLH domains of EngE and cell wall containing peptidoglycan may be bridged by divalent ions but the data are not conclusive. CBD, cellulose binding domain; CD, catalytic domain.
    Figure Legend Snippet: Model showing attachment of EngE to the CbpA of C. cellulovorans and the cell surface. The three repeated SLH domains of the N terminus of EngE integrate into the cell wall layer containing peptidoglycan, while the C terminus of EngE is bound to CbpA through its dockerin domain. The question mark indicates that some interactions between SLH domains of EngE and cell wall containing peptidoglycan may be bridged by divalent ions but the data are not conclusive. CBD, cellulose binding domain; CD, catalytic domain.

    Techniques Used: Binding Assay

    Localization of EngE on C. cellulovorans . (A) Coomassie blue-stained SDS gel; (B) immunoblot with anti-EngE antiserum on each cell wall fraction. Lanes 1, whole cells (fraction F1); lanes 2, cell extract (fraction F2); lanes 3, crude cell walls (fraction F3); lanes 4, cell wall proteins (fraction F4); lanes 5, SDS-extracted cell wall fragments (fraction F5). Molecular size markers (in kilodaltons) are shown at the left. Four and 10 μl of each fraction were used for immunoblot analysis and SDS-PAGE, respectively.
    Figure Legend Snippet: Localization of EngE on C. cellulovorans . (A) Coomassie blue-stained SDS gel; (B) immunoblot with anti-EngE antiserum on each cell wall fraction. Lanes 1, whole cells (fraction F1); lanes 2, cell extract (fraction F2); lanes 3, crude cell walls (fraction F3); lanes 4, cell wall proteins (fraction F4); lanes 5, SDS-extracted cell wall fragments (fraction F5). Molecular size markers (in kilodaltons) are shown at the left. Four and 10 μl of each fraction were used for immunoblot analysis and SDS-PAGE, respectively.

    Techniques Used: Staining, SDS-Gel, SDS Page

    Binding of SLH domains of EngE to C. cellulovorans cell wall fragments. Each purified rEngE was incubated with fraction F5. Any insoluble material was precipitated and washed as described in Materials and Methods. Lanes S, soluble fraction; lanes W, wash fraction; lanes I, insoluble fraction. Molecular size markers (in kilodaltons) are shown at the left.
    Figure Legend Snippet: Binding of SLH domains of EngE to C. cellulovorans cell wall fragments. Each purified rEngE was incubated with fraction F5. Any insoluble material was precipitated and washed as described in Materials and Methods. Lanes S, soluble fraction; lanes W, wash fraction; lanes I, insoluble fraction. Molecular size markers (in kilodaltons) are shown at the left.

    Techniques Used: Binding Assay, Purification, Incubation

    (A) Schematic representation of C. cellulovorans CbpA and mini-CbpA. a.a., amino acids. (B) Binding of mini-CbpA to the cell surface by SLH domains of EngE. Purified rEngE 32-1030 and mini-CbpA were incubated with fraction F5 and analyzed by SDS-PAGE. (a) Reaction of rEngE 32-1030 and mini-CbpA; (b) reaction of mini-CbpA only; (c) reaction of rEngE 32-1030 and mini-CbpA plus 20 mM EDTA. Any insoluble material was precipitated and washed as described in Materials and Methods. Lanes S, soluble fraction; lanes W, wash fraction; lanes I, insoluble fraction. Molecular size markers (in kilodaltons) are shown at the left.
    Figure Legend Snippet: (A) Schematic representation of C. cellulovorans CbpA and mini-CbpA. a.a., amino acids. (B) Binding of mini-CbpA to the cell surface by SLH domains of EngE. Purified rEngE 32-1030 and mini-CbpA were incubated with fraction F5 and analyzed by SDS-PAGE. (a) Reaction of rEngE 32-1030 and mini-CbpA; (b) reaction of mini-CbpA only; (c) reaction of rEngE 32-1030 and mini-CbpA plus 20 mM EDTA. Any insoluble material was precipitated and washed as described in Materials and Methods. Lanes S, soluble fraction; lanes W, wash fraction; lanes I, insoluble fraction. Molecular size markers (in kilodaltons) are shown at the left.

    Techniques Used: Binding Assay, Purification, Incubation, SDS Page

    5) Product Images from "Sequence and Expression Analysis of virB9 of the Type IV Secretion System of Ehrlichia canis Strains in Ticks, Dogs, and Cultured Cells "

    Article Title: Sequence and Expression Analysis of virB9 of the Type IV Secretion System of Ehrlichia canis Strains in Ticks, Dogs, and Cultured Cells

    Journal: Infection and Immunity

    doi: 10.1128/IAI.71.10.6063-6067.2003

    (A) SDS-polyacrylamide gel electrophoresis analysis of purified E. canis Oklahoma T rVirB9. Affinity-purified (AP) rVirB9 (2 μg) was subjected to SDS-polyacrylamide gel electrophoresis followed by Coomassie blue staining. M, molecular size marker. The numbers on the left are molecular masses, in kilodaltons. (B) Western immunoblot analysis to detect E. canis VirB9-specific antibody in plasma samples from infected dogs. pET33b-transformed E. coli was used as a negative control. rVirB9, affinity-purified recombinant fusion protein of E. canis . Antigens (15 μg of E. coli and 2 μg of rVirB9) were subjected to Western blot analysis with serum derived from the blood of various infected dogs (OK, Oklahoma; OH, Ohio; AZ, Arizona; NM, New Mexico). The arrow on the right indicates the apparent molecular mass of rVirB9, based on broad-range prestained standards (Bio-Rad Laboratories, Richmond, Calif.).
    Figure Legend Snippet: (A) SDS-polyacrylamide gel electrophoresis analysis of purified E. canis Oklahoma T rVirB9. Affinity-purified (AP) rVirB9 (2 μg) was subjected to SDS-polyacrylamide gel electrophoresis followed by Coomassie blue staining. M, molecular size marker. The numbers on the left are molecular masses, in kilodaltons. (B) Western immunoblot analysis to detect E. canis VirB9-specific antibody in plasma samples from infected dogs. pET33b-transformed E. coli was used as a negative control. rVirB9, affinity-purified recombinant fusion protein of E. canis . Antigens (15 μg of E. coli and 2 μg of rVirB9) were subjected to Western blot analysis with serum derived from the blood of various infected dogs (OK, Oklahoma; OH, Ohio; AZ, Arizona; NM, New Mexico). The arrow on the right indicates the apparent molecular mass of rVirB9, based on broad-range prestained standards (Bio-Rad Laboratories, Richmond, Calif.).

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Affinity Purification, Staining, Marker, Western Blot, Infection, Transformation Assay, Negative Control, Derivative Assay

    6) Product Images from "Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell"

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell

    Journal: Saudi Journal of Biological Sciences

    doi: 10.1016/j.sjbs.2016.05.003

    This figure represents the details of the 3C/LIC cloning strategy, PCR product containing the 5LIC extension were treated with LIC-qualified T4 DNA polymerase in the presence of dATB, and then annealed to the 3C/LIC vector.
    Figure Legend Snippet: This figure represents the details of the 3C/LIC cloning strategy, PCR product containing the 5LIC extension were treated with LIC-qualified T4 DNA polymerase in the presence of dATB, and then annealed to the 3C/LIC vector.

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Plasmid Preparation

    7) Product Images from "Characterization and Recombinant Expression of Terebrid Venom Peptide from Terebra guttata"

    Article Title: Characterization and Recombinant Expression of Terebrid Venom Peptide from Terebra guttata

    Journal: Toxins

    doi: 10.3390/toxins8030063

    Recombinant expression and characterization of Tgu6.1 teretoxin. ( A ) Terebrid snail Terebra guttata from which the Tgu6.1 teretoxin was discovered. ( B ) Plasmid map of Tgu6.1 cloned into pET-32a Xa/ligation independent cloning (LIC) vector via LIC. ( C ) RP-HPLC purification of recombinant Tgu6.1 from its fusion tag after expression, purification and cleavage (top spectra); LC-MS analysis of Tgu6.1 (bottom spectra). ( D ) Characterization of Tgu6.1 bioactivity using the native prey polychaete worm assay (view the video in Supplemental Material ).
    Figure Legend Snippet: Recombinant expression and characterization of Tgu6.1 teretoxin. ( A ) Terebrid snail Terebra guttata from which the Tgu6.1 teretoxin was discovered. ( B ) Plasmid map of Tgu6.1 cloned into pET-32a Xa/ligation independent cloning (LIC) vector via LIC. ( C ) RP-HPLC purification of recombinant Tgu6.1 from its fusion tag after expression, purification and cleavage (top spectra); LC-MS analysis of Tgu6.1 (bottom spectra). ( D ) Characterization of Tgu6.1 bioactivity using the native prey polychaete worm assay (view the video in Supplemental Material ).

    Techniques Used: Recombinant, Expressing, Plasmid Preparation, Clone Assay, Positron Emission Tomography, Ligation, High Performance Liquid Chromatography, Purification, Liquid Chromatography with Mass Spectroscopy

    Recombinant expression strategy of Tgu6.1. ( A ) Full precursor structure of Tgu6.1. The signal sequence is shaded in gray; the pro-region is underlined; and the mature peptide is shaded in blue. ( B ) Schematic representation of Tgu6.1 fusion protein. The fusion protein was expressed under the control of a pET-32a T7 promoter and contains thioredoxin as the fusion partner, His6-tag for purification and the enterokinase (EK) site for the cleavage of Tgu6.1 from TRX by enterokinase. ( C ) Plasmid map of the expression vector. The Tgu6.1 gene was cloned into pET-32a XA/LIC plasmid by ligation independent cloning.
    Figure Legend Snippet: Recombinant expression strategy of Tgu6.1. ( A ) Full precursor structure of Tgu6.1. The signal sequence is shaded in gray; the pro-region is underlined; and the mature peptide is shaded in blue. ( B ) Schematic representation of Tgu6.1 fusion protein. The fusion protein was expressed under the control of a pET-32a T7 promoter and contains thioredoxin as the fusion partner, His6-tag for purification and the enterokinase (EK) site for the cleavage of Tgu6.1 from TRX by enterokinase. ( C ) Plasmid map of the expression vector. The Tgu6.1 gene was cloned into pET-32a XA/LIC plasmid by ligation independent cloning.

    Techniques Used: Recombinant, Expressing, Sequencing, Positron Emission Tomography, Purification, Plasmid Preparation, Clone Assay, Ligation

    8) Product Images from "Bile-Inducible Efflux Transporter from Bifidobacterium longum NCC2705, Conferring Bile Resistance ▿"

    Article Title: Bile-Inducible Efflux Transporter from Bifidobacterium longum NCC2705, Conferring Bile Resistance ▿

    Journal: Applied and Environmental Microbiology

    doi: 10.1128/AEM.00172-09

    Organization of the B. longum subsp. longum NCC2705 genomic region containing the BL0920 gene and its flanking sequences and the corresponding sequences in B. breve UCC2003, B. adolescentis ATCC 15703, and B. longum subsp. infantis ATCC 15697. The pin-like
    Figure Legend Snippet: Organization of the B. longum subsp. longum NCC2705 genomic region containing the BL0920 gene and its flanking sequences and the corresponding sequences in B. breve UCC2003, B. adolescentis ATCC 15703, and B. longum subsp. infantis ATCC 15697. The pin-like

    Techniques Used:

    Fluorescence levels in cells and supernatants of tDE3 cells carrying the empty pETblue-1 plasmid or the same plasmid containing the BL0920 gene (plasmid pETBL0920), after cells were loaded with fluorescent UDCA followed by 5 min of incubation (37°C)
    Figure Legend Snippet: Fluorescence levels in cells and supernatants of tDE3 cells carrying the empty pETblue-1 plasmid or the same plasmid containing the BL0920 gene (plasmid pETBL0920), after cells were loaded with fluorescent UDCA followed by 5 min of incubation (37°C)

    Techniques Used: Fluorescence, Plasmid Preparation, Incubation

    9) Product Images from "The ?14 Mutation of Human Cardiac Troponin T Enhances ATPase Activity and Alters the Cooperative Binding of S1-ADP to Regulated Actin †"

    Article Title: The ?14 Mutation of Human Cardiac Troponin T Enhances ATPase Activity and Alters the Cooperative Binding of S1-ADP to Regulated Actin †

    Journal: Biochemistry

    doi: 10.1021/bi048646h

    Mutations of Troponin T Enhance ATPase Activity
    Figure Legend Snippet: Mutations of Troponin T Enhance ATPase Activity

    Techniques Used: Activity Assay

    10) Product Images from "Integrating artificial with natural cells to translate chemical messages that direct E. coli behaviour"

    Article Title: Integrating artificial with natural cells to translate chemical messages that direct E. coli behaviour

    Journal: Nature Communications

    doi: 10.1038/ncomms5012

    In vitro characterization of the theophylline-sensing device and αHL. ( a ) The cell-free expression of αHL–GFP behind a theophylline riboswitch gives rise to similar levels of fluorescence both in the presence (+theo) and absence (−theo) of theophylline at 37 °C. ( b ) The removal of the theophylline riboswitch and thus, the RBS preceding the start codon of αHL–GFP shows production of a fluorescent protein product when incubated with transcription–translation machinery (−RBS). The removal of a putative internal RBS within the αHL coding portion of the fusion construct significantly decreases the production of the fluorescent protein product (−RBS mutant). ( c ) The activity of the theophylline-sensing device is observable by fluorescence when an internal RBS is removed. The top and middle curves are the in vitro expression of αHL–GFP behind the theophylline riboswitch in the presence (+theo) and absence of theophylline (−theo), respectively. Background fluorescent protein production is shown with the same construct lacking the theophylline riboswitch (−RBS mutant) used in b . ( d ) The cell-free expression of theophylline riboswitch-controlled αHL-degraded red blood cells (RBCs) in the presence (+theo) but not the absence of theophylline (−theo). Control reactions include the expression of an αHL construct lacking the theophylline riboswitch (αHL) and RBCs alone (negative control). RBC degradation was monitored by attenuance at 22 °C. The exploited constructs were SP011A for panel A, SP002A and AS014A for panel B, RL069A and AS014A for c , and RL067A and JF001A for d ( Supplementary Table 1 ). Data are averages of three independent reactions.
    Figure Legend Snippet: In vitro characterization of the theophylline-sensing device and αHL. ( a ) The cell-free expression of αHL–GFP behind a theophylline riboswitch gives rise to similar levels of fluorescence both in the presence (+theo) and absence (−theo) of theophylline at 37 °C. ( b ) The removal of the theophylline riboswitch and thus, the RBS preceding the start codon of αHL–GFP shows production of a fluorescent protein product when incubated with transcription–translation machinery (−RBS). The removal of a putative internal RBS within the αHL coding portion of the fusion construct significantly decreases the production of the fluorescent protein product (−RBS mutant). ( c ) The activity of the theophylline-sensing device is observable by fluorescence when an internal RBS is removed. The top and middle curves are the in vitro expression of αHL–GFP behind the theophylline riboswitch in the presence (+theo) and absence of theophylline (−theo), respectively. Background fluorescent protein production is shown with the same construct lacking the theophylline riboswitch (−RBS mutant) used in b . ( d ) The cell-free expression of theophylline riboswitch-controlled αHL-degraded red blood cells (RBCs) in the presence (+theo) but not the absence of theophylline (−theo). Control reactions include the expression of an αHL construct lacking the theophylline riboswitch (αHL) and RBCs alone (negative control). RBC degradation was monitored by attenuance at 22 °C. The exploited constructs were SP011A for panel A, SP002A and AS014A for panel B, RL069A and AS014A for c , and RL067A and JF001A for d ( Supplementary Table 1 ). Data are averages of three independent reactions.

    Techniques Used: In Vitro, Expressing, Fluorescence, Incubation, Construct, Mutagenesis, Activity Assay, Negative Control

    11) Product Images from "Mapping the Ligand-Binding Region of Borrelia burgdorferi Fibronectin-Binding Protein BBK32"

    Article Title: Mapping the Ligand-Binding Region of Borrelia burgdorferi Fibronectin-Binding Protein BBK32

    Journal: Infection and Immunity

    doi: 10.1128/IAI.69.6.4129-4133.2001

    Fibronectin-binding activities of E. coli clones expressing the bbk32 gene from isolates representing different genospecies of B. burgdorferi . The bbk32 gene was amplified from each isolate and cloned into the pMalc2 vector. Expression of the cloned gene results in a recombinant fusion protein of 80 kDa. Lysates from each E. coli clone were subjected to SDS-PAGE on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to nitrocellulose for ligand blotting with alkaline phosphatase-labeled human fibronectin (B). The isolate from which bbk32 was derived is indicated above each lane. The genospecies designation for each isolate is as follows: B31, B. burgdorferi sensu stricto; IP90, B. garinii ; ACA1, B. afzelii ; and DN127, B. bissettii . Expression of the pMalc2 vector in E. coli produces a fusion protein of 52 kDa (Vector Only). Sizes of the molecular weight markers (MWS) are provided in kilodaltons.
    Figure Legend Snippet: Fibronectin-binding activities of E. coli clones expressing the bbk32 gene from isolates representing different genospecies of B. burgdorferi . The bbk32 gene was amplified from each isolate and cloned into the pMalc2 vector. Expression of the cloned gene results in a recombinant fusion protein of 80 kDa. Lysates from each E. coli clone were subjected to SDS-PAGE on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to nitrocellulose for ligand blotting with alkaline phosphatase-labeled human fibronectin (B). The isolate from which bbk32 was derived is indicated above each lane. The genospecies designation for each isolate is as follows: B31, B. burgdorferi sensu stricto; IP90, B. garinii ; ACA1, B. afzelii ; and DN127, B. bissettii . Expression of the pMalc2 vector in E. coli produces a fusion protein of 52 kDa (Vector Only). Sizes of the molecular weight markers (MWS) are provided in kilodaltons.

    Techniques Used: Binding Assay, Clone Assay, Expressing, Amplification, Plasmid Preparation, Recombinant, SDS Page, Staining, Labeling, Derivative Assay, Molecular Weight

    Mapping the ligand-binding region of BBK32. Fragments of the bbk32 gene from B. burgdorferi isolate B31 were cloned into the pScreen T vector and expressed as recombinant fusion proteins in E. coli . Proteins from E. coli lysates were separated on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to a nitrocellulose membrane and probed with alkaline phosphatase-labeled human fibronectin (B). The BBK32 amino acid sequence expressed by each clone is indicated above each lane. A clone expressing the vector-derived peptide of 37 kDa is labeled Vector Only. Sizes of the molecular weight standards (MWS) are provided in kilodaltons.
    Figure Legend Snippet: Mapping the ligand-binding region of BBK32. Fragments of the bbk32 gene from B. burgdorferi isolate B31 were cloned into the pScreen T vector and expressed as recombinant fusion proteins in E. coli . Proteins from E. coli lysates were separated on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to a nitrocellulose membrane and probed with alkaline phosphatase-labeled human fibronectin (B). The BBK32 amino acid sequence expressed by each clone is indicated above each lane. A clone expressing the vector-derived peptide of 37 kDa is labeled Vector Only. Sizes of the molecular weight standards (MWS) are provided in kilodaltons.

    Techniques Used: Ligand Binding Assay, Clone Assay, Plasmid Preparation, Recombinant, Staining, Labeling, Sequencing, Expressing, Derivative Assay, Molecular Weight

    Alignment of BBK32 amino acid sequences from isolates representing different genospecies of B. burgdorferi with the ligand-binding region (amino acids 131 to 162) of BBK32 from isolate B31. The genospecies designations for the isolates are as follows: B31, B. burgdorferi sensu stricto; IP90, B. garinii ; ACA1, B. afzelii ; and DN127, B. bissettii . Sequence dissimilarity is indicated with a single-letter amino acid code. Sequence identity is shown as a period. Shaded amino acids residues represent sequence identity between the ligand-binding regions of BBK32 from isolate B31 and the UR region of protein F1 from S. pyogenes .
    Figure Legend Snippet: Alignment of BBK32 amino acid sequences from isolates representing different genospecies of B. burgdorferi with the ligand-binding region (amino acids 131 to 162) of BBK32 from isolate B31. The genospecies designations for the isolates are as follows: B31, B. burgdorferi sensu stricto; IP90, B. garinii ; ACA1, B. afzelii ; and DN127, B. bissettii . Sequence dissimilarity is indicated with a single-letter amino acid code. Sequence identity is shown as a period. Shaded amino acids residues represent sequence identity between the ligand-binding regions of BBK32 from isolate B31 and the UR region of protein F1 from S. pyogenes .

    Techniques Used: Ligand Binding Assay, Sequencing

    12) Product Images from "Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion"

    Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006467

    Differences between the membrane-bound forms of each EqCXCL16 isoform in OxLDL scavenger receptor activity. Approximately 5 x 10 5 naïve HEK-293T and stable HEK-EqCXCL16S and HEK-EqCXCL16R cells/well were plated on a 24-well plate, permitted to adhere for 24 h prior to washing and incubation with Dil-OxLDL for 3 h at 37°C. Following this, cells were washed again with PBS pre-warmed to 37°C, fixed with 4% PFA, and examined with an inverted fluorescence microscope. A marked increase in Dil-OxLDL binding and internalization was shown in HEK-EqCXCL16S (b) as compared to naïve HEK-293T (a), or HEK-EqCXCL16R (c), or HEK-EqCXCL16S cells treated with Gp α-EqCXCL16 pAb (d).
    Figure Legend Snippet: Differences between the membrane-bound forms of each EqCXCL16 isoform in OxLDL scavenger receptor activity. Approximately 5 x 10 5 naïve HEK-293T and stable HEK-EqCXCL16S and HEK-EqCXCL16R cells/well were plated on a 24-well plate, permitted to adhere for 24 h prior to washing and incubation with Dil-OxLDL for 3 h at 37°C. Following this, cells were washed again with PBS pre-warmed to 37°C, fixed with 4% PFA, and examined with an inverted fluorescence microscope. A marked increase in Dil-OxLDL binding and internalization was shown in HEK-EqCXCL16S (b) as compared to naïve HEK-293T (a), or HEK-EqCXCL16R (c), or HEK-EqCXCL16S cells treated with Gp α-EqCXCL16 pAb (d).

    Techniques Used: Activity Assay, Incubation, Fluorescence, Microscopy, Binding Assay

    Cellular adhesion properties of EqCXCL16S and EqCXCL16R. Naïve HEK-293T, stable HEK-EqCXCL16S and HEK-EqCXCL16R cells (5 x 10 5 cells/well) with or without pre-treatment with Gp α-EqCXCL16 pAb were permitted to adhere for 24 h before incubation with 0.5M EDTA for 10 min at 37°C, fixation in 4% PFA, and staining with 0.1% crystal violet. The dye was then extracted with 10% acetic acid prior to determining OD 595nm values. A) Representative image of a 24-well plate stained with crystal violet following EDTA treatment showing the differences in adhesion of the different HEK-293T-derived cells. B) Stable HEK-EqCXCL16S cells possess significantly higher adhesion properties that can be eliminated by pre-treatment with Gp α-EqCXCL16 pAb compared to naïve HEK-293T or HEK-EqCXCL16R cells. Mean OD 595nm values ± SD of the cell lysate are presented in the bar diagram. P
    Figure Legend Snippet: Cellular adhesion properties of EqCXCL16S and EqCXCL16R. Naïve HEK-293T, stable HEK-EqCXCL16S and HEK-EqCXCL16R cells (5 x 10 5 cells/well) with or without pre-treatment with Gp α-EqCXCL16 pAb were permitted to adhere for 24 h before incubation with 0.5M EDTA for 10 min at 37°C, fixation in 4% PFA, and staining with 0.1% crystal violet. The dye was then extracted with 10% acetic acid prior to determining OD 595nm values. A) Representative image of a 24-well plate stained with crystal violet following EDTA treatment showing the differences in adhesion of the different HEK-293T-derived cells. B) Stable HEK-EqCXCL16S cells possess significantly higher adhesion properties that can be eliminated by pre-treatment with Gp α-EqCXCL16 pAb compared to naïve HEK-293T or HEK-EqCXCL16R cells. Mean OD 595nm values ± SD of the cell lysate are presented in the bar diagram. P

    Techniques Used: Incubation, Staining, Derivative Assay

    The ability of EqCXCL16 to function as an entry receptor for EAV is determined by amino acid substitutions in the N-terminal ectodomain of the protein encoded by exon 1. A) Stable HEK-293T cell lines were generated by transfection with the pJ609-EqCXCL16S or pJ609-EqCXCL16R plasmid DNA followed by selection with antibiotic puromycin. These cells (panel a: EqCXCL16S, panel b: EqCXCL16R) were surface stained with Gp α-EqCXCL16 Ab or guinea pig pre-bleed (Gp Pb) sera (panels d and e) as primary antibodies, followed by goat anti-Gp IgG(H+L) conjugated to Alexa Fluor 488 and analyzed by confocal microscopy to confirm the expression of EqCXCL16 protein. Naïve HEK-293T cells were also stained with Gp α-EqCXCL16 Ab (panel c). B) Naïve HEK-293T and stable HEK-EqCXCL16S and HEK-EqCXCL16R cells were lysed in RIPA cell-lysis buffer and an equal amount of lysates were analyzed by WB using Gp Pb sera or Gp α-EqCXCL16 Ab. Arrow indicates the absence or presence of EqCXCL16 protein in the WB membrane (molecular weight approximately 30 kDa). C) Naïve HEK-293T (a), HEK-EqCXCL16S (b), and HEK-EqCXCL16R (c) cells were infected with EAV sVBSmCherry (synthetic virus expressing mCherry) [ 24 ] at a multiplicity of infection of 1 (MOI = 1). At 12 hours post infection (hpi), cells were washed with PBS, fixed in 4% paraformaldehyde (PFA) and analyzed with an inverted immunofluorescence microscope for the expression of mCherry (red) as an indicator of EAV infection. Markedly increased numbers of stable HEK-EqCXCL16S cells were shown to express mCherry compared to naïve HEK-293T and stable HEK-EqCXCL16R cells. D) The role of EqCXCL16 variants on EAV infection and gene expression was analyzed in the EAV sVBSmCherry infected cells. a) HEK-EqCXCL16S, b) HEK-EqCXCL16R, and c) naïve HEK-293T cells were infected with EAV sVBSmCherry at an MOI = 1. After fixation in 4% PFA at 12 hpi, cells were analyzed with an inverted immunofluorescence microscope for the expression of EAV nsp-1 gene using a monoclonal antibody, α-nsp-1 MAb (12A4). Images are representative of three independent experiments.
    Figure Legend Snippet: The ability of EqCXCL16 to function as an entry receptor for EAV is determined by amino acid substitutions in the N-terminal ectodomain of the protein encoded by exon 1. A) Stable HEK-293T cell lines were generated by transfection with the pJ609-EqCXCL16S or pJ609-EqCXCL16R plasmid DNA followed by selection with antibiotic puromycin. These cells (panel a: EqCXCL16S, panel b: EqCXCL16R) were surface stained with Gp α-EqCXCL16 Ab or guinea pig pre-bleed (Gp Pb) sera (panels d and e) as primary antibodies, followed by goat anti-Gp IgG(H+L) conjugated to Alexa Fluor 488 and analyzed by confocal microscopy to confirm the expression of EqCXCL16 protein. Naïve HEK-293T cells were also stained with Gp α-EqCXCL16 Ab (panel c). B) Naïve HEK-293T and stable HEK-EqCXCL16S and HEK-EqCXCL16R cells were lysed in RIPA cell-lysis buffer and an equal amount of lysates were analyzed by WB using Gp Pb sera or Gp α-EqCXCL16 Ab. Arrow indicates the absence or presence of EqCXCL16 protein in the WB membrane (molecular weight approximately 30 kDa). C) Naïve HEK-293T (a), HEK-EqCXCL16S (b), and HEK-EqCXCL16R (c) cells were infected with EAV sVBSmCherry (synthetic virus expressing mCherry) [ 24 ] at a multiplicity of infection of 1 (MOI = 1). At 12 hours post infection (hpi), cells were washed with PBS, fixed in 4% paraformaldehyde (PFA) and analyzed with an inverted immunofluorescence microscope for the expression of mCherry (red) as an indicator of EAV infection. Markedly increased numbers of stable HEK-EqCXCL16S cells were shown to express mCherry compared to naïve HEK-293T and stable HEK-EqCXCL16R cells. D) The role of EqCXCL16 variants on EAV infection and gene expression was analyzed in the EAV sVBSmCherry infected cells. a) HEK-EqCXCL16S, b) HEK-EqCXCL16R, and c) naïve HEK-293T cells were infected with EAV sVBSmCherry at an MOI = 1. After fixation in 4% PFA at 12 hpi, cells were analyzed with an inverted immunofluorescence microscope for the expression of EAV nsp-1 gene using a monoclonal antibody, α-nsp-1 MAb (12A4). Images are representative of three independent experiments.

    Techniques Used: Generated, Transfection, Plasmid Preparation, Selection, Staining, Confocal Microscopy, Expressing, Lysis, Western Blot, Molecular Weight, Infection, Immunofluorescence, Microscopy

    Binding of EAV to EqCXCL16 is determined by amino acid substitutions within the N-terminal ectodomain of the protein encoded by exon 1. A). Effect of amino acid differences between EqCXCL16S and EqCXCL16R on EAV binding as determined by a combination of VOPBA and Far-WB analysis. Naïve HEK-293T, stable HEK-EqCXCL16S and HEK-EqCXCL16R cells were lysed in RIPA buffer, the lysate proteins separated using 12% SDS-PAGE and transferred onto a PVDF membrane. Membrane bound proteins were denatured and renatured using sequentially decreasing concentrations of Gn-HCl following which the membranes were blocked and incubated either with purified EAV VBS (15 μg/ml) in protein binding buffer (a) or with protein binding buffer without purified EAV VBS (b). After washing, membranes were incubated with α-GP5 MAb 6D10 and developed using the enhanced chemiluminescence (ECL) method. Binding of EAV VBS to EqCXCL16 protein is shown in (a [arrow]). The same membrane (a) was stripped and re-probed with Gp anti-EqCXCL16 as shown in panel c. As indicated by the arrow in panel c, EqCXCL16S and EqCXCL16R were detected at the same position on the membrane where EAV GP5 was detected in panel a. B). Amino acid substitutions between the “S” and “R” EqCXCL16 isoforms and attachment of EAV to host cells. Equal numbers (2 x 10 6 ) of a) naïve HEK-293T cells and stable b) HEK-EqCXCL16S and c) HEK-EqCXCL16R cells were washed, resuspended in cold PBS (pH 7.4) with 2% FBS (PBS-F) and then incubated with biotinylated EAV VBS on ice for 2 h in the dark. After adsorption, excess EAV was removed by washing in cold PBS-F, and cells were then stained with Streptavidin-FITC and DAPI solution. Significantly higher number of HEK-EqCXCL16S cells were observed to bind biotinylated EAV (panel a) compared to the HEK-EqCXCL16R (panel b) or naïve control HEK-293T cells (panel c). Statistically different results are represented with different letters, a and b. Panel d shows the graphical representation of the images from panels a, b, and c. All the images depicted were representative of three independent experiments. Data were analyzed by ANOVA; P
    Figure Legend Snippet: Binding of EAV to EqCXCL16 is determined by amino acid substitutions within the N-terminal ectodomain of the protein encoded by exon 1. A). Effect of amino acid differences between EqCXCL16S and EqCXCL16R on EAV binding as determined by a combination of VOPBA and Far-WB analysis. Naïve HEK-293T, stable HEK-EqCXCL16S and HEK-EqCXCL16R cells were lysed in RIPA buffer, the lysate proteins separated using 12% SDS-PAGE and transferred onto a PVDF membrane. Membrane bound proteins were denatured and renatured using sequentially decreasing concentrations of Gn-HCl following which the membranes were blocked and incubated either with purified EAV VBS (15 μg/ml) in protein binding buffer (a) or with protein binding buffer without purified EAV VBS (b). After washing, membranes were incubated with α-GP5 MAb 6D10 and developed using the enhanced chemiluminescence (ECL) method. Binding of EAV VBS to EqCXCL16 protein is shown in (a [arrow]). The same membrane (a) was stripped and re-probed with Gp anti-EqCXCL16 as shown in panel c. As indicated by the arrow in panel c, EqCXCL16S and EqCXCL16R were detected at the same position on the membrane where EAV GP5 was detected in panel a. B). Amino acid substitutions between the “S” and “R” EqCXCL16 isoforms and attachment of EAV to host cells. Equal numbers (2 x 10 6 ) of a) naïve HEK-293T cells and stable b) HEK-EqCXCL16S and c) HEK-EqCXCL16R cells were washed, resuspended in cold PBS (pH 7.4) with 2% FBS (PBS-F) and then incubated with biotinylated EAV VBS on ice for 2 h in the dark. After adsorption, excess EAV was removed by washing in cold PBS-F, and cells were then stained with Streptavidin-FITC and DAPI solution. Significantly higher number of HEK-EqCXCL16S cells were observed to bind biotinylated EAV (panel a) compared to the HEK-EqCXCL16R (panel b) or naïve control HEK-293T cells (panel c). Statistically different results are represented with different letters, a and b. Panel d shows the graphical representation of the images from panels a, b, and c. All the images depicted were representative of three independent experiments. Data were analyzed by ANOVA; P

    Techniques Used: Binding Assay, Far Western Blot, SDS Page, Incubation, Purification, Protein Binding, Adsorption, Staining

    Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on chemoattractant properties of EqCXCL16S and EqCXCL16R. Purified recombinant soluble forms of EqCXCL16S and EqCXCL16R proteins (2 μg/ml) in RPMI medium containing 0.5% BSA were added to the lower compartment of a Boyden chemotaxis chamber separated from the upper by a polycarbonate filter having a 3 μm pore size; CD3 + T lymphocytes (5 x10 5 ) labelled with Calcein-AM were added to the upper chamber and incubated for 6 h. The cells that passed through the filter were counted with a fluorescent microscope and represented in a bar diagram. Controls consisted of RPMI with 0.5% BSA and EqCXCL16 (S and R) pre-treated by incubation with Gp α-EqCXCL16 pAb. No statistically significant differences were found in chemoattractant potential between recombinant EqCXCL16S and EqCXCL16R proteins whereas CD3 + T lymphocyte migration in response to pre-treatment of these molecules with Gp α-EqCXCL16 pAb was similar to that observed in the medium only control. Experiments were repeated independently three times. The bar diagram represents mean ± SD, P
    Figure Legend Snippet: Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on chemoattractant properties of EqCXCL16S and EqCXCL16R. Purified recombinant soluble forms of EqCXCL16S and EqCXCL16R proteins (2 μg/ml) in RPMI medium containing 0.5% BSA were added to the lower compartment of a Boyden chemotaxis chamber separated from the upper by a polycarbonate filter having a 3 μm pore size; CD3 + T lymphocytes (5 x10 5 ) labelled with Calcein-AM were added to the upper chamber and incubated for 6 h. The cells that passed through the filter were counted with a fluorescent microscope and represented in a bar diagram. Controls consisted of RPMI with 0.5% BSA and EqCXCL16 (S and R) pre-treated by incubation with Gp α-EqCXCL16 pAb. No statistically significant differences were found in chemoattractant potential between recombinant EqCXCL16S and EqCXCL16R proteins whereas CD3 + T lymphocyte migration in response to pre-treatment of these molecules with Gp α-EqCXCL16 pAb was similar to that observed in the medium only control. Experiments were repeated independently three times. The bar diagram represents mean ± SD, P

    Techniques Used: Purification, Recombinant, Chemotaxis Assay, Incubation, Microscopy, Migration

    Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on binding to the EqCXCR6 receptor protein in vitro . Interactions between purified recombinant EqCXCL16S/R-EqCXCR6 were examined using Far-WB. Equal amounts (20 μg) of His-tagged EqCXCR6 protein or BSA as a control were separated in different lanes on 10% SDS-PAGE and transferred onto a PVDF membrane. Proteins were then sequentially denatured and renatured by using different concentrations of Gn-HCl. After blocking, the membranes were incubated with soluble EqCXCL16S (panel a) or EqCXCL16R (panel b) protein (5 μg/ml) followed by Rb α-EqCXCL16 Ab. After washing, membranes were developed using the ECL method. Binding of EqCXCL16S and EqCXCL16R to EqCXCR6 is indicated by arrows (panels a and b). These interactions occurred at the same location as that occupied by EqCXCR6; this was confirmed by stripping the membrane shown in panel b and re-probing it with anti-His antibody as shown in panel c.
    Figure Legend Snippet: Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on binding to the EqCXCR6 receptor protein in vitro . Interactions between purified recombinant EqCXCL16S/R-EqCXCR6 were examined using Far-WB. Equal amounts (20 μg) of His-tagged EqCXCR6 protein or BSA as a control were separated in different lanes on 10% SDS-PAGE and transferred onto a PVDF membrane. Proteins were then sequentially denatured and renatured by using different concentrations of Gn-HCl. After blocking, the membranes were incubated with soluble EqCXCL16S (panel a) or EqCXCL16R (panel b) protein (5 μg/ml) followed by Rb α-EqCXCL16 Ab. After washing, membranes were developed using the ECL method. Binding of EqCXCL16S and EqCXCL16R to EqCXCR6 is indicated by arrows (panels a and b). These interactions occurred at the same location as that occupied by EqCXCR6; this was confirmed by stripping the membrane shown in panel b and re-probing it with anti-His antibody as shown in panel c.

    Techniques Used: Binding Assay, In Vitro, Purification, Recombinant, Far Western Blot, SDS Page, Blocking Assay, Incubation, Stripping Membranes

    13) Product Images from "Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat"

    Article Title: Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.02237

    SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.
    Figure Legend Snippet: SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Expressing, Purification

    Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .
    Figure Legend Snippet: Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .

    Techniques Used:

    Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.
    Figure Legend Snippet: Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.

    Techniques Used: Western Blot

    Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.
    Figure Legend Snippet: Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.

    Techniques Used: Sequencing

    14) Product Images from "Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell"

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell

    Journal: Saudi Journal of Biological Sciences

    doi: 10.1016/j.sjbs.2016.05.003

    This figure represents the details of the 3C/LIC cloning strategy, PCR product containing the 5LIC extension were treated with LIC-qualified T4 DNA polymerase in the presence of dATB, and then annealed to the 3C/LIC vector.
    Figure Legend Snippet: This figure represents the details of the 3C/LIC cloning strategy, PCR product containing the 5LIC extension were treated with LIC-qualified T4 DNA polymerase in the presence of dATB, and then annealed to the 3C/LIC vector.

    Techniques Used: Clone Assay, Polymerase Chain Reaction, Plasmid Preparation

    15) Product Images from "Identification and Characterization of a Novel Calcium-Activated Apyrase from Cryptosporidium Parasites and Its Potential Role in Pathogenesis"

    Article Title: Identification and Characterization of a Novel Calcium-Activated Apyrase from Cryptosporidium Parasites and Its Potential Role in Pathogenesis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0031030

    Expression, Purification and Refolding of recombinant CApy. The electrophoretic analysis (SDS-PAGE, 12% PAA under reducing conditions) shows extracts of non-induced and induced E. coli cultures (lane 1 and 2) bearing the CApy gene in the pTriEx-4 expression vector from samples taken at different steps of protein purification (lanes 3–10). Following bacterial cell lysis the soluble (supernatant, lane 3) and insoluble (pellet, lane 4) fractions show that CApy was mostly found in the insoluble fraction in form of inclusion bodies (IBs). The solubilized IBs (see Materials and Methods ) were loaded onto a Ni 2+ chelate column and purified under denaturing conditions, flow-through (lane 5), wash (lane 6), and elution (lane 7) fractions were collected. The eluate containing the purified CApy was refolded by dialysis against folding buffer (lane 8), which was subsequently dialysed against PBS, pH 7.4 (lane 9) or 20 mM MOPS, pH 7.4 (lane10).
    Figure Legend Snippet: Expression, Purification and Refolding of recombinant CApy. The electrophoretic analysis (SDS-PAGE, 12% PAA under reducing conditions) shows extracts of non-induced and induced E. coli cultures (lane 1 and 2) bearing the CApy gene in the pTriEx-4 expression vector from samples taken at different steps of protein purification (lanes 3–10). Following bacterial cell lysis the soluble (supernatant, lane 3) and insoluble (pellet, lane 4) fractions show that CApy was mostly found in the insoluble fraction in form of inclusion bodies (IBs). The solubilized IBs (see Materials and Methods ) were loaded onto a Ni 2+ chelate column and purified under denaturing conditions, flow-through (lane 5), wash (lane 6), and elution (lane 7) fractions were collected. The eluate containing the purified CApy was refolded by dialysis against folding buffer (lane 8), which was subsequently dialysed against PBS, pH 7.4 (lane 9) or 20 mM MOPS, pH 7.4 (lane10).

    Techniques Used: Expressing, Purification, Recombinant, SDS Page, Plasmid Preparation, Protein Purification, Lysis, Flow Cytometry

    16) Product Images from "Disruption of Nuclear Lamin Organization Alters the Distribution of Replication Factors and Inhibits DNA Synthesis"

    Article Title: Disruption of Nuclear Lamin Organization Alters the Distribution of Replication Factors and Inhibits DNA Synthesis

    Journal: The Journal of Cell Biology

    doi:

    Nuclei assembled in an interphase extract containing ΔNLA. ( a–c ) Conventional fluorescence images of lamin and DNA patterns of a nucleus stained for ( a ) human LA, ( b ) Xenopus LB3, and ( c ) DNA. ( d and e ) Confocal images of a disrupted nucleus stained for ( d ) human LA and ( e ) Xenopus LB3. The endogenous lamin structure has been disrupted and LB3 appears in foci colocalizing with ΔNLA. Bar, 5 μm.
    Figure Legend Snippet: Nuclei assembled in an interphase extract containing ΔNLA. ( a–c ) Conventional fluorescence images of lamin and DNA patterns of a nucleus stained for ( a ) human LA, ( b ) Xenopus LB3, and ( c ) DNA. ( d and e ) Confocal images of a disrupted nucleus stained for ( d ) human LA and ( e ) Xenopus LB3. The endogenous lamin structure has been disrupted and LB3 appears in foci colocalizing with ΔNLA. Bar, 5 μm.

    Techniques Used: Fluorescence, Staining

    Nuclei formed in the presence of ΔNLA, and then subsequently stained for ΔNLA or lamin B3 and one of several early DNA replication markers. ( a and b ) Nucleus stained for ( a ) ΔNLA and ( b ) DNA polymerase α. ( c and d ) Nucleus stained for ( c ) LB3 and ( d ) XORC2. ( e and f ) Nucleus stained for ( e ) LB3 and ( f ) XMCM3. The distribution of DNA polymerase α, XORC2, and XMCM3 is not altered by the disruption of the lamin structure. Confocal microscopic images showing sections through the middle of the nuclei. Bar, 5 μm.
    Figure Legend Snippet: Nuclei formed in the presence of ΔNLA, and then subsequently stained for ΔNLA or lamin B3 and one of several early DNA replication markers. ( a and b ) Nucleus stained for ( a ) ΔNLA and ( b ) DNA polymerase α. ( c and d ) Nucleus stained for ( c ) LB3 and ( d ) XORC2. ( e and f ) Nucleus stained for ( e ) LB3 and ( f ) XMCM3. The distribution of DNA polymerase α, XORC2, and XMCM3 is not altered by the disruption of the lamin structure. Confocal microscopic images showing sections through the middle of the nuclei. Bar, 5 μm.

    Techniques Used: Staining

    The addition of ΔNLA to nuclear assembly reactions reduces [ 32 P]dCTP incorporation by ∼95%. ( A ) Autoradiogram of an agarose gel showing the incorporation of 32 P-labeled dCTP into the DNA of nuclei formed in the presence of buffer control or ΔNLA. After nuclear assembly, the samples were treated as described in Materials and Methods and resolved on an 0.8% agarose gel. The upper band is at the origin of the gel. ( B ) Quantitation of replication assays shown in A. The radioactive signal of the dried gel was quantitated with a FUJIX BAS 2000 phosphoimager. The sum of the signal intensity/area value for both bands in each lane was used to measure the total incorporation of radioactivity into DNA. The average value for four replicate assays was plotted in a bar graph, where the vertical axis represents the signal/area values (in thousands) determined by the imager. The average value for samples containing ΔNLA was 2,292, with values ranging from 2,035–2,513. The average value for the control samples was 39,030, with samples ranging from 34,514–47,443. The addition of ΔNLA to the nuclear assembly reaction reduced th e incorporation of 32 P-labeled dCTP to ∼5% of that found in control reactions.
    Figure Legend Snippet: The addition of ΔNLA to nuclear assembly reactions reduces [ 32 P]dCTP incorporation by ∼95%. ( A ) Autoradiogram of an agarose gel showing the incorporation of 32 P-labeled dCTP into the DNA of nuclei formed in the presence of buffer control or ΔNLA. After nuclear assembly, the samples were treated as described in Materials and Methods and resolved on an 0.8% agarose gel. The upper band is at the origin of the gel. ( B ) Quantitation of replication assays shown in A. The radioactive signal of the dried gel was quantitated with a FUJIX BAS 2000 phosphoimager. The sum of the signal intensity/area value for both bands in each lane was used to measure the total incorporation of radioactivity into DNA. The average value for four replicate assays was plotted in a bar graph, where the vertical axis represents the signal/area values (in thousands) determined by the imager. The average value for samples containing ΔNLA was 2,292, with values ranging from 2,035–2,513. The average value for the control samples was 39,030, with samples ranging from 34,514–47,443. The addition of ΔNLA to the nuclear assembly reaction reduced th e incorporation of 32 P-labeled dCTP to ∼5% of that found in control reactions.

    Techniques Used: Agarose Gel Electrophoresis, Labeling, Quantitation Assay, Radioactivity

    Staining patterns of lamin and DNA replication factors involved in elongation in nuclei assembled in the presence of ( a and d ) buffer or ( b , c , e , and f ) ΔNLA. ( a ) Control nucleus stained for PCNA. ( b and c ) Nucleus assembled in the presence of ΔNLA stained for ( b ) PCNA and ( c ) ΔNLA. ( d ) Control nucleus stained for RFC. ( e and f ) Nucleus assembled in the presence of ΔNLA stained for ( e ) RFC and ( f ) ΔNLA. PCNA and RFC distributions are altered from the control as a consequence of lamin disruption such that PCNA and RFC colocalize with lamin aggregates in these nuclei. Confocal microscope showing sections through the middle of the nuclei. Bar, 5 μm.
    Figure Legend Snippet: Staining patterns of lamin and DNA replication factors involved in elongation in nuclei assembled in the presence of ( a and d ) buffer or ( b , c , e , and f ) ΔNLA. ( a ) Control nucleus stained for PCNA. ( b and c ) Nucleus assembled in the presence of ΔNLA stained for ( b ) PCNA and ( c ) ΔNLA. ( d ) Control nucleus stained for RFC. ( e and f ) Nucleus assembled in the presence of ΔNLA stained for ( e ) RFC and ( f ) ΔNLA. PCNA and RFC distributions are altered from the control as a consequence of lamin disruption such that PCNA and RFC colocalize with lamin aggregates in these nuclei. Confocal microscope showing sections through the middle of the nuclei. Bar, 5 μm.

    Techniques Used: Staining, Microscopy

    Double label immunofluorescence showing nuclear lamin patterns in a normal interphase BHK cell and in a cell injected with ΔNLA. Nuclei were stained for lamins A/C ( LA ) ( a and c ) or lamin B ( LB ) ( b and d ). In the uninjected cell, there is a distinctive lamin rim as well as less intense nucleoplasmic foci ( a and b ), as previously described ( 39 ). In cells fixed 2 h after injection, the lamin rim is no longer obvious, and the lamin staining for both lamins A/C and B appears mainly in the same foci ( c and d ). Confocal optics showing sections through the mid-region of the nucleus. Bar, 5 μm.
    Figure Legend Snippet: Double label immunofluorescence showing nuclear lamin patterns in a normal interphase BHK cell and in a cell injected with ΔNLA. Nuclei were stained for lamins A/C ( LA ) ( a and c ) or lamin B ( LB ) ( b and d ). In the uninjected cell, there is a distinctive lamin rim as well as less intense nucleoplasmic foci ( a and b ), as previously described ( 39 ). In cells fixed 2 h after injection, the lamin rim is no longer obvious, and the lamin staining for both lamins A/C and B appears mainly in the same foci ( c and d ). Confocal optics showing sections through the mid-region of the nucleus. Bar, 5 μm.

    Techniques Used: Immunofluorescence, Injection, Staining

    Double label fluorescence observations of nuclei stained for different aspects of nuclear envelope structure and function. ( a–f ) Nuclei were assembled in interphase extracts containing: ( a and b ) buffer control, ( c and d ) lamin A, and ( e and f ) ΔNLA. Nuclei were stained for ( a ) lamin B3 or ( c and e ) human lamin A, and ( b , d , and f ) the nuclear pore WGA binding proteins using fluorescently tagged WGA. Nuclei assembled under all three conditions appear to have essentially normal distributions of WGA binding proteins at the nuclear periphery. ( g and h ) Nucleus assembled in the presence of ΔNLA and stained for ( g ) ΔNLA and ( h ) the membrane dye DIOC 6 ( MEM ). The nucleus contains a disrupted lamin organization but retains normal membrane staining. Bar, 5 μm. ( i and j ) Import of wild-type lamin A into ( i ) buffer control and ( j ) ΔNLA-disrupted nuclei. The wildtype lamin A was detected using the myc 9E10 epitope antibody ( 13 ). Nuclei were assembled with or without ΔNLA, and 90 min after the initiation of assembly, myc-tagged human lamin A was added to the reaction. The nuclei were fixed 20 min later and stained with the myc antibody. Both ( i ) control and ( j ) ΔNLAdisrupted nuclei show prominent myc staining, demonstrating that the disrupted nuclei retain the ability to import protein. The majority of the imported protein localizes to the characteristic foci of ΔNLA-disrupted nuclei. Confocal optics showing sections through the mid-region of nuclei. Bar, 5 μm.
    Figure Legend Snippet: Double label fluorescence observations of nuclei stained for different aspects of nuclear envelope structure and function. ( a–f ) Nuclei were assembled in interphase extracts containing: ( a and b ) buffer control, ( c and d ) lamin A, and ( e and f ) ΔNLA. Nuclei were stained for ( a ) lamin B3 or ( c and e ) human lamin A, and ( b , d , and f ) the nuclear pore WGA binding proteins using fluorescently tagged WGA. Nuclei assembled under all three conditions appear to have essentially normal distributions of WGA binding proteins at the nuclear periphery. ( g and h ) Nucleus assembled in the presence of ΔNLA and stained for ( g ) ΔNLA and ( h ) the membrane dye DIOC 6 ( MEM ). The nucleus contains a disrupted lamin organization but retains normal membrane staining. Bar, 5 μm. ( i and j ) Import of wild-type lamin A into ( i ) buffer control and ( j ) ΔNLA-disrupted nuclei. The wildtype lamin A was detected using the myc 9E10 epitope antibody ( 13 ). Nuclei were assembled with or without ΔNLA, and 90 min after the initiation of assembly, myc-tagged human lamin A was added to the reaction. The nuclei were fixed 20 min later and stained with the myc antibody. Both ( i ) control and ( j ) ΔNLAdisrupted nuclei show prominent myc staining, demonstrating that the disrupted nuclei retain the ability to import protein. The majority of the imported protein localizes to the characteristic foci of ΔNLA-disrupted nuclei. Confocal optics showing sections through the mid-region of nuclei. Bar, 5 μm.

    Techniques Used: Fluorescence, Staining, Whole Genome Amplification, Binding Assay

    The addition of ΔNLA to nuclear assembly reactions inhibits DNA replication as shown by the reduced incorporation of biotinylated dUTP. Fluorescence images of the LB3 pattern and biotinylated dUTP incorporation in ( a and b ) control nuclei and ( c–f ) nuclei formed in the presence of ΔNLA. ( a , c , and e ) Immunofluorescence using the antibody against Xenopus LB3; ( b , d , and f ) Texas red–conjugated streptavidin shows the patterns of incorporation of biotinylated dUTP. Disruption of lamin organization greatly inhibited the incorporation of biotinylated nucleotide when compared with control nuclei. However, all of the lamin-disrupted nuclei do contain a faint punctate nucleoplasmic pattern of labeled nucleotide incorporation that is readily resolved by confocal microscopy. ( a–d ) Conventional optics (see f ). ( e and f ) Confocal optics. Bar, 5 μm.
    Figure Legend Snippet: The addition of ΔNLA to nuclear assembly reactions inhibits DNA replication as shown by the reduced incorporation of biotinylated dUTP. Fluorescence images of the LB3 pattern and biotinylated dUTP incorporation in ( a and b ) control nuclei and ( c–f ) nuclei formed in the presence of ΔNLA. ( a , c , and e ) Immunofluorescence using the antibody against Xenopus LB3; ( b , d , and f ) Texas red–conjugated streptavidin shows the patterns of incorporation of biotinylated dUTP. Disruption of lamin organization greatly inhibited the incorporation of biotinylated nucleotide when compared with control nuclei. However, all of the lamin-disrupted nuclei do contain a faint punctate nucleoplasmic pattern of labeled nucleotide incorporation that is readily resolved by confocal microscopy. ( a–d ) Conventional optics (see f ). ( e and f ) Confocal optics. Bar, 5 μm.

    Techniques Used: Fluorescence, Immunofluorescence, Labeling, Confocal Microscopy

    ( a ) SDS-PAGE of purified ΔNLA and ( b ) corresponding Western blot using a polyclonal lamin A/C antibody ( 39 ). The major band runs at 69 kD, the predicted molecular mass of ΔNLA. There are also minor bands, representing the proteolytic fragments seen in nuclear lamin preparations expressed in E. coli ( 38 ). Numbers on the left represent molecular mass size markers in kD.
    Figure Legend Snippet: ( a ) SDS-PAGE of purified ΔNLA and ( b ) corresponding Western blot using a polyclonal lamin A/C antibody ( 39 ). The major band runs at 69 kD, the predicted molecular mass of ΔNLA. There are also minor bands, representing the proteolytic fragments seen in nuclear lamin preparations expressed in E. coli ( 38 ). Numbers on the left represent molecular mass size markers in kD.

    Techniques Used: SDS Page, Purification, Western Blot

    ( a and b ) Lamin and biotinylated dUTP incorporation in a nucleus formed in the presence of ΔNLA, and subsequently transferred to an interphase extract containing biotinylated dUTP but lacking ΔNLA (see text). Confocal micrographs showing sections through the middle of the nucleus. ( a ) Nucleus stained for Xenopus LB3. ( b ) Pattern of biotinylated dUTP incorporation as shown by binding of Texas red–conjugated streptavidin. The disrupted nuclei were transferred to a nuclear assembly reaction lacking ΔNLA, where they form a lamin rim and replicate DNA. However, some lamin foci remain. ( c ) Postassembly disruption of the lamin structure of an in vitro assembled nucleus. ΔNLA was added 90 min after the onset of nuclear formation, a point at which the nuclei have normal lamin organization and have largely completed DNA replication. The addition of ΔNLA disrupts the assembled LB3 staining pattern. Bar, 5 μm.
    Figure Legend Snippet: ( a and b ) Lamin and biotinylated dUTP incorporation in a nucleus formed in the presence of ΔNLA, and subsequently transferred to an interphase extract containing biotinylated dUTP but lacking ΔNLA (see text). Confocal micrographs showing sections through the middle of the nucleus. ( a ) Nucleus stained for Xenopus LB3. ( b ) Pattern of biotinylated dUTP incorporation as shown by binding of Texas red–conjugated streptavidin. The disrupted nuclei were transferred to a nuclear assembly reaction lacking ΔNLA, where they form a lamin rim and replicate DNA. However, some lamin foci remain. ( c ) Postassembly disruption of the lamin structure of an in vitro assembled nucleus. ΔNLA was added 90 min after the onset of nuclear formation, a point at which the nuclei have normal lamin organization and have largely completed DNA replication. The addition of ΔNLA disrupts the assembled LB3 staining pattern. Bar, 5 μm.

    Techniques Used: Staining, Binding Assay, In Vitro

    17) Product Images from "Cellular Recognition and Repair of Monofunctional–Intercalative Platinum–DNA Adducts"

    Article Title: Cellular Recognition and Repair of Monofunctional–Intercalative Platinum–DNA Adducts

    Journal: Chemical research in toxicology

    doi: 10.1021/acs.chemrestox.5b00327

    In vitro DNA synthesis monitored by [α- 32 P]-dCTP incorporation. (A) Assay design. (B) Representative autoradiogram of an agarose gel showing the progress of the repair of platinum–acridine-modified pUC19 plasmid DNA after 15, 30, 60, and
    Figure Legend Snippet: In vitro DNA synthesis monitored by [α- 32 P]-dCTP incorporation. (A) Assay design. (B) Representative autoradiogram of an agarose gel showing the progress of the repair of platinum–acridine-modified pUC19 plasmid DNA after 15, 30, 60, and

    Techniques Used: In Vitro, DNA Synthesis, Agarose Gel Electrophoresis, Modification, Plasmid Preparation

    18) Product Images from "Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements"

    Article Title: Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2015.06.044

    SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .
    Figure Legend Snippet: SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Plasmid Preparation, Flow Cytometry

    19) Product Images from "Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements"

    Article Title: Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2015.06.044

    SDS (10%)-PAGE analysis of the purification steps of 15 N-hOGG1: lane 1, 20 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2, 21 µg protein of the extract of BL21(DE3) cells harboring hOGG1/pET15b plasmid induced with IPTG; lane 3, 17 µg of 48000 × g supernatant; lane 4, 15.5 µg from Ni-agarose flow through; lane 5, 8.3 µg 15 .
    Figure Legend Snippet: SDS (10%)-PAGE analysis of the purification steps of 15 N-hOGG1: lane 1, 20 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2, 21 µg protein of the extract of BL21(DE3) cells harboring hOGG1/pET15b plasmid induced with IPTG; lane 3, 17 µg of 48000 × g supernatant; lane 4, 15.5 µg from Ni-agarose flow through; lane 5, 8.3 µg 15 .

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Plasmid Preparation, Flow Cytometry

    SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .
    Figure Legend Snippet: SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Plasmid Preparation, Flow Cytometry

    20) Product Images from "Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements"

    Article Title: Production, Purification, and Characterization of 15N-Labeled DNA Repair Proteins as Internal Standards for Mass Spectrometric Measurements

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2015.06.044

    SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .
    Figure Legend Snippet: SDS (13%)-PAGE analysis of the purification steps of E. coli 15 N-Fpg: lane 1, 21 µg protein of the extract of BL21(DE3) cells harboring pET11a control plasmid; lane 2,31 µg protein of the extract of BL21(DE3) cells harboring Fpg/pET11a plasmid induced with IPTG; lane 3,26 µg of 10000 × g supernatant; lane 4,8.6 µg flow through from DEAE cellulose column, 29 µg; lane 5, 8.5 µg 15 .

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Plasmid Preparation, Flow Cytometry

    21) Product Images from "Identification and Characterization of a Novel Calcium-Activated Apyrase from Cryptosporidium Parasites and Its Potential Role in Pathogenesis"

    Article Title: Identification and Characterization of a Novel Calcium-Activated Apyrase from Cryptosporidium Parasites and Its Potential Role in Pathogenesis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0031030

    Expression, Purification and Refolding of recombinant CApy. The electrophoretic analysis (SDS-PAGE, 12% PAA under reducing conditions) shows extracts of non-induced and induced E. coli cultures (lane 1 and 2) bearing the CApy gene in the pTriEx-4 expression vector from samples taken at different steps of protein purification (lanes 3–10). Following bacterial cell lysis the soluble (supernatant, lane 3) and insoluble (pellet, lane 4) fractions show that CApy was mostly found in the insoluble fraction in form of inclusion bodies (IBs). The solubilized IBs (see Materials and Methods ) were loaded onto a Ni 2+ chelate column and purified under denaturing conditions, flow-through (lane 5), wash (lane 6), and elution (lane 7) fractions were collected. The eluate containing the purified CApy was refolded by dialysis against folding buffer (lane 8), which was subsequently dialysed against PBS, pH 7.4 (lane 9) or 20 mM MOPS, pH 7.4 (lane10).
    Figure Legend Snippet: Expression, Purification and Refolding of recombinant CApy. The electrophoretic analysis (SDS-PAGE, 12% PAA under reducing conditions) shows extracts of non-induced and induced E. coli cultures (lane 1 and 2) bearing the CApy gene in the pTriEx-4 expression vector from samples taken at different steps of protein purification (lanes 3–10). Following bacterial cell lysis the soluble (supernatant, lane 3) and insoluble (pellet, lane 4) fractions show that CApy was mostly found in the insoluble fraction in form of inclusion bodies (IBs). The solubilized IBs (see Materials and Methods ) were loaded onto a Ni 2+ chelate column and purified under denaturing conditions, flow-through (lane 5), wash (lane 6), and elution (lane 7) fractions were collected. The eluate containing the purified CApy was refolded by dialysis against folding buffer (lane 8), which was subsequently dialysed against PBS, pH 7.4 (lane 9) or 20 mM MOPS, pH 7.4 (lane10).

    Techniques Used: Expressing, Purification, Recombinant, SDS Page, Plasmid Preparation, Protein Purification, Lysis, Flow Cytometry

    22) Product Images from "Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat"

    Article Title: Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.02237

    SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.
    Figure Legend Snippet: SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Expressing, Purification

    Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .
    Figure Legend Snippet: Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .

    Techniques Used:

    Plots (means with standard errors from two replicates) showing the synthesis of asparagine and glutamate, in reactions catalyzed by TaASN1 (top) and TaASN2 (bottom).
    Figure Legend Snippet: Plots (means with standard errors from two replicates) showing the synthesis of asparagine and glutamate, in reactions catalyzed by TaASN1 (top) and TaASN2 (bottom).

    Techniques Used:

    Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.
    Figure Legend Snippet: Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.

    Techniques Used: Western Blot

    Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.
    Figure Legend Snippet: Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.

    Techniques Used: Sequencing

    Time-series plots for parameter estimation against experimental data for TaASN1.
    Figure Legend Snippet: Time-series plots for parameter estimation against experimental data for TaASN1.

    Techniques Used:

    23) Product Images from "Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function"

    Article Title: Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function

    Journal: Microbiology (Reading, England)

    doi: 10.1099/mic.0.2007/013466-0

    Co-purification of two species of Srv. For expression and purification of recombinant protein, srv was cloned into expression vector pET32A to generate pSDR srv . The native translational start and termination sites of Srv were left intact. Following over-expression
    Figure Legend Snippet: Co-purification of two species of Srv. For expression and purification of recombinant protein, srv was cloned into expression vector pET32A to generate pSDR srv . The native translational start and termination sites of Srv were left intact. Following over-expression

    Techniques Used: Copurification, Expressing, Purification, Recombinant, Clone Assay, Plasmid Preparation, Over Expression

    24) Product Images from "Using the Amino Acid Network to Modulate the Hydrolytic Activity of β-Glycosidases"

    Article Title: Using the Amino Acid Network to Modulate the Hydrolytic Activity of β-Glycosidases

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0167978

    Effects of single mutations on the Sfβgly hydrolytic activity. Mutational effects are shown as the Log of relative catalytic efficiency [( k cat / K m ) mut /( k cat / K m ) WT ]. Charts present the same scale for comparisons among mutational effect amplitudes. Mutations are grouped according to the active site residues they are associated. Red box: residues associated to the GBS; Blue box: positions associated to the ABS; Yellow box: residues related to the CR. Residues at L1 (underlined) and L2 (double underlined) associated to more than one functional group (GBS, ABS or CR) are placed in the group intersections. Mutations of active site residues are presented not underlined. Grouping is based on the shortest pathway linking the mutation to the functional region. Four mutants are inactive and not included here: D84A (L2 amino acid contacting GBS and CR residues), W452A (located in the GBS), F98A and T398A (both L1 positions contacting CR residues).
    Figure Legend Snippet: Effects of single mutations on the Sfβgly hydrolytic activity. Mutational effects are shown as the Log of relative catalytic efficiency [( k cat / K m ) mut /( k cat / K m ) WT ]. Charts present the same scale for comparisons among mutational effect amplitudes. Mutations are grouped according to the active site residues they are associated. Red box: residues associated to the GBS; Blue box: positions associated to the ABS; Yellow box: residues related to the CR. Residues at L1 (underlined) and L2 (double underlined) associated to more than one functional group (GBS, ABS or CR) are placed in the group intersections. Mutations of active site residues are presented not underlined. Grouping is based on the shortest pathway linking the mutation to the functional region. Four mutants are inactive and not included here: D84A (L2 amino acid contacting GBS and CR residues), W452A (located in the GBS), F98A and T398A (both L1 positions contacting CR residues).

    Techniques Used: Activity Assay, Functional Assay, Mutagenesis

    Crystallographic structure of Sfβgly (PDB ID 5CG0). A –Six Sfβgly chains (A-F) are observed in the asymmetric unit; B –Superposition of the six Sfβgly refined chains (A-F). The (β/α) 8 secondary structures are labeled; C –Cartoon representation of the Sfβgly crystallographic dimer (Chain A: Green; Chain B: Red) D –Detailed interaction surface of a Sfβgly dimer. Residues in the dimerization interface are coloured yellow (Chain A) and pink (Chain B).
    Figure Legend Snippet: Crystallographic structure of Sfβgly (PDB ID 5CG0). A –Six Sfβgly chains (A-F) are observed in the asymmetric unit; B –Superposition of the six Sfβgly refined chains (A-F). The (β/α) 8 secondary structures are labeled; C –Cartoon representation of the Sfβgly crystallographic dimer (Chain A: Green; Chain B: Red) D –Detailed interaction surface of a Sfβgly dimer. Residues in the dimerization interface are coloured yellow (Chain A) and pink (Chain B).

    Techniques Used: Labeling

    Spatial distribution of mutational effects outside the Sfβgly active site. Highlighted are the main chain (spheres) of amino acids whose mutations cause deleterious (decreases higher than 4-fold using NPβglc, dark orange spheres) and mild decreases (smaller than 4x, light purple spheres) or positive effects (cyan spheres) on Sfβgly activity. Residues outside the active site are labelled with their corresponding colour, as described above. Active site residues from GBS (red sticks), ABS (dark blue sticks) and CR (yellow sticks) are also labelled with their corresponding colour. A substrate molecule, p -nitrophenyl β-glycoside (NPβglc), is placed in the active site (green sticks). Note that positive mutations (cyan spheres), are located close to the ABS but not to the GBS.
    Figure Legend Snippet: Spatial distribution of mutational effects outside the Sfβgly active site. Highlighted are the main chain (spheres) of amino acids whose mutations cause deleterious (decreases higher than 4-fold using NPβglc, dark orange spheres) and mild decreases (smaller than 4x, light purple spheres) or positive effects (cyan spheres) on Sfβgly activity. Residues outside the active site are labelled with their corresponding colour, as described above. Active site residues from GBS (red sticks), ABS (dark blue sticks) and CR (yellow sticks) are also labelled with their corresponding colour. A substrate molecule, p -nitrophenyl β-glycoside (NPβglc), is placed in the active site (green sticks). Note that positive mutations (cyan spheres), are located close to the ABS but not to the GBS.

    Techniques Used: Activity Assay

    Distribution of Sfβgly residues based on their distances from the active site. Active site residues (green) are directly involved in substrate binding (GBS and ABS) and cleavage (CR); Residues composing the Layer 1 (L1, cyan) surround the active site and directly contact functional residues; Residues composing the Layer 2 (L2, salmon) envelop L1 and indirectly contact the active site via L1 (cyan) residues.
    Figure Legend Snippet: Distribution of Sfβgly residues based on their distances from the active site. Active site residues (green) are directly involved in substrate binding (GBS and ABS) and cleavage (CR); Residues composing the Layer 1 (L1, cyan) surround the active site and directly contact functional residues; Residues composing the Layer 2 (L2, salmon) envelop L1 and indirectly contact the active site via L1 (cyan) residues.

    Techniques Used: Binding Assay, Functional Assay

    Sfβgly active site. A –Overview of Sfβgly active site. Note that ABS residues are located at the active site entrance, whereas the GBS and CR residues are located at the bottom of the active site pocket. B –Detailed view of functional residues (in sticks): GBS (red), ABS (blue) and CR (yellow). One Tris molecule (green sticks) is bound to the Sfβgly active site (PDB ID 5CG0).
    Figure Legend Snippet: Sfβgly active site. A –Overview of Sfβgly active site. Note that ABS residues are located at the active site entrance, whereas the GBS and CR residues are located at the bottom of the active site pocket. B –Detailed view of functional residues (in sticks): GBS (red), ABS (blue) and CR (yellow). One Tris molecule (green sticks) is bound to the Sfβgly active site (PDB ID 5CG0).

    Techniques Used: Functional Assay

    Degree of conservation among β-glycosidases. A –Weblogo of active site positions generated from a multiple sequence alignment of 1551 β-glycosidases sequences. Note that residues in ABS positions 190, 194, 201 and 453 (blue arrows) are poorly conserved when compared to GBS (red arrows) and CR (yellow arrows) positions. B –Superposition of Sfβgly (chain A) with homologous GH1 β-glycosidases from PDB: 3AI0, 1E6S, 1E4I, 1E56, 1UG6, 2ZOX, 1V03 and 1VFF. C –Multiple superposition of active site conserved residues (GBS: red; CR: yellow) from Sfβgly and β-glycosidases shown in (B). The complexed NPβglc (cyan) is from structure 3AI0. The numbering shown is from Sfβgly. D –Detailed superposition of active site residues from Sfβgly and 3AI0 (GBS: brown; CR: yellow), demonstrating their similar relative positioning to NPβglc (Cyan).
    Figure Legend Snippet: Degree of conservation among β-glycosidases. A –Weblogo of active site positions generated from a multiple sequence alignment of 1551 β-glycosidases sequences. Note that residues in ABS positions 190, 194, 201 and 453 (blue arrows) are poorly conserved when compared to GBS (red arrows) and CR (yellow arrows) positions. B –Superposition of Sfβgly (chain A) with homologous GH1 β-glycosidases from PDB: 3AI0, 1E6S, 1E4I, 1E56, 1UG6, 2ZOX, 1V03 and 1VFF. C –Multiple superposition of active site conserved residues (GBS: red; CR: yellow) from Sfβgly and β-glycosidases shown in (B). The complexed NPβglc (cyan) is from structure 3AI0. The numbering shown is from Sfβgly. D –Detailed superposition of active site residues from Sfβgly and 3AI0 (GBS: brown; CR: yellow), demonstrating their similar relative positioning to NPβglc (Cyan).

    Techniques Used: Generated, Sequencing

    25) Product Images from "Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease"

    Article Title: Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.13-0118

    Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.
    Figure Legend Snippet: Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.

    Techniques Used: Expressing, Plasmid Preparation, Binding Assay, SDS Page, Purification, Derivative Assay, Staining

    Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.
    Figure Legend Snippet: Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.

    Techniques Used: Neutralization, Activity Assay, Mouse Assay

    A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.
    Figure Legend Snippet: A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.

    Techniques Used: Mouse Assay, Injection

    Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P
    Figure Legend Snippet: Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P

    Techniques Used: Mouse Assay

    26) Product Images from "Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease"

    Article Title: Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.13-0118

    Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.
    Figure Legend Snippet: Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.

    Techniques Used: Expressing, Plasmid Preparation, Binding Assay, SDS Page, Purification, Derivative Assay, Staining

    Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.
    Figure Legend Snippet: Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.

    Techniques Used: Neutralization, Activity Assay, Mouse Assay

    A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.
    Figure Legend Snippet: A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.

    Techniques Used: Mouse Assay, Injection

    Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P
    Figure Legend Snippet: Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P

    Techniques Used: Mouse Assay

    27) Product Images from "Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion"

    Article Title: Allelic Variation in CXCL16 Determines CD3+ T Lymphocyte Susceptibility to Equine Arteritis Virus Infection and Establishment of Long-Term Carrier State in the Stallion

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1006467

    Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on binding to the EqCXCR6 receptor protein in vitro . Interactions between purified recombinant EqCXCL16S/R-EqCXCR6 were examined using Far-WB. Equal amounts (20 μg) of His-tagged EqCXCR6 protein or BSA as a control were separated in different lanes on 10% SDS-PAGE and transferred onto a PVDF membrane. Proteins were then sequentially denatured and renatured by using different concentrations of Gn-HCl. After blocking, the membranes were incubated with soluble EqCXCL16S (panel a) or EqCXCL16R (panel b) protein (5 μg/ml) followed by Rb α-EqCXCL16 Ab. After washing, membranes were developed using the ECL method. Binding of EqCXCL16S and EqCXCL16R to EqCXCR6 is indicated by arrows (panels a and b). These interactions occurred at the same location as that occupied by EqCXCR6; this was confirmed by stripping the membrane shown in panel b and re-probing it with anti-His antibody as shown in panel c.
    Figure Legend Snippet: Effect of amino acid substitutions between “S” and “R” isoforms of EqCXCL16 on binding to the EqCXCR6 receptor protein in vitro . Interactions between purified recombinant EqCXCL16S/R-EqCXCR6 were examined using Far-WB. Equal amounts (20 μg) of His-tagged EqCXCR6 protein or BSA as a control were separated in different lanes on 10% SDS-PAGE and transferred onto a PVDF membrane. Proteins were then sequentially denatured and renatured by using different concentrations of Gn-HCl. After blocking, the membranes were incubated with soluble EqCXCL16S (panel a) or EqCXCL16R (panel b) protein (5 μg/ml) followed by Rb α-EqCXCL16 Ab. After washing, membranes were developed using the ECL method. Binding of EqCXCL16S and EqCXCL16R to EqCXCR6 is indicated by arrows (panels a and b). These interactions occurred at the same location as that occupied by EqCXCR6; this was confirmed by stripping the membrane shown in panel b and re-probing it with anti-His antibody as shown in panel c.

    Techniques Used: Binding Assay, In Vitro, Purification, Recombinant, Far Western Blot, SDS Page, Blocking Assay, Incubation, Stripping Membranes

    28) Product Images from "A mutant β-glucosidase increases the rate of the cellulose enzymatic hydrolysis"

    Article Title: A mutant β-glucosidase increases the rate of the cellulose enzymatic hydrolysis

    Journal: Biochemistry and Biophysics Reports

    doi: 10.1016/j.bbrep.2016.05.014

    – Crystalline cellulose (5 mg/mL Avicel PH101) hydrolysis catalyzed by TrCel7A (0.1 mg). ( A ), Calculated production of cellobiose. ( B ), Production of glucose. Assay performed in the absence of β-glucosidases (∆). Assays in the presence of 0.11 nmols of the wild-type Sfβgly (□) and L428V (♦). Due the presence of β-glucosidases (□ and ♦), cellobiose produced by TrCel7A was converted into glucose, thus the amount of cellobiose produced ( B ) was calculated based on the glucose concentration ( A ).
    Figure Legend Snippet: – Crystalline cellulose (5 mg/mL Avicel PH101) hydrolysis catalyzed by TrCel7A (0.1 mg). ( A ), Calculated production of cellobiose. ( B ), Production of glucose. Assay performed in the absence of β-glucosidases (∆). Assays in the presence of 0.11 nmols of the wild-type Sfβgly (□) and L428V (♦). Due the presence of β-glucosidases (□ and ♦), cellobiose produced by TrCel7A was converted into glucose, thus the amount of cellobiose produced ( B ) was calculated based on the glucose concentration ( A ).

    Techniques Used: Glucose Assay, Produced, Concentration Assay

    29) Product Images from "Sequence and Expression Analysis of virB9 of the Type IV Secretion System of Ehrlichia canis Strains in Ticks, Dogs, and Cultured Cells "

    Article Title: Sequence and Expression Analysis of virB9 of the Type IV Secretion System of Ehrlichia canis Strains in Ticks, Dogs, and Cultured Cells

    Journal: Infection and Immunity

    doi: 10.1128/IAI.71.10.6063-6067.2003

    (A) SDS-polyacrylamide gel electrophoresis analysis of purified E. canis Oklahoma T rVirB9. Affinity-purified (AP) rVirB9 (2 μg) was subjected to SDS-polyacrylamide gel electrophoresis followed by Coomassie blue staining. M, molecular size marker. The numbers on the left are molecular masses, in kilodaltons. (B) Western immunoblot analysis to detect E. canis VirB9-specific antibody in plasma samples from infected dogs. pET33b-transformed E. coli was used as a negative control. rVirB9, affinity-purified recombinant fusion protein of E. canis . Antigens (15 μg of E. coli and 2 μg of rVirB9) were subjected to Western blot analysis with serum derived from the blood of various infected dogs (OK, Oklahoma; OH, Ohio; AZ, Arizona; NM, New Mexico). The arrow on the right indicates the apparent molecular mass of rVirB9, based on broad-range prestained standards (Bio-Rad Laboratories, Richmond, Calif.).
    Figure Legend Snippet: (A) SDS-polyacrylamide gel electrophoresis analysis of purified E. canis Oklahoma T rVirB9. Affinity-purified (AP) rVirB9 (2 μg) was subjected to SDS-polyacrylamide gel electrophoresis followed by Coomassie blue staining. M, molecular size marker. The numbers on the left are molecular masses, in kilodaltons. (B) Western immunoblot analysis to detect E. canis VirB9-specific antibody in plasma samples from infected dogs. pET33b-transformed E. coli was used as a negative control. rVirB9, affinity-purified recombinant fusion protein of E. canis . Antigens (15 μg of E. coli and 2 μg of rVirB9) were subjected to Western blot analysis with serum derived from the blood of various infected dogs (OK, Oklahoma; OH, Ohio; AZ, Arizona; NM, New Mexico). The arrow on the right indicates the apparent molecular mass of rVirB9, based on broad-range prestained standards (Bio-Rad Laboratories, Richmond, Calif.).

    Techniques Used: Polyacrylamide Gel Electrophoresis, Purification, Affinity Purification, Staining, Marker, Western Blot, Infection, Transformation Assay, Negative Control, Derivative Assay

    30) Product Images from "Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function"

    Article Title: Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function

    Journal: Microbiology (Reading, England)

    doi: 10.1099/mic.0.2007/013466-0

    Co-purification of two species of Srv. For expression and purification of recombinant protein, srv was cloned into expression vector pET32A to generate pSDR srv . The native translational start and termination sites of Srv were left intact. Following over-expression
    Figure Legend Snippet: Co-purification of two species of Srv. For expression and purification of recombinant protein, srv was cloned into expression vector pET32A to generate pSDR srv . The native translational start and termination sites of Srv were left intact. Following over-expression

    Techniques Used: Copurification, Expressing, Purification, Recombinant, Clone Assay, Plasmid Preparation, Over Expression

    31) Product Images from "Characterization of Fluorescent Chimeras of Cholera Toxin and Escherichia coli Heat-Labile Enterotoxins Produced by Use of the Twin Arginine Translocation System "

    Article Title: Characterization of Fluorescent Chimeras of Cholera Toxin and Escherichia coli Heat-Labile Enterotoxins Produced by Use of the Twin Arginine Translocation System

    Journal:

    doi: 10.1128/IAI.73.6.3627-3635.2005

    Analysis of CT chimera fluorescence. (A) Expression of the GFP-CT and RFP-CT chimeras in E. coli after an overnight incubation with 0.2% l -arabinose: E. coli NovaBlue plus pTatABCE plus pJKT35 with FITC filter (frame 1) and NovaBlue plus pTatABCE plus
    Figure Legend Snippet: Analysis of CT chimera fluorescence. (A) Expression of the GFP-CT and RFP-CT chimeras in E. coli after an overnight incubation with 0.2% l -arabinose: E. coli NovaBlue plus pTatABCE plus pJKT35 with FITC filter (frame 1) and NovaBlue plus pTatABCE plus

    Techniques Used: Fluorescence, Expressing, Incubation

    32) Product Images from "Characterization of mdcR, a Regulatory Gene of the Malonate Catabolic System in Klebsiella pneumoniae"

    Article Title: Characterization of mdcR, a Regulatory Gene of the Malonate Catabolic System in Klebsiella pneumoniae

    Journal: Journal of Bacteriology

    doi:

    Expression and purification of recombinant MdcR. Whole-cell protein profiles and the purified fractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Lanes 1 and 2 contain total proteins isolated from E. coli NovaBlue(DE3)(pHPm23). The whole-cell protein in lane 2 was obtained from IPTG-induced cells. Lane 3 shows the molecular size markers. Lanes 4 to 7 contain MdcR purified through HisBind resin. The sizes of the molecular mass markers are shown on the left. The position of purified MdcR is indicated on the right.
    Figure Legend Snippet: Expression and purification of recombinant MdcR. Whole-cell protein profiles and the purified fractions were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Lanes 1 and 2 contain total proteins isolated from E. coli NovaBlue(DE3)(pHPm23). The whole-cell protein in lane 2 was obtained from IPTG-induced cells. Lane 3 shows the molecular size markers. Lanes 4 to 7 contain MdcR purified through HisBind resin. The sizes of the molecular mass markers are shown on the left. The position of purified MdcR is indicated on the right.

    Techniques Used: Expressing, Purification, Recombinant, Polyacrylamide Gel Electrophoresis, Isolation

    33) Product Images from "Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function"

    Article Title: Point mutations within the streptococcal regulator of virulence (Srv) alter protein-DNA interactions and Srv function

    Journal: Microbiology (Reading, England)

    doi: 10.1099/mic.0.2007/013466-0

    Casein agar assay for SpeB proteolytic activity. MGAS5005, MGAS5005Δ srv , MGAS5005Δ srv (pIA β 8- srv ) and MGAS5005Δ srv (pIA β 8- srv R207G ) were stab inoculated into agar plates containing skim milk and incubated for 18 h
    Figure Legend Snippet: Casein agar assay for SpeB proteolytic activity. MGAS5005, MGAS5005Δ srv , MGAS5005Δ srv (pIA β 8- srv ) and MGAS5005Δ srv (pIA β 8- srv R207G ) were stab inoculated into agar plates containing skim milk and incubated for 18 h

    Techniques Used: Activity Assay, Incubation

    34) Product Images from "Disulfide-Mediated Oligomer Formation in Borrelia burgdorferi Outer Surface Protein C, a Critical Virulence Factor and Potential Lyme Disease Vaccine Candidate ▿"

    Article Title: Disulfide-Mediated Oligomer Formation in Borrelia burgdorferi Outer Surface Protein C, a Critical Virulence Factor and Potential Lyme Disease Vaccine Candidate ▿

    Journal: Clinical and Vaccine Immunology : CVI

    doi: 10.1128/CVI.05004-11

    Infectivity and dissemination of strains expressing wild-type or C130A OspC.
    Figure Legend Snippet: Infectivity and dissemination of strains expressing wild-type or C130A OspC.

    Techniques Used: Infection, Expressing

    Anti-OspC antibody isotype profile in mice infected with B. burgdorferi B31 or B31:: ospC ( C130A ). ELISAs were conducted using serum harvested from mice 4 weeks after needle inoculation. Antibodies were captured by immobilized r-OspC(wt) and detected by
    Figure Legend Snippet: Anti-OspC antibody isotype profile in mice infected with B. burgdorferi B31 or B31:: ospC ( C130A ). ELISAs were conducted using serum harvested from mice 4 weeks after needle inoculation. Antibodies were captured by immobilized r-OspC(wt) and detected by

    Techniques Used: Mouse Assay, Infection

    35) Product Images from "Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease"

    Article Title: Evaluation of Recombinant Forms of the Shiga Toxin Variant Stx2eB Subunit and Non-Toxic Mutant Stx2e as Vaccine Candidates against Porcine Edema Disease

    Journal: The Journal of Veterinary Medical Science

    doi: 10.1292/jvms.13-0118

    Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.
    Figure Legend Snippet: Construction of expression plasmids for Stx2e and mStx2e (A), Stx2eB-His (B) and Stx2eA 2 B-His (C). The schematic model shows the construction of a plasmid for the expression of target proteins. The arrow boxes indicate the open reading frames. The striped and shaded boxes indicate the start and stop codons, respectively. T7, T7 promoter; lac O, lac operator; RBS, ribosome-binding site; V5, V5 epitope tag; 6xHis, polyhistidine tag. (D) SDS-PAGE of the purified toxins and Stx2eB-derived antigens. Purified proteins (1 µ g) were resolved by 4–20% gradient SDS-PAGE and stained with Ez stain AQua. Lanes 1 and 2 show the holotoxins of Stx2e and mStx2e, respectively. The 2 bands correspond to the A 1 fragment of the A subunit (27.3 kDa) and the B subunit (7.6 kDa). Lanes 3 and 4 show Stx2eA 2 B-His and Stx2eB-His, respectively. The protein bands corresponding to the B subunit are slightly larger than the native B subunit, because of the additional 6xHis tag. The putative A 2 fragment of the A subunit (5.8 kDa) is not visible in the holotoxin or Stx2eA 2 B-His samples. Lane M shows the molecular size markers.

    Techniques Used: Expressing, Plasmid Preparation, Binding Assay, SDS Page, Purification, Derivative Assay, Staining

    Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.
    Figure Legend Snippet: Anti-Stx2e IgG titer and lethal toxin-neutralization activity in sera from individual mice immunized i.p. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 43 were assessed for anti-Stx2e IgG titer as well as ED 50 titer. Open symbols indicate sera that gave ED 50 titers≥2, which was the cut-off for positive Stx2e-neutralizing activity.

    Techniques Used: Neutralization, Activity Assay, Mouse Assay

    A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.
    Figure Legend Snippet: A. Survival profile of mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) or Stx2eB-His (♦), after i.p. injection with 0.1 µ g of the native toxin Stx2e. Mice administered PBS (▲) were used as negative controls. B. Anti-Stx2e IgG titers in individual sera and protection from lethal toxin challenge for mice immunized i.n. with mStx2e (●), Stx2eA 2 B-His (■) and Stx2eB-His (♦). All serum samples from immunized mice on day 178 were assessed for anti-Stx2e IgG titer. Open symbols represent sera from protected mice.

    Techniques Used: Mouse Assay, Injection

    Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P
    Figure Legend Snippet: Cytokines in the sera of Stx2e-challenged mice. Five mice per group were immunized with mStx2e (A), Stx2eA 2 B-His (B), Stx2eB-His (C) or PBS (D). Sera were collected before and three days after lethal challenge with Stx2e. Concentrations of IL-10, IL-12, IL-4 and IL-5 before and after Stx2e challenge are shown as log 10 -fold change ± standard deviations (SD). Levels of IL-2, IL-17, GM-CSF, IFN-γ and TNF-α were unchanged and are not shown. An asterisk denotes significance at P

    Techniques Used: Mouse Assay

    36) Product Images from "Sequence-Specific DNA Detection at 10 fM by Electromechanical Signal Transduction"

    Article Title: Sequence-Specific DNA Detection at 10 fM by Electromechanical Signal Transduction

    Journal: Analytical Chemistry

    doi: 10.1021/ac5021408

    Schematic of DNA oligomer preparation. (a) Purified pET-21b plasmids were enzymatically digested by selected pairs of ScaI, PvuI, Pst I, BsaI, and EcoNI restriction enzymes, producing fragments of different lengths. The target DNA sequence complementary to the PNA probe is located beginning at plasmid position 4427 (orange band). Plasmid digestion by ScaI and PvuI produced a 110-base, target-containing fragment, T1. Plasmid digestion by PvuI and PstI produced a 125-base, target-free control fragment, C1. Other fragments were produced similarly: T2 (235 bases) using ScaI and PstI, T3 (419 bases) using ScaI and BsaI, T4 (1613 bases) using by PvuI and EcoNI), C2 (184 bases) using PstI and BsaI, C3 (309 bases) using PvuI and BsaI, and C4 (1503 bases) using ScaI and EcoNI. (b) Following digestion, the DNA was isolated by gel electrophoresis, extracted, and purified. (c) Purified double-stranded DNA was denatured and hybridized with bead–PNA probe conjugates. (d) DNA–PNA–bead mixture was injected into the micropipette for electrical detection.
    Figure Legend Snippet: Schematic of DNA oligomer preparation. (a) Purified pET-21b plasmids were enzymatically digested by selected pairs of ScaI, PvuI, Pst I, BsaI, and EcoNI restriction enzymes, producing fragments of different lengths. The target DNA sequence complementary to the PNA probe is located beginning at plasmid position 4427 (orange band). Plasmid digestion by ScaI and PvuI produced a 110-base, target-containing fragment, T1. Plasmid digestion by PvuI and PstI produced a 125-base, target-free control fragment, C1. Other fragments were produced similarly: T2 (235 bases) using ScaI and PstI, T3 (419 bases) using ScaI and BsaI, T4 (1613 bases) using by PvuI and EcoNI), C2 (184 bases) using PstI and BsaI, C3 (309 bases) using PvuI and BsaI, and C4 (1503 bases) using ScaI and EcoNI. (b) Following digestion, the DNA was isolated by gel electrophoresis, extracted, and purified. (c) Purified double-stranded DNA was denatured and hybridized with bead–PNA probe conjugates. (d) DNA–PNA–bead mixture was injected into the micropipette for electrical detection.

    Techniques Used: Purification, Positron Emission Tomography, Sequencing, Plasmid Preparation, Produced, Isolation, Nucleic Acid Electrophoresis, Injection

    37) Product Images from "5?-Methylthioadenosine Nucleosidase Is Implicated in Playing a Key Role in a Modified Futalosine Pathway for Menaquinone Biosynthesis in Campylobacter jejuni *"

    Article Title: 5?-Methylthioadenosine Nucleosidase Is Implicated in Playing a Key Role in a Modified Futalosine Pathway for Menaquinone Biosynthesis in Campylobacter jejuni *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M111.229781

    Alignment of the E. coli MTAN ( EcMTAN ), the C. jejuni MTAN ( CjMTAN ), the T. thermophilus futalosine hydrolase ( TtMqnB ), and the S. coelicolor futalosine hydrolase ( ScMqnB ).
    Figure Legend Snippet: Alignment of the E. coli MTAN ( EcMTAN ), the C. jejuni MTAN ( CjMTAN ), the T. thermophilus futalosine hydrolase ( TtMqnB ), and the S. coelicolor futalosine hydrolase ( ScMqnB ).

    Techniques Used:

    38) Product Images from "Mapping the Ligand-Binding Region of Borrelia burgdorferi Fibronectin-Binding Protein BBK32"

    Article Title: Mapping the Ligand-Binding Region of Borrelia burgdorferi Fibronectin-Binding Protein BBK32

    Journal: Infection and Immunity

    doi: 10.1128/IAI.69.6.4129-4133.2001

    Mapping the ligand-binding region of BBK32. Fragments of the bbk32 gene from B. burgdorferi isolate B31 were cloned into the pScreen T vector and expressed as recombinant fusion proteins in E. coli . Proteins from E. coli lysates were separated on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to a nitrocellulose membrane and probed with alkaline phosphatase-labeled human fibronectin (B). The BBK32 amino acid sequence expressed by each clone is indicated above each lane. A clone expressing the vector-derived peptide of 37 kDa is labeled Vector Only. Sizes of the molecular weight standards (MWS) are provided in kilodaltons.
    Figure Legend Snippet: Mapping the ligand-binding region of BBK32. Fragments of the bbk32 gene from B. burgdorferi isolate B31 were cloned into the pScreen T vector and expressed as recombinant fusion proteins in E. coli . Proteins from E. coli lysates were separated on a 12% polyacrylamide gel and stained with Coomassie blue (A) or transferred to a nitrocellulose membrane and probed with alkaline phosphatase-labeled human fibronectin (B). The BBK32 amino acid sequence expressed by each clone is indicated above each lane. A clone expressing the vector-derived peptide of 37 kDa is labeled Vector Only. Sizes of the molecular weight standards (MWS) are provided in kilodaltons.

    Techniques Used: Ligand Binding Assay, Clone Assay, Plasmid Preparation, Recombinant, Staining, Labeling, Sequencing, Expressing, Derivative Assay, Molecular Weight

    39) Product Images from "Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat"

    Article Title: Genomic, Biochemical, and Modeling Analyses of Asparagine Synthetases from Wheat

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.02237

    SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.
    Figure Legend Snippet: SDS-polyacrylamide gel electrophoresis of extracts of E. coli cells expressing wheat asparagine synthetases: TaASN1, TaASN2, and TaASN3. Expression of the proteins was induced by addition of IPTG to the bacterial cell cultures. An uninduced control is included for each protein, and each protein is also shown after purification on a nickel-nitrilotriacetic acid (Ni-NTA) agarose column. The arrow indicates the position of the expressed proteins.

    Techniques Used: Polyacrylamide Gel Electrophoresis, Expressing, Purification

    Time-series plots for parameter estimation against experimental data for TaASN2.
    Figure Legend Snippet: Time-series plots for parameter estimation against experimental data for TaASN2.

    Techniques Used:

    Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .
    Figure Legend Snippet: Diagrammatic representation of the gene structures of TaASN1, TaASN2, TaASN3.1, TaASN3.2 , and TaASN4 .

    Techniques Used:

    Plots (means with standard errors from two replicates) showing the synthesis of asparagine and glutamate, in reactions catalyzed by TaASN1 (top) and TaASN2 (bottom).
    Figure Legend Snippet: Plots (means with standard errors from two replicates) showing the synthesis of asparagine and glutamate, in reactions catalyzed by TaASN1 (top) and TaASN2 (bottom).

    Techniques Used:

    Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.
    Figure Legend Snippet: Western blot of heterologously expressed TaASN1, TaASN2, and TaASN3 proteins reacted with monoclonal antibodies raised to peptides SKKPRMIEVAAP and GGSNKPGVMNTV, as indicated.

    Techniques Used: Western Blot

    Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.
    Figure Legend Snippet: Amino acid sequence alignment of TaASN1, TaASN2, and TaASN3 proteins from wheat ( Triticum aestivum ) cv. Spark. Identical residues at the same position are highlighted in black, except for residues known to be critical for the function of the enzyme (see text), which are highlighted in red. Similar residues at the same position (conservative substitutions) are highlighted in gray. The region corresponding to peptides used to raise the two monoclonal antibodies that showed highest specificity for the asparagine synthetase proteins is indicated with a blue box.

    Techniques Used: Sequencing

    40) Product Images from "Synthesis, Aqueous Reactivity, and Biological Evaluation of Carboxylic Acid Ester-Functionalized Platinum-Acridine Hybrid Anticancer Agents"

    Article Title: Synthesis, Aqueous Reactivity, and Biological Evaluation of Carboxylic Acid Ester-Functionalized Platinum-Acridine Hybrid Anticancer Agents

    Journal: Journal of medicinal chemistry

    doi: 10.1021/jm300879k

    DNA unwinding study of pUC19 plasmid modified with varying amounts (0.02
    Figure Legend Snippet: DNA unwinding study of pUC19 plasmid modified with varying amounts (0.02

    Techniques Used: Plasmid Preparation, Modification

    41) Product Images from "The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1 [W]The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1 [W] [OA]"

    Article Title: The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1 [W]The Role of Oxophytodienoate Reductases in the Detoxification of the Explosive 2,4,6-Trinitrotoluene by Arabidopsis 1 [W] [OA]

    Journal: Plant Physiology

    doi: 10.1104/pp.109.141598

    Quantitative RT-PCR of OPR expression in response to TNT treatment. Fourteen-day-old, liquid culture-grown Arabidopsis plants were treated with 60 μ m TNT for 6 h, and the level of OPR expression was determined by quantitative RT-PCR. ACT2 mRNA
    Figure Legend Snippet: Quantitative RT-PCR of OPR expression in response to TNT treatment. Fourteen-day-old, liquid culture-grown Arabidopsis plants were treated with 60 μ m TNT for 6 h, and the level of OPR expression was determined by quantitative RT-PCR. ACT2 mRNA

    Techniques Used: Quantitative RT-PCR, Expressing

    Uptake and product formation of TNT-treated Arabidopsis OPR knockdown lines. A, TNT removal. B, ADNT. C, Meisenheimer complex formation in the medium of 14-d-old, liquid culture-grown Arabidopsis dosed with 300 μ m TNT. Results are means of four
    Figure Legend Snippet: Uptake and product formation of TNT-treated Arabidopsis OPR knockdown lines. A, TNT removal. B, ADNT. C, Meisenheimer complex formation in the medium of 14-d-old, liquid culture-grown Arabidopsis dosed with 300 μ m TNT. Results are means of four

    Techniques Used:

    Root length and liquid culture analysis of Arabidopsis lines with altered levels of OPR transcript. A, Root length of 7-d-old seedlings grown on medium containing 2 μ m TNT. Values are expressed as percentage of the root length of seedlings grown
    Figure Legend Snippet: Root length and liquid culture analysis of Arabidopsis lines with altered levels of OPR transcript. A, Root length of 7-d-old seedlings grown on medium containing 2 μ m TNT. Values are expressed as percentage of the root length of seedlings grown

    Techniques Used:

    Purification and characterization of Arabidopsis OPRs. A, SDS-PAGE analysis of affinity-purified Arabidopsis OPR1, OPR2, and OPR3 from E. coli . Lane M contains protein markers. B to E, Time course of TNT disappearance and product formation from purified
    Figure Legend Snippet: Purification and characterization of Arabidopsis OPRs. A, SDS-PAGE analysis of affinity-purified Arabidopsis OPR1, OPR2, and OPR3 from E. coli . Lane M contains protein markers. B to E, Time course of TNT disappearance and product formation from purified

    Techniques Used: Purification, SDS Page, Affinity Purification

    Morphology and biomass of overexpressing OPR (oxOPR) lines treated with TNT. A, Three-week-old, liquid culture-grown Arabidopsis growing without TNT. B, Appearance 7 d after dosing with 200 μ m TNT. C, Fresh weight biomass after 2 weeks. Results
    Figure Legend Snippet: Morphology and biomass of overexpressing OPR (oxOPR) lines treated with TNT. A, Three-week-old, liquid culture-grown Arabidopsis growing without TNT. B, Appearance 7 d after dosing with 200 μ m TNT. C, Fresh weight biomass after 2 weeks. Results

    Techniques Used:

    42) Product Images from "Dominant-negative Inhibitors of the Clostridium perfringens ?-Toxin *"

    Article Title: Dominant-negative Inhibitors of the Clostridium perfringens ?-Toxin *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M109.021782

    Inhibition of ϵ-toxin-mediated cytotoxicity by mutant proteins. Wild-type ϵ-toxin (6.5 n m , final concentration) was mixed with serial dilutions of Etx-I51C/A114C (■), Etx-V56C/F118C (□), Etx-H106P (●), or ϵ-prototoxin
    Figure Legend Snippet: Inhibition of ϵ-toxin-mediated cytotoxicity by mutant proteins. Wild-type ϵ-toxin (6.5 n m , final concentration) was mixed with serial dilutions of Etx-I51C/A114C (■), Etx-V56C/F118C (□), Etx-H106P (●), or ϵ-prototoxin

    Techniques Used: Inhibition, Mutagenesis, Concentration Assay

    Related Articles

    Clone Assay:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: .. The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: The underlined bases were to generate ligation-independent cloning (LIC) sites for the pMCSG7 vector [ ]. .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen).

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: Plasmid pTrc99a was used as a template for I-SceI cloning. .. The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Paragraph title: PCR conditions and cloning ... Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen).

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: Paragraph title: 2.2. Cloning and heterologous expression ... Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: Paragraph title: LIC Cloning ... Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099).

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: To construct the recombinant plasmid, the ligation-independent cloning (LIC) strategy was used. .. Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV).

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Amplification:

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen). .. The 50 μl of Escherichia coli NovaBlue cells (Novagen) was transformed with the self-annealed PCR product and pMCSG7 vector.

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: .. The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic). .. Homing endonuclease I-SceI was amplified from pSCM525 ( ) (a gift from B. Dujon) with primers EcoRI–SceI′, atcagt gaattc aggaaactcgagatgaaaaatattaaaaaaaa (EcoRI site shown in italic), and KpnI-Isce-2-C, atgccg ggtacc ttattttaaaaaagtttcgg (KpnI site shown in italic), and cloned into the KpnI and EcoRI sites of pTrc-p15a to form pTrc-ISceI. pTrc-D44A, containing a mutant I-SceI (D44A) was constructed using megaprimer PCR technique ( ).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: Cloning, expression and purification of AtXK-1 The gene encoding AtXK-1 was amplified by PCR using a forward primer 5' TACTTCCAATCCAATGCT GTTATGAGTGGCAATAAAGGAACGA 3' and reverse primer 5' TTATCCACTTCCAATG TTACAAACCACTGTTCTGTTTTGCGCCC 3' from cDNA library of Arabidopsis thaliana . .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ].

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: The gene xbp1, encoding a putative solute-binding protein, was amplified by PCR with Pfu DNA polymerase and the primer pair XBP1-F/XBP1-R ( ). .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: The primers used for amplification of the FapR gene was FAPR (5′-GACGACGACAAGATG CGG GTACCTAAAAAAG-3′) and FAPF (5′-GAGGAGAAGCCCGGTTATCTGGACTCCTCCTTAC-3′). .. Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen).

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: To introduce the overlap sequences for LIC cloning, the 5′ primer used for amplification contained the sequence AACACCTTCTTACAACAAATATACCAAAATG-ORF (which includes the ATG) and the 3′ primer contained the sequence AAACAAAACCTCCAAACCACT-ORF. .. Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099).

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Filtration:

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Construct:

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic). .. Homing endonuclease I-SceI was amplified from pSCM525 ( ) (a gift from B. Dujon) with primers EcoRI–SceI′, atcagt gaattc aggaaactcgagatgaaaaatattaaaaaaaa (EcoRI site shown in italic), and KpnI-Isce-2-C, atgccg ggtacc ttattttaaaaaagtttcgg (KpnI site shown in italic), and cloned into the KpnI and EcoRI sites of pTrc-p15a to form pTrc-ISceI. pTrc-D44A, containing a mutant I-SceI (D44A) was constructed using megaprimer PCR technique ( ).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: To construct the recombinant plasmid, the ligation-independent cloning (LIC) strategy was used. .. Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV).

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Incubation:

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099). .. T4 DNA polymerase treatments were allowed to proceed at 22°C for 40 min., then were incubated at 75°C for 15 min. to inactivate the T4 polymerase.

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. A total of 0.2 pmol of each insert was incubated with 0.01 pmol of pEV-L8 vector in 3 µL reaction mix at 22°C for 10 min followed by addition of 1 µL of 25 mM EDTA for 22°C for 5 min. Annealing reaction products were transformed into X10Gold competent cells (Strategene) and plated on LB agar containing 50 µg/mL kanamycin.

    Activity Assay:

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Expressing:

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: Paragraph title: Target selection, expression and purification of proteins ... The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: Paragraph title: Cloning, expression and purification of AtXK-1 ... The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ].

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of Xyn10A, Xyl3A, Agu67A, and XBP1 ... The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen). .. The plasmids were first transformed by thermal shock into the competent NovaBlue GigaSingles™ cells (Novagen) provided with the expression kit.

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: Paragraph title: 2.2. Cloning and heterologous expression ... Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: .. Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099). .. Amplified DNAs containing the ORFs to be inserted were gel purified, then similarly treated with T4 DNA polymerase in 20 μl reactions containing 0.12-0.48 pmol PCR product, 5 mM DTT, 2.5 mM dCTP, 1× T4 polymerase buffer and 5 units of polymerase per pmol of DNA.

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: Paragraph title: Cloning and expression of the proline-rich regions in plasmid constructs. ... For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen).

    Transformation Assay:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen). .. The 50 μl of Escherichia coli NovaBlue cells (Novagen) was transformed with the self-annealed PCR product and pMCSG7 vector.

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The recombinant vectors were transformed into Escherichia coli BL21 (DE3) for protein expression.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. The recombinant plasmids were transformed individually into E. coli BL-21 CodonPlus (DE3) RIL by heat shock and grown overnight at 37 °C on Lysogeny Broth (LB) agar plates supplemented with ampicillin (100 μg/ml) and chloramphenicol (50 μg/ml).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen). .. The plasmids were first transformed by thermal shock into the competent NovaBlue GigaSingles™ cells (Novagen) provided with the expression kit.

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Following identification of positive clones by colony PCR or restriction digests of the purified plasmid, the PCR-amplified DNA is sequenced to confirm its identity.

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. A total of 0.2 pmol of each insert was incubated with 0.01 pmol of pEV-L8 vector in 3 µL reaction mix at 22°C for 10 min followed by addition of 1 µL of 25 mM EDTA for 22°C for 5 min. Annealing reaction products were transformed into X10Gold competent cells (Strategene) and plated on LB agar containing 50 µg/mL kanamycin.

    Electroporation:

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Ligation:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: .. The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: The underlined bases were to generate ligation-independent cloning (LIC) sites for the pMCSG7 vector [ ]. .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: To facilitate ligation of the PCR products into the gene expression vector (pET46b), each forward primer (with an -F designation) was engineered to incorporate a 5′-GACGACGACAAGA extension, and the reverse primers (with an -R designation) were designed to include a 5′-GAGGAGAAGCCCGGT extension. .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: Design primers for PCR-amplification of the gene for insertion into the pET-30Xa ligation-independent cloning vector provided by Novagen (Madison, WI). .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: To construct the recombinant plasmid, the ligation-independent cloning (LIC) strategy was used. .. Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV).

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Introduce:

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Following identification of positive clones by colony PCR or restriction digests of the purified plasmid, the PCR-amplified DNA is sequenced to confirm its identity.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: To introduce the overlap sequences for LIC cloning, the 5′ primer used for amplification contained the sequence AACACCTTCTTACAACAAATATACCAAAATG-ORF (which includes the ATG) and the 3′ primer contained the sequence AAACAAAACCTCCAAACCACT-ORF. .. Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099).

    other:

    Article Title: A Family of LIC Vectors for High-Throughput Cloning and Purification of Proteins 1
    Article Snippet: dCTP (100 mM) (Promega cat. no. U1221) Dithiothreitol (DTT, 100 mM), molecular biology grade (Sigma cat. no. D-9779) T4 DNA polymerase, LIC-qualified (Novagen cat. no. 70099) 10× T4 polymerase buffer (included with polymerase)

    DNA Sequencing:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The plasmid containing mutagenic sodN was isolated using plasmid mini prep kit from Qiagen and DNA sequencing was performed to confirm the expected base sequence for each mutant (University of Massachusetts-Amherst DNA sequencing facility).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Polymerase Chain Reaction:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: .. The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen). .. The 50 μl of Escherichia coli NovaBlue cells (Novagen) was transformed with the self-annealed PCR product and pMCSG7 vector.

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: .. The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic). .. Homing endonuclease I-SceI was amplified from pSCM525 ( ) (a gift from B. Dujon) with primers EcoRI–SceI′, atcagt gaattc aggaaactcgagatgaaaaatattaaaaaaaa (EcoRI site shown in italic), and KpnI-Isce-2-C, atgccg ggtacc ttattttaaaaaagtttcgg (KpnI site shown in italic), and cloned into the KpnI and EcoRI sites of pTrc-p15a to form pTrc-ISceI. pTrc-D44A, containing a mutant I-SceI (D44A) was constructed using megaprimer PCR technique ( ).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: To facilitate ligation of the PCR products into the gene expression vector (pET46b), each forward primer (with an -F designation) was engineered to incorporate a 5′-GACGACGACAAGA extension, and the reverse primers (with an -R designation) were designed to include a 5′-GAGGAGAAGCCCGGT extension. .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Paragraph title: PCR conditions and cloning ... Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen).

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: The thermocycler program includes an initial hold at 95 °C for 2 min followed by 30 cycles of 95 °C for 10 s, 56 °C for 15 s, and 68 °C for 75 sec. Purify the DNA fragment of the expected size by 1% agarose gel electrophoresis with ethidium bromide staining, recovering the PCR product using a commercial kit such as the Wizard SV Gel and PCR Clean-Up System from Promega (Madison, WI). .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099). .. Amplified DNAs containing the ORFs to be inserted were gel purified, then similarly treated with T4 DNA polymerase in 20 μl reactions containing 0.12-0.48 pmol PCR product, 5 mM DTT, 2.5 mM dCTP, 1× T4 polymerase buffer and 5 units of polymerase per pmol of DNA.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: .. Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV). ..

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: In each case, an internal gene fragment of the pspA gene from the indicated strain was amplified by PCR using the primers given in Table . .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen).

    Recombinant:

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The recombinant vectors were transformed into Escherichia coli BL21 (DE3) for protein expression.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Introduce the plasmid into E. coli BL21(DE3) by transformation and grow the recombinant strain in LB medium supplemented with 30 μg/mL kanamycin.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: Paragraph title: 2.2. Recombinant plasmid construction ... Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: For details of the plasmids and recombinant proteins that were constructed for this work, see Table S1 in the supplemental material. .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen).

    Mutagenesis:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: Paragraph title: Site-Directed Mutagenesis ... The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ).

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: Mutant LacY(A177C) under the lac promoter was amplified from pLacYA177C ( ) (a gift from J. E. Cronan) with primers plac-StuI, gagctc aggcct gactcactatagggagaccg, and LacY-StuI-R, ctagct aggcct taagcgacttcattcacct (StuI sites shown in italic), and inserted into the StuI site of p11-ccdB-wtx1 to form p11-LacY-wtx1. .. The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic).

    Isolation:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The plasmid containing mutagenic sodN was isolated using plasmid mini prep kit from Qiagen and DNA sequencing was performed to confirm the expected base sequence for each mutant (University of Massachusetts-Amherst DNA sequencing facility).

    Subcloning:

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: This cloning strategy also renders subsequent subcloning experiments relatively easy and straightforward (if necessary), since the entire gene along with the engineered codons encoding the His6 -tag can be excised from the plasmid by Nde I and a second restriction enzyme, usually Hin dIII, Bam HI, or Eco RI, for ligation into pUWL201 or a related Streptomyces expression vector. .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Size-exclusion Chromatography:

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: The thermocycler program includes an initial hold at 95 °C for 2 min followed by 30 cycles of 95 °C for 10 s, 56 °C for 15 s, and 68 °C for 75 sec. Purify the DNA fragment of the expected size by 1% agarose gel electrophoresis with ethidium bromide staining, recovering the PCR product using a commercial kit such as the Wizard SV Gel and PCR Clean-Up System from Promega (Madison, WI). .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Purification:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: .. The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen). .. The 50 μl of Escherichia coli NovaBlue cells (Novagen) was transformed with the self-annealed PCR product and pMCSG7 vector.

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: Paragraph title: Cloning, expression and purification of AtXK-1 ... The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ].

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: Paragraph title: Cloning, Expression, and Purification of Xyn10A, Xyl3A, Agu67A, and XBP1 ... The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Reaction conditions were: initial denaturation step at 94 °C for 2 min; 30 cycles of 94 °C for 1 min, 56 °C for 40 s, and extension at 72 °C for 2 min; and a final extension at 72 °C for 10 min. Amplicons were purified using the QIAquick Gel Extraction kit (Qiagen), according to the manufacturer’s protocol. .. Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen).

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Following identification of positive clones by colony PCR or restriction digests of the purified plasmid, the PCR-amplified DNA is sequenced to confirm its identity.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099). .. Amplified DNAs containing the ORFs to be inserted were gel purified, then similarly treated with T4 DNA polymerase in 20 μl reactions containing 0.12-0.48 pmol PCR product, 5 mM DTT, 2.5 mM dCTP, 1× T4 polymerase buffer and 5 units of polymerase per pmol of DNA.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV). .. Recombinant plasmid was then purified using Mobius™ 200 kit (Novagen, Merck, USA), and then analysed using 1% agarose gel electrophoresis in Tris–phosphate buffer and then stained with ethidium bromide solution for 10 min and viewed in an ultraviolet transilluminator.

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Sequencing:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The plasmid containing mutagenic sodN was isolated using plasmid mini prep kit from Qiagen and DNA sequencing was performed to confirm the expected base sequence for each mutant (University of Massachusetts-Amherst DNA sequencing facility).

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: The coding sequence of agu67A was then amplified with agu67A-A as template and agu67A -F and agu67A -R ( ) as primers. .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad).

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: Sufficient sequence complementary to the reading frame was introduced to yield a predicted melting temperature of 63 °C. .. Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099).

    Selection:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: Paragraph title: Target selection, expression and purification of proteins ... The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen).

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen). .. The selection of clones was performed on selective LB agar medium containing 50 µg ml−1 ampicillin.

    Gel Extraction:

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: Reaction conditions were: initial denaturation step at 94 °C for 2 min; 30 cycles of 94 °C for 1 min, 56 °C for 40 s, and extension at 72 °C for 2 min; and a final extension at 72 °C for 10 min. Amplicons were purified using the QIAquick Gel Extraction kit (Qiagen), according to the manufacturer’s protocol. .. Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen).

    cDNA Library Assay:

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: Cloning, expression and purification of AtXK-1 The gene encoding AtXK-1 was amplified by PCR using a forward primer 5' TACTTCCAATCCAATGCT GTTATGAGTGGCAATAAAGGAACGA 3' and reverse primer 5' TTATCCACTTCCAATG TTACAAACCACTGTTCTGTTTTGCGCCC 3' from cDNA library of Arabidopsis thaliana . .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ].

    Plasmid Preparation:

    Article Title: Nickel Superoxide Dismutase: Structural and Functional Roles of Cys2 and Cys6
    Article Snippet: .. The PCR product was gel purified (1% agarose) and treated with T4 DNA polymerase to create overhangs complementary to the Ligation Independent Cloning (LIC) vector pET30 Xa/LIC (Novagen™ ). .. The insert was annealed to the vector and NovaBlue (Novagen™ ) competent cells were transformed with the pET30 Xa/LIC plasmid containing the sodN mutant gene for selection.

    Article Title: Enhancement of crystallization with nucleotide ligands identified by dye-ligand affinity chromatography
    Article Snippet: .. The pMCSG7 vector was digested with the SspI restriction enzyme (Promega), and the amplified and purified PCR product and a singly digested pMCSG7 vector were treated with T4 DNA polymerase (Novagen). .. The 50 μl of Escherichia coli NovaBlue cells (Novagen) was transformed with the self-annealed PCR product and pMCSG7 vector.

    Article Title: A highly sensitive selection method for directed evolution of homing endonucleases
    Article Snippet: Paragraph title: Plasmid construction ... The large fragment of pTrc-KM from AlwNI and HpaI digestion was treated with T4 DNA polymerase to form blunt ends, and ligated with the StuI digested PCR product of pACYCDuet-1 (Novagen, Madison, WI) amplified with primers StuI-D1, tattaaaggcct gctccagtggcttctgtttc, and StuI-D2, ataatt aggcct cttgagagccttcaacccag (StuI sites shown in italic).

    Article Title: Crystal Structures of Putative Sugar Kinases from Synechococcus Elongatus PCC 7942 and Arabidopsis Thaliana
    Article Snippet: .. The PCR product was treated by T4 DNA polymerase (LIC-qualified, Novagen) and then cloned into linearized pMCSG7 vector treated by T4 DNA polymerase (LIC-qualified, Novagen) with an N-terminal his6 tag though ligation-independent cloning method [ ]. .. The final construct was confirmed by DNA sequencing after amplified in competent Escherichia coli Trans 10 cells.

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: .. The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: .. Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen). .. The plasmids were first transformed by thermal shock into the competent NovaBlue GigaSingles™ cells (Novagen) provided with the expression kit.

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Following identification of positive clones by colony PCR or restriction digests of the purified plasmid, the PCR-amplified DNA is sequenced to confirm its identity.

    Article Title: Purification of Transmembrane Proteins from Saccharomyces cerevisiae for X-ray Crystallography
    Article Snippet: .. Expression vectors, described above, were digested with Bst XI, then single stranded regions were created using T4 DNA polymerase, in 20 μl reactions containing 0.037 pmol digested vector, 5 mM DTT, 2.5 mM dGTP, 1× T4 polymerase buffer (Novagen) and 0.2 units of T4 polymerase (LIC certified, Novagen (#70099). .. Amplified DNAs containing the ORFs to be inserted were gel purified, then similarly treated with T4 DNA polymerase in 20 μl reactions containing 0.12-0.48 pmol PCR product, 5 mM DTT, 2.5 mM dCTP, 1× T4 polymerase buffer and 5 units of polymerase per pmol of DNA.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: .. Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV). ..

    Article Title: Flexibility of PCNA-Protein Interface Accommodates Differential Binding Partners
    Article Snippet: .. Ligation Independent Cloning of PCNA Construct Ligation independent cloning compatible expression vector pEV-L8 containing an N-terminal (His)6 -tag and TEV protease recognition site was linearized by digestion with Ssp1 (New England BioLabs), purified by gel filtration, and treated with T4 DNA polymerase (Novagen) in the presence of dGTP (New England BioLabs) for 30 min at 22°C followed by heat inactivation at 75°C for 20 min. .. The PCNA fragment was amplified by PCR from a template plasmid (Genecoepia) using a high fidelity polymerase Platinum Pfx DNA polymerase (Invitrogen).

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: Paragraph title: Cloning and expression of the proline-rich regions in plasmid constructs. ... For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen).

    Functional Assay:

    Article Title: Biochemical and Structural Insights into Xylan Utilization by the Thermophilic Bacterium Caldanaerobius polysaccharolyticus *
    Article Snippet: The resultant amplicons were then digested with the exonuclease activity of T4 DNA polymerase and subcloned into pET46 Ek/LIC vector using the Ek/LIC cloning kit (Novagen) and E. coli JM109 as the competent cells by electroporation (Gene Pulser XcellTM from Bio-Rad). .. All recombinant plasmids (pET46- xyl3A , pET46- agu67A , and pET46- xbp1 ) were then extracted using QIAprep spin miniprep kit, and the nucleotides were sequenced (W. M. Keck Center for Comparative and Functional Genomics, University of Illinois) to confirm the integrity of the coding sequence.

    Positron Emission Tomography:

    Article Title: De novo synthesis of fatty acids is regulated by FapR protein in Exiguobacterium antarcticum B7, a psychrotrophic bacterium isolated from Antarctica
    Article Snippet: .. Subsequently, amplicons were treated with T4 DNA polymerase and ligated into the pET-46 Ek/LIC vector (Novagen). .. The plasmids were first transformed by thermal shock into the competent NovaBlue GigaSingles™ cells (Novagen) provided with the expression kit.

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells. .. Following identification of positive clones by colony PCR or restriction digests of the purified plasmid, the PCR-amplified DNA is sequenced to confirm its identity.

    Article Title: The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿The Proline-Rich Region of Pneumococcal Surface Proteins A and C Contains Surface-Accessible Epitopes Common to All Pneumococci and Elicits Antibody-Mediated Protection against Sepsis ▿ ‡
    Article Snippet: .. For the pET-41Ek/LIC (ligation-independent cloning) or the pET-46Ek/LIC constructs, the amplified gene fragments were digested with T4 DNA polymerase (Novagen), and the ∼100-bp pspA gene fragment was then incorporated into predigested vectors (Novagen). .. DNA sequencing confirmed that all the recombinant plasmids contained the expected pspA gene fragments as shown in Fig. .

    Agarose Gel Electrophoresis:

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: The thermocycler program includes an initial hold at 95 °C for 2 min followed by 30 cycles of 95 °C for 10 s, 56 °C for 15 s, and 68 °C for 75 sec. Purify the DNA fragment of the expected size by 1% agarose gel electrophoresis with ethidium bromide staining, recovering the PCR product using a commercial kit such as the Wizard SV Gel and PCR Clean-Up System from Promega (Madison, WI). .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV). .. Recombinant plasmid was then purified using Mobius™ 200 kit (Novagen, Merck, USA), and then analysed using 1% agarose gel electrophoresis in Tris–phosphate buffer and then stained with ethidium bromide solution for 10 min and viewed in an ultraviolet transilluminator.

    Staining:

    Article Title: Fe(II)-dependent, uridine-5?-monophosphate ?-ketoglutarate dioxygenases in the synthesis of 5?-modified nucleosides
    Article Snippet: The thermocycler program includes an initial hold at 95 °C for 2 min followed by 30 cycles of 95 °C for 10 s, 56 °C for 15 s, and 68 °C for 75 sec. Purify the DNA fragment of the expected size by 1% agarose gel electrophoresis with ethidium bromide staining, recovering the PCR product using a commercial kit such as the Wizard SV Gel and PCR Clean-Up System from Promega (Madison, WI). .. Prepare the DNA overhangs using T4 DNA polymerase, following the protocol provided by Novagen, anneal with the pET-30Xa vector, and introduce by transformation into NovaBlue cells.

    Article Title: Expression of variable viruses as herpes simplex glycoprotein D and varicella zoster gE glycoprotein using a novel plasmid based expression system in insect cell
    Article Snippet: Briefly, the insert with overhangs prepared by PCR was treated with T4 DNA polymerase in the presence of dATP, and then annealed with the pIEx/Bac-3 3C/LIC vector (Novagen, Merck, USA) containing the hr5 (homologous region 5) enhancer and the ie1 (immediate early 1) promoter from Autographa californica nuclear polyhedrosis virus (AcNPV). .. Recombinant plasmid was then purified using Mobius™ 200 kit (Novagen, Merck, USA), and then analysed using 1% agarose gel electrophoresis in Tris–phosphate buffer and then stained with ethidium bromide solution for 10 min and viewed in an ultraviolet transilluminator.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore escherichia coli strain novablue
    Escherichia Coli Strain Novablue, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli strain novablue/product/Millipore
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    escherichia coli strain novablue - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    92
    Millipore novablue
    Novablue, supplied by Millipore, used in various techniques. Bioz Stars score: 92/100, based on 18 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/novablue/product/Millipore
    Average 92 stars, based on 18 article reviews
    Price from $9.99 to $1999.99
    novablue - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    93
    Millipore e coli novablue competent cells
    E Coli Novablue Competent Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 93/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli novablue competent cells/product/Millipore
    Average 93 stars, based on 5 article reviews
    Price from $9.99 to $1999.99
    e coli novablue competent cells - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results