pcr ii topo vector  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    Thermo Fisher pcr ii topo vector
    (A) Generation of a library encoding STAT5-responsive genomic elements by ChIP-cloning . IL-2 stimulated, formaldehyde cross-linked YT cells were lysed, sonicated and immuno-precipitated with antibodies to STAT5A or STAT5B. Eluted DNA was ligated to a unidirectional linker (black blocks), amplified and then cloned into <t>pCR</t> <t>II-TOPO</t> vector. Clones containing inserts were identified by sequencing. (B) Successful immuno-precipitation of STAT5 from formaldehyde fixed YT cell lysates . YT cells were stimulated with medium (-) or IL-2 (+) then fixed with formaldehyde. Fixed lysates were immuno-precipitated with antibodies to STAT5 as indicated or normal rabbit serum (IgG CTRL) then Western blotted for STAT5. Molecular weight markers are indicated to the left side of the panel. Input material corresponds to 1% of cell lysate used in the immuno-precipitations. (C) Validation of STAT5 ChIP in YT cells . ChIP assay with C-terminal antibodies to STAT5A and B in combination (αSTAT5 C-term) or IgG control was carried out as described above. The eluted DNA was then used as template in qPCR reactions with primers designed to PRR III. (D) STAT5 bound genomic library captured by ChIP-cloning . Inserts were amplified via PCR using M13 primers prior to sequencing and visualized by agarose gel electrophoresis (1%). Stars (*) indicate clones without an insert. (E) Nearby gene mapping of the ChIP-clone identified genomic sequences . One hundred and nineteen clones were sequenced, 3 fragments were duplicates and 9 were greater than 300 kb away from any coding region. The remaining sequences that fell within 300 kb from coding regions were analyzed with Cis-Regulatory Element Annotation System (CEAS). The pie chart represents
    Pcr Ii Topo Vector, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 24171 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/pcr ii topo vector/product/Thermo Fisher
    Average 94 stars, based on 24171 article reviews
    Price from $9.99 to $1999.99
    pcr ii topo vector - by Bioz Stars, 2020-10
    94/100 stars

    Images

    1) Product Images from "STAT5 regulation of BCL10 parallels constitutive NF?B activation in lymphoid tumor cells"

    Article Title: STAT5 regulation of BCL10 parallels constitutive NF?B activation in lymphoid tumor cells

    Journal: Molecular Cancer

    doi: 10.1186/1476-4598-8-67

    (A) Generation of a library encoding STAT5-responsive genomic elements by ChIP-cloning . IL-2 stimulated, formaldehyde cross-linked YT cells were lysed, sonicated and immuno-precipitated with antibodies to STAT5A or STAT5B. Eluted DNA was ligated to a unidirectional linker (black blocks), amplified and then cloned into pCR II-TOPO vector. Clones containing inserts were identified by sequencing. (B) Successful immuno-precipitation of STAT5 from formaldehyde fixed YT cell lysates . YT cells were stimulated with medium (-) or IL-2 (+) then fixed with formaldehyde. Fixed lysates were immuno-precipitated with antibodies to STAT5 as indicated or normal rabbit serum (IgG CTRL) then Western blotted for STAT5. Molecular weight markers are indicated to the left side of the panel. Input material corresponds to 1% of cell lysate used in the immuno-precipitations. (C) Validation of STAT5 ChIP in YT cells . ChIP assay with C-terminal antibodies to STAT5A and B in combination (αSTAT5 C-term) or IgG control was carried out as described above. The eluted DNA was then used as template in qPCR reactions with primers designed to PRR III. (D) STAT5 bound genomic library captured by ChIP-cloning . Inserts were amplified via PCR using M13 primers prior to sequencing and visualized by agarose gel electrophoresis (1%). Stars (*) indicate clones without an insert. (E) Nearby gene mapping of the ChIP-clone identified genomic sequences . One hundred and nineteen clones were sequenced, 3 fragments were duplicates and 9 were greater than 300 kb away from any coding region. The remaining sequences that fell within 300 kb from coding regions were analyzed with Cis-Regulatory Element Annotation System (CEAS). The pie chart represents
    Figure Legend Snippet: (A) Generation of a library encoding STAT5-responsive genomic elements by ChIP-cloning . IL-2 stimulated, formaldehyde cross-linked YT cells were lysed, sonicated and immuno-precipitated with antibodies to STAT5A or STAT5B. Eluted DNA was ligated to a unidirectional linker (black blocks), amplified and then cloned into pCR II-TOPO vector. Clones containing inserts were identified by sequencing. (B) Successful immuno-precipitation of STAT5 from formaldehyde fixed YT cell lysates . YT cells were stimulated with medium (-) or IL-2 (+) then fixed with formaldehyde. Fixed lysates were immuno-precipitated with antibodies to STAT5 as indicated or normal rabbit serum (IgG CTRL) then Western blotted for STAT5. Molecular weight markers are indicated to the left side of the panel. Input material corresponds to 1% of cell lysate used in the immuno-precipitations. (C) Validation of STAT5 ChIP in YT cells . ChIP assay with C-terminal antibodies to STAT5A and B in combination (αSTAT5 C-term) or IgG control was carried out as described above. The eluted DNA was then used as template in qPCR reactions with primers designed to PRR III. (D) STAT5 bound genomic library captured by ChIP-cloning . Inserts were amplified via PCR using M13 primers prior to sequencing and visualized by agarose gel electrophoresis (1%). Stars (*) indicate clones without an insert. (E) Nearby gene mapping of the ChIP-clone identified genomic sequences . One hundred and nineteen clones were sequenced, 3 fragments were duplicates and 9 were greater than 300 kb away from any coding region. The remaining sequences that fell within 300 kb from coding regions were analyzed with Cis-Regulatory Element Annotation System (CEAS). The pie chart represents "%" distribution.

    Techniques Used: Chromatin Immunoprecipitation, Clone Assay, Sonication, Amplification, Polymerase Chain Reaction, Plasmid Preparation, Sequencing, Immunoprecipitation, Western Blot, Molecular Weight, Real-time Polymerase Chain Reaction, Agarose Gel Electrophoresis, Genomic Sequencing

    2) Product Images from "Cloning and characterization of filamentous temperature-sensitive protein Z from Xanthomonas oryzae pv. Oryzae"

    Article Title: Cloning and characterization of filamentous temperature-sensitive protein Z from Xanthomonas oryzae pv. Oryzae

    Journal: SpringerPlus

    doi: 10.1186/s40064-016-1876-3

    Analysis of the process for FtsZ expression and purification by SDS-PAGE ( a ) and western blotting analysis of the purified FtsZ ( b ). The FtsZ was expressed in E. coli BL21 (DE3)/pET22b- ftsZ induced by 0.6 mM IPTG at 37 °C for 3 h. Lane M 1 and M 2 protein Marker; lane 1 purified FtsZ via Ni-NTA agarose column; lane 2 supernatant after ultrasonication under induced conditions; lane 3 total protein under induced conditions; lane 4 supernatant of broth under induced conditions; lane 5 supernatant of lysed E. coli BL21 cells containing pET-22b- ftsZ ; lane 6 purified FtsZ via Ni-NTA agarose column. The migration difference of the 44.3 kDa protein between ( a ) and ( b ) is due to gel electrophoresis with different pulse time
    Figure Legend Snippet: Analysis of the process for FtsZ expression and purification by SDS-PAGE ( a ) and western blotting analysis of the purified FtsZ ( b ). The FtsZ was expressed in E. coli BL21 (DE3)/pET22b- ftsZ induced by 0.6 mM IPTG at 37 °C for 3 h. Lane M 1 and M 2 protein Marker; lane 1 purified FtsZ via Ni-NTA agarose column; lane 2 supernatant after ultrasonication under induced conditions; lane 3 total protein under induced conditions; lane 4 supernatant of broth under induced conditions; lane 5 supernatant of lysed E. coli BL21 cells containing pET-22b- ftsZ ; lane 6 purified FtsZ via Ni-NTA agarose column. The migration difference of the 44.3 kDa protein between ( a ) and ( b ) is due to gel electrophoresis with different pulse time

    Techniques Used: Expressing, Purification, SDS Page, Western Blot, Marker, Positron Emission Tomography, Migration, Nucleic Acid Electrophoresis

    3) Product Images from "Infectious alphavirus production from a simple plasmid transfection+"

    Article Title: Infectious alphavirus production from a simple plasmid transfection+

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-356

    Plasmid constructs . The full-length double subgenomic Sindbis genome TE3'2J was engineered behind a cytomegalovirus promoter (CMV), and a 3' hepatitis delta virus ribozyme (HDV) was added after a 35 base adenine repeat (A35) to cleave the viral RNA from the over length transcript. pBG167 possess a unique XbaI site after the second SGP, and is analogous to pTE3'2J [ 17 ]. pBG218 is pBG167 with GFP inserted at XbaI site via ligation between the unique XbaI site in pBG167 and engineered NheI sites flanking the GFP ORF. pBG210 and pBG211 have the attR1/attR2 Gateway Recombination Cassettes ligated into the pBG167 XbaI site in forward and reverse orientation, respectively. pBG212 is the product of a LR Clonase reaction between pBG210 and pBG440 and places GFP in the sense orientation. pBG213 is a recombination between pBG211 and pBG440, and places GFP in the reverse orientation. pBG451 is the product of a recombination between pBG210 and pBG403, and places Renilla luciferase in the sense orientation. pBG452 is the product of a recombination between pBG210 and pBG344 and places mCherry in the sense orientation.
    Figure Legend Snippet: Plasmid constructs . The full-length double subgenomic Sindbis genome TE3'2J was engineered behind a cytomegalovirus promoter (CMV), and a 3' hepatitis delta virus ribozyme (HDV) was added after a 35 base adenine repeat (A35) to cleave the viral RNA from the over length transcript. pBG167 possess a unique XbaI site after the second SGP, and is analogous to pTE3'2J [ 17 ]. pBG218 is pBG167 with GFP inserted at XbaI site via ligation between the unique XbaI site in pBG167 and engineered NheI sites flanking the GFP ORF. pBG210 and pBG211 have the attR1/attR2 Gateway Recombination Cassettes ligated into the pBG167 XbaI site in forward and reverse orientation, respectively. pBG212 is the product of a LR Clonase reaction between pBG210 and pBG440 and places GFP in the sense orientation. pBG213 is a recombination between pBG211 and pBG440, and places GFP in the reverse orientation. pBG451 is the product of a recombination between pBG210 and pBG403, and places Renilla luciferase in the sense orientation. pBG452 is the product of a recombination between pBG210 and pBG344 and places mCherry in the sense orientation.

    Techniques Used: Plasmid Preparation, Construct, Ligation, Luciferase

    4) Product Images from "Improvement of efficiency of brown coal biosolubilization by novel recombinant Fusarium oxysporum laccase"

    Article Title: Improvement of efficiency of brown coal biosolubilization by novel recombinant Fusarium oxysporum laccase

    Journal: AMB Express

    doi: 10.1186/s13568-018-0669-1

    Dynamics of biosynthesis of recombinant F. oxysporum laccase in P. pastoris KM71H. Diamonds—wet biomass, triangles—laccase activity, circles—protein concentration
    Figure Legend Snippet: Dynamics of biosynthesis of recombinant F. oxysporum laccase in P. pastoris KM71H. Diamonds—wet biomass, triangles—laccase activity, circles—protein concentration

    Techniques Used: Recombinant, Activity Assay, Protein Concentration

    5) Product Images from "Ligand-directed profiling of organelles with internalizing phage libraries"

    Article Title: Ligand-directed profiling of organelles with internalizing phage libraries

    Journal: Current protocols in protein science / editorial board, John E. Coligan ... [et al.]

    doi: 10.1002/0471140864.ps3004s79

    Cloning strategy to generate the iPhage library. The f88-4 phage vector contains two capsid genes encoding a wild-type (wt) protein VIII (pVIII) and a recombinant protein VIII (rpVIII). The recombinant gene VIII contains a foreign DNA insert with a Hin
    Figure Legend Snippet: Cloning strategy to generate the iPhage library. The f88-4 phage vector contains two capsid genes encoding a wild-type (wt) protein VIII (pVIII) and a recombinant protein VIII (rpVIII). The recombinant gene VIII contains a foreign DNA insert with a Hin

    Techniques Used: Clone Assay, Plasmid Preparation, Recombinant

    6) Product Images from "Use of recombinant S1 spike polypeptide to develop a TCoV-specific antibody ELISA"

    Article Title: Use of recombinant S1 spike polypeptide to develop a TCoV-specific antibody ELISA

    Journal: Veterinary Microbiology

    doi: 10.1016/j.vetmic.2009.04.010

    Production and confirmation of antigenicity of TCoV-S 54–395 recombinant protein produced by E. coli BL21 transfected with pGEX-4T3-TCoV-S 54–395 using 12% discontinuous SDS-PAGE (lanes 1–2) and subsequent Western blotting with anti-GST antibodies (lanes 3–4) or experimentally derived turkey sera against TCoV (lane 5). Lanes: (M) Molecular weight markers, in kiloDalton; (1) purified TCoV-S 54–395 +GST fusion protein (∼67 kDa, open arrow) from bacterial lysate after induction with IPTG; (2) same as lane 1 but from non-induced bacterial culture; (3 and 4) Western blot of samples as in lanes 1 and 2, respectively, using anti-GST antibodies against the TCoV-S 54–395 +GST fusion protein (∼67 kDa, open arrow, lane 3). (Lane 5) Purified TCoV-S 54–395 recombinant protein (cleaved from TCoV-S 54–395 +GST fusion protein by thrombin protease and subsequently purified) was recognized by turkey serum antibodies against TCoV (∼38 kDa, solid arrow).
    Figure Legend Snippet: Production and confirmation of antigenicity of TCoV-S 54–395 recombinant protein produced by E. coli BL21 transfected with pGEX-4T3-TCoV-S 54–395 using 12% discontinuous SDS-PAGE (lanes 1–2) and subsequent Western blotting with anti-GST antibodies (lanes 3–4) or experimentally derived turkey sera against TCoV (lane 5). Lanes: (M) Molecular weight markers, in kiloDalton; (1) purified TCoV-S 54–395 +GST fusion protein (∼67 kDa, open arrow) from bacterial lysate after induction with IPTG; (2) same as lane 1 but from non-induced bacterial culture; (3 and 4) Western blot of samples as in lanes 1 and 2, respectively, using anti-GST antibodies against the TCoV-S 54–395 +GST fusion protein (∼67 kDa, open arrow, lane 3). (Lane 5) Purified TCoV-S 54–395 recombinant protein (cleaved from TCoV-S 54–395 +GST fusion protein by thrombin protease and subsequently purified) was recognized by turkey serum antibodies against TCoV (∼38 kDa, solid arrow).

    Techniques Used: Recombinant, Produced, Transfection, SDS Page, Western Blot, Derivative Assay, Molecular Weight, Purification

    7) Product Images from "Cloning, Expression and Purification of Pseudomonas putida ATCC12633 Creatinase"

    Article Title: Cloning, Expression and Purification of Pseudomonas putida ATCC12633 Creatinase

    Journal: Avicenna Journal of Medical Biotechnology

    doi:

    Lane 1: PCR product of Cre gene, lane 2: pET28a-cre plasmid extraction result, lane 3: DNA ladder, lane 4: double digestion of recombinant pET28a-cre by NheI and XhoI. Products were electrophoresed on 0.7% agarose gel.
    Figure Legend Snippet: Lane 1: PCR product of Cre gene, lane 2: pET28a-cre plasmid extraction result, lane 3: DNA ladder, lane 4: double digestion of recombinant pET28a-cre by NheI and XhoI. Products were electrophoresed on 0.7% agarose gel.

    Techniques Used: Polymerase Chain Reaction, Plasmid Preparation, Recombinant, Agarose Gel Electrophoresis

    8) Product Images from "The Argi system: one-step purification of proteins tagged with arginine-rich cell-penetrating peptides"

    Article Title: The Argi system: one-step purification of proteins tagged with arginine-rich cell-penetrating peptides

    Journal: Scientific Reports

    doi: 10.1038/s41598-017-02432-6

    Analysis of arginine-rich peptide-tagged protein purification from E. coli total protein extract using AR aptamer-based chromatography. The recombinant proteins: GFP-R 6 ( A ), R 6 -GST ( B ), R 6 -PCNA ( C ), GFP-R 8 ( D ), R 8 -GST ( E ), R 8 -PCNA ( F ), GFP-Tat 49–57 ( G ), Tat 49–57 -GST ( H ) and Tat 49–57 -PCNA ( I ) were overexpressed and purified from E. coli total protein extract using AR aptamer. Lanes: M) molecular weight marker; 1) non-induced BL21-CodonPlus(DE3)-RIL[pET29a arginine-rich peptide-tagged protein] cells; 2) induced BL21-CodonPlus(DE3)-RIL [pET29a arginine-rich peptide-tagged protein] cells; 3) cell lysate; 4) 4 μg of protein sample eluted from AR aptamer-based resin using ARGI buffer supplemented with GuHCl. The samples were denatured and separated on 12% SDS-PAGE followed by Coomassie brilliant blue staining. This is one of three independent experiments which is representative.
    Figure Legend Snippet: Analysis of arginine-rich peptide-tagged protein purification from E. coli total protein extract using AR aptamer-based chromatography. The recombinant proteins: GFP-R 6 ( A ), R 6 -GST ( B ), R 6 -PCNA ( C ), GFP-R 8 ( D ), R 8 -GST ( E ), R 8 -PCNA ( F ), GFP-Tat 49–57 ( G ), Tat 49–57 -GST ( H ) and Tat 49–57 -PCNA ( I ) were overexpressed and purified from E. coli total protein extract using AR aptamer. Lanes: M) molecular weight marker; 1) non-induced BL21-CodonPlus(DE3)-RIL[pET29a arginine-rich peptide-tagged protein] cells; 2) induced BL21-CodonPlus(DE3)-RIL [pET29a arginine-rich peptide-tagged protein] cells; 3) cell lysate; 4) 4 μg of protein sample eluted from AR aptamer-based resin using ARGI buffer supplemented with GuHCl. The samples were denatured and separated on 12% SDS-PAGE followed by Coomassie brilliant blue staining. This is one of three independent experiments which is representative.

    Techniques Used: Protein Purification, Chromatography, Recombinant, Purification, Molecular Weight, Marker, SDS Page, Staining

    9) Product Images from "Improvement of yeast tolerance to acetic acid through Haa1 transcription factor engineering: towards the underlying mechanisms"

    Article Title: Improvement of yeast tolerance to acetic acid through Haa1 transcription factor engineering: towards the underlying mechanisms

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-016-0621-5

    Selection of mutant HAA1 alleles with improved tolerance to acetic acid. a Growth performance of two parallel cultures of an HAA1 mutant library during the fourth round of enrichment in synthetic medium containing 200 mM acetic acid (pH 4.5) is shown. First, a CEN/ARS plasmid-based HAA1 mutant library was generated by means of error-prone PCR and recombinatorial cloning in the S. cerevisiae strain CEN.PK113-13D haa1 Δ. Two aliquots of the library were then cultivated under non-stress conditions until exponential growth phase, after which the cells were transferred to synthetic medium containing 200 mM acetic acid (pH 4.5). This procedure of alternating non-stress and acetic acid stress conditions was repeated four times. For comparison, cells of an isogenic strain containing the wild-type HAA1 allele cloned in the same plasmid backbone (pRS416- HAA1 ) were subjected to the same enrichment procedure, and the growth performance in acetic acid containing medium during the fourth round of enrichment is shown as well. The strain CEN.PK113-13D haa1 Δ containing the empty plasmid (pRS416) was always included as a control. b Modifications in protein sequence deduced from five non-redundant mutant HAA1 alleles isolated from the enriched library cultures that significantly improved acetic acid tolerance. c Relative position of the identified mutations in the Haa1 DNA binding and transactivation domains
    Figure Legend Snippet: Selection of mutant HAA1 alleles with improved tolerance to acetic acid. a Growth performance of two parallel cultures of an HAA1 mutant library during the fourth round of enrichment in synthetic medium containing 200 mM acetic acid (pH 4.5) is shown. First, a CEN/ARS plasmid-based HAA1 mutant library was generated by means of error-prone PCR and recombinatorial cloning in the S. cerevisiae strain CEN.PK113-13D haa1 Δ. Two aliquots of the library were then cultivated under non-stress conditions until exponential growth phase, after which the cells were transferred to synthetic medium containing 200 mM acetic acid (pH 4.5). This procedure of alternating non-stress and acetic acid stress conditions was repeated four times. For comparison, cells of an isogenic strain containing the wild-type HAA1 allele cloned in the same plasmid backbone (pRS416- HAA1 ) were subjected to the same enrichment procedure, and the growth performance in acetic acid containing medium during the fourth round of enrichment is shown as well. The strain CEN.PK113-13D haa1 Δ containing the empty plasmid (pRS416) was always included as a control. b Modifications in protein sequence deduced from five non-redundant mutant HAA1 alleles isolated from the enriched library cultures that significantly improved acetic acid tolerance. c Relative position of the identified mutations in the Haa1 DNA binding and transactivation domains

    Techniques Used: Selection, Mutagenesis, Plasmid Preparation, Generated, Polymerase Chain Reaction, Clone Assay, Sequencing, Isolation, Binding Assay

    10) Product Images from "CML20, an Arabidopsis Calmodulin-like Protein, Negatively Regulates Guard Cell ABA Signaling and Drought Stress Tolerance"

    Article Title: CML20, an Arabidopsis Calmodulin-like Protein, Negatively Regulates Guard Cell ABA Signaling and Drought Stress Tolerance

    Journal: Frontiers in Plant Science

    doi: 10.3389/fpls.2017.00824

    Stomatal movement of the cml20 mutant is hypersensitive to ABA treatment, making the plant more tolerant to drought stress. (A) The T-DNA insertion site in the third intron of CML20 . (B,C) CML20 is not transcribed in the cml20 mutant, as shown by (B) RT-PCR analysis and (C) qRT-PCR analysis. Error bars represent the SE ( n = 3). The ACTIN2 was used as an internal control. (D,E) The stomatal movement assay: (D) ABA induction of stomatal closure, (E) ABA inhibition of stomatal opening. At least 60 stomata were measured for each genotype per replication. ∗ means differ significantly ( P
    Figure Legend Snippet: Stomatal movement of the cml20 mutant is hypersensitive to ABA treatment, making the plant more tolerant to drought stress. (A) The T-DNA insertion site in the third intron of CML20 . (B,C) CML20 is not transcribed in the cml20 mutant, as shown by (B) RT-PCR analysis and (C) qRT-PCR analysis. Error bars represent the SE ( n = 3). The ACTIN2 was used as an internal control. (D,E) The stomatal movement assay: (D) ABA induction of stomatal closure, (E) ABA inhibition of stomatal opening. At least 60 stomata were measured for each genotype per replication. ∗ means differ significantly ( P

    Techniques Used: Mutagenesis, Reverse Transcription Polymerase Chain Reaction, Quantitative RT-PCR, Motility Assay, Inhibition

    A proposed model for the signaling role of CML20 in the guard cell in response to ABA .
    Figure Legend Snippet: A proposed model for the signaling role of CML20 in the guard cell in response to ABA .

    Techniques Used:

    The site of expression of CML20 . (A–G) GUS staining of various tissues in A. thaliana plants harboring pCML20::GUS . (A) The whole seedling. Bar: 2 mm, (B) the root. Bar: 0.5 mm, (C) the silique. Bar: 3 mm, (D) the leaf. Bar: 1.5 mm, (E) the Inflorescence. Bar: 1.5 mm, all without abscisic acid (ABA) treatment, (F) a guard cell in plants not exposed to ABA treatment. Bar: 10 μm, (G) a guard cell in plants 6 h after exposure to 50 μM ABA treatment. Bar: 10 μm. (H) Transcript levels of CML20 in leaves and epidermis exposed to 50 μM ABA treatment for 6 h or solvent control. Error bars show the SE ( n = 3). (I,J) Transient expression of GFP and CML20-GFP in mesophyll protoplasts showing their sub-cellular localization (I) p35S::CML20-GFP and (J) p35S::GFP . Bar: 10 μm.
    Figure Legend Snippet: The site of expression of CML20 . (A–G) GUS staining of various tissues in A. thaliana plants harboring pCML20::GUS . (A) The whole seedling. Bar: 2 mm, (B) the root. Bar: 0.5 mm, (C) the silique. Bar: 3 mm, (D) the leaf. Bar: 1.5 mm, (E) the Inflorescence. Bar: 1.5 mm, all without abscisic acid (ABA) treatment, (F) a guard cell in plants not exposed to ABA treatment. Bar: 10 μm, (G) a guard cell in plants 6 h after exposure to 50 μM ABA treatment. Bar: 10 μm. (H) Transcript levels of CML20 in leaves and epidermis exposed to 50 μM ABA treatment for 6 h or solvent control. Error bars show the SE ( n = 3). (I,J) Transient expression of GFP and CML20-GFP in mesophyll protoplasts showing their sub-cellular localization (I) p35S::CML20-GFP and (J) p35S::GFP . Bar: 10 μm.

    Techniques Used: Expressing, Staining

    CML20 is involved in the ABA regulation of inward K + and slow-type anion channels. (A) Patch-clamp whole cell recordings of the inward K + current in guard cell protoplasts isolated from WT, cml20 and the CML20 over-expression lines OE-1 and -2, either in the presence or absence of 50 μM ABA. (B) Current/voltage relationships of whole cell K + currents. The number of guard cells measured were: WT (8), WT+ABA (9), cml20 (7), cml20 +ABA (8), OE-1 (7), OE-1+ABA (11), OE-2 (11), OE-2+ABA (12). Error bars represent the SE. (C) ABA (50 μM) activation of slow anion currents in guard cell protoplasts of WT, cml20 , OE-1, and OE-2. (D) Current/voltage relationships of whole cell slow anion currents. The number of guard cells measured were: WT (9), WT+ABA (7), cml20 (9), cml20 +ABA (11), OE-1 (6), OE-1+ABA (7), OE-2 (11), OE-2+ABA (10). Error bars represent the SE.
    Figure Legend Snippet: CML20 is involved in the ABA regulation of inward K + and slow-type anion channels. (A) Patch-clamp whole cell recordings of the inward K + current in guard cell protoplasts isolated from WT, cml20 and the CML20 over-expression lines OE-1 and -2, either in the presence or absence of 50 μM ABA. (B) Current/voltage relationships of whole cell K + currents. The number of guard cells measured were: WT (8), WT+ABA (9), cml20 (7), cml20 +ABA (8), OE-1 (7), OE-1+ABA (11), OE-2 (11), OE-2+ABA (12). Error bars represent the SE. (C) ABA (50 μM) activation of slow anion currents in guard cell protoplasts of WT, cml20 , OE-1, and OE-2. (D) Current/voltage relationships of whole cell slow anion currents. The number of guard cells measured were: WT (9), WT+ABA (7), cml20 (9), cml20 +ABA (11), OE-1 (6), OE-1+ABA (7), OE-2 (11), OE-2+ABA (10). Error bars represent the SE.

    Techniques Used: Patch Clamp, Isolation, Over Expression, Activation Assay

    The CML20 over-expression lines OE-1 and -2 show hypersensitivity to drought stress. (A) CML20 transcript abundance in WT and the two over-expression lines (qRT-PCR assay). ACTIN2 was used as the internal control. Error bars represent the SE ( n = 3). (B,C) Stomatal movement in WT, OE-1 and OE-2 under control (without ABA) and 50 μM ABA conditions. At least 60 stomata were measured for each genotype per replication ∗ : means differ significantly ( P
    Figure Legend Snippet: The CML20 over-expression lines OE-1 and -2 show hypersensitivity to drought stress. (A) CML20 transcript abundance in WT and the two over-expression lines (qRT-PCR assay). ACTIN2 was used as the internal control. Error bars represent the SE ( n = 3). (B,C) Stomatal movement in WT, OE-1 and OE-2 under control (without ABA) and 50 μM ABA conditions. At least 60 stomata were measured for each genotype per replication ∗ : means differ significantly ( P

    Techniques Used: Over Expression, Quantitative RT-PCR

    The transcription of the indicated stress-responsive genes was altered in the cml20 mutant. RAB18, COR47, MYB2 and ERD10 were up-regulated by exposure to 50 μM ABA for 6 h. RD29A and KIN2 were up-regulated by exposure to drought stress for 6 h. ACTIN2 was used as the internal control. Error bars represent the SE ( n = 3).
    Figure Legend Snippet: The transcription of the indicated stress-responsive genes was altered in the cml20 mutant. RAB18, COR47, MYB2 and ERD10 were up-regulated by exposure to 50 μM ABA for 6 h. RD29A and KIN2 were up-regulated by exposure to drought stress for 6 h. ACTIN2 was used as the internal control. Error bars represent the SE ( n = 3).

    Techniques Used: Mutagenesis

    CML20, a calmodulin-like protein, is able to bind Ca 2+ . (A) Amino acid sequence alignment between CML20 and its homologs CAM2, CAM7, and CML9. (B) The amino acid sequence of CML20. The Ca 2+ -binding EF-hand motifs are highlighted in yellow. (C) The SDS-PAGE mobility shift assay showing that CML20 and CaM7 bind to Ca 2+ . GST was used as a negative control. The left-hand lane contains a protein size marker.
    Figure Legend Snippet: CML20, a calmodulin-like protein, is able to bind Ca 2+ . (A) Amino acid sequence alignment between CML20 and its homologs CAM2, CAM7, and CML9. (B) The amino acid sequence of CML20. The Ca 2+ -binding EF-hand motifs are highlighted in yellow. (C) The SDS-PAGE mobility shift assay showing that CML20 and CaM7 bind to Ca 2+ . GST was used as a negative control. The left-hand lane contains a protein size marker.

    Techniques Used: Sequencing, Binding Assay, SDS Page, Mobility Shift, Negative Control, Marker

    Reactive oxygen species (ROS) production is elevated in the guard cells of cml20 plants exposed to ABA. (A) H 2 DCF fluorescence in WT, cml20 and OE-2 imaged at 5 min intervals over 25 min. At least ten guard cells were measured. (B) H 2 DCF-DA staining revealed a higher level of ROS production in cml20 than in WT, and a lower level in OE-2. Error bars represent the SE. (C) The transcription of APX2 was down-regulated in cml20 . Error bars represent the SE ( n = 3).
    Figure Legend Snippet: Reactive oxygen species (ROS) production is elevated in the guard cells of cml20 plants exposed to ABA. (A) H 2 DCF fluorescence in WT, cml20 and OE-2 imaged at 5 min intervals over 25 min. At least ten guard cells were measured. (B) H 2 DCF-DA staining revealed a higher level of ROS production in cml20 than in WT, and a lower level in OE-2. Error bars represent the SE. (C) The transcription of APX2 was down-regulated in cml20 . Error bars represent the SE ( n = 3).

    Techniques Used: Fluorescence, Staining

    11) Product Images from "Overproduction, purification, and characterization of nanosized polyphosphate bodies from Synechococcus sp. PCC 7002"

    Article Title: Overproduction, purification, and characterization of nanosized polyphosphate bodies from Synechococcus sp. PCC 7002

    Journal: Microbial Cell Factories

    doi: 10.1186/s12934-018-0870-6

    Electrophoresis results of the construction of transgenic strains on a 1% agarose gel. A PCR products of target gene; B purified target gene from PCR products; C lane a: ppk +pEASY-Blunt vector; line b: ppk +pEASY-Blunt vector digested with Hin dIII and Kpn I restriction enzymes; line c: pSyn_1 vector; line d: pSyn_1 vector digested with Hin dIII and Kpn I restriction enzymes; D lane a: ppk +pSyn_1 vector; line b: ppk +pSyn_1 vector digested with Hin dIII or Kpn I restriction enzymes; line c: ppk +pSyn_1 vector digested with Hin dIII and Kpn I restriction enzymes; E PCR products from ppk -type strain plasmid (lane a and b); M in A , B , E was 5 Kb DNA Marker, in C , D was 1 Kb DNA Ladder
    Figure Legend Snippet: Electrophoresis results of the construction of transgenic strains on a 1% agarose gel. A PCR products of target gene; B purified target gene from PCR products; C lane a: ppk +pEASY-Blunt vector; line b: ppk +pEASY-Blunt vector digested with Hin dIII and Kpn I restriction enzymes; line c: pSyn_1 vector; line d: pSyn_1 vector digested with Hin dIII and Kpn I restriction enzymes; D lane a: ppk +pSyn_1 vector; line b: ppk +pSyn_1 vector digested with Hin dIII or Kpn I restriction enzymes; line c: ppk +pSyn_1 vector digested with Hin dIII and Kpn I restriction enzymes; E PCR products from ppk -type strain plasmid (lane a and b); M in A , B , E was 5 Kb DNA Marker, in C , D was 1 Kb DNA Ladder

    Techniques Used: Electrophoresis, Transgenic Assay, Agarose Gel Electrophoresis, Polymerase Chain Reaction, Purification, Plasmid Preparation, Marker

    12) Product Images from "A parallel panning scheme used for selection of a GluA4-specific Fab targeting the ligand-binding domain"

    Article Title: A parallel panning scheme used for selection of a GluA4-specific Fab targeting the ligand-binding domain

    Journal: International journal of biological macromolecules

    doi: 10.1016/j.ijbiomac.2016.07.026

    A) Cartoon overview of the iGluR receptor family . A dimer of dimer forms the active ion channel and both homomers and heteromers exist, dependent upon the receptor subtype assembly. The ectodomain comprises the amino-terminal domain (NTD) and the ligand-binding domain (LBD). Glutamate has high affinity for the LBD, and the binding leads to opening of an ion channel formed by the transmembrane domains (TMD). The carboxyl terminus is located in the cytoplasm, where it can interact with proteins of the postsynaptic density. B) Overview of the immunization and parallel panning scheme . A mouse was immunized i.p. biweekly four times with rat GluA4 ectodomain (containing both the NTD and LBD in one molecule). Mouse-spleen RNA was subsequently isolated and the Fab cassette was constructed by jumping PCR from amplified heavy and light chains and ligated into the pFab74 phagemid. Electrotransformation into TG1 E. coli cells yielded a library size of 2.2 × 10 7 . The panning procedure was performed in parallel using intact ectodomain and LBD respectively. This enabled us to isolate Fab fragments towards GluA4 subdomains. C) Detailed overview of the Pfab74 phagemid vector used in this study.
    Figure Legend Snippet: A) Cartoon overview of the iGluR receptor family . A dimer of dimer forms the active ion channel and both homomers and heteromers exist, dependent upon the receptor subtype assembly. The ectodomain comprises the amino-terminal domain (NTD) and the ligand-binding domain (LBD). Glutamate has high affinity for the LBD, and the binding leads to opening of an ion channel formed by the transmembrane domains (TMD). The carboxyl terminus is located in the cytoplasm, where it can interact with proteins of the postsynaptic density. B) Overview of the immunization and parallel panning scheme . A mouse was immunized i.p. biweekly four times with rat GluA4 ectodomain (containing both the NTD and LBD in one molecule). Mouse-spleen RNA was subsequently isolated and the Fab cassette was constructed by jumping PCR from amplified heavy and light chains and ligated into the pFab74 phagemid. Electrotransformation into TG1 E. coli cells yielded a library size of 2.2 × 10 7 . The panning procedure was performed in parallel using intact ectodomain and LBD respectively. This enabled us to isolate Fab fragments towards GluA4 subdomains. C) Detailed overview of the Pfab74 phagemid vector used in this study.

    Techniques Used: Ligand Binding Assay, Binding Assay, Isolation, Construct, Polymerase Chain Reaction, Amplification, Plasmid Preparation

    13) Product Images from "Genetic manipulation of Staphylococcus aureus"

    Article Title: Genetic manipulation of Staphylococcus aureus

    Journal: Current protocols in microbiology

    doi: 10.1002/9780471729259.mc09c03s32

    Map of transposon bursa aurealis and plasmids used for delivery along with summary of steps involved in the mapping of insertion sites by inverse PCR. (A) Bursa aurealis (3.2 kbp), a mini-mariner transposable element, was cloned into pTS2, with a temperature-sensitive plasmid replicon (rep ts ) and chloramphenicol resistance gene cat to generate pBursa (7,383 bp). Bursa aurealis encompasses mariner terminal inverted repeats (TIR), R6K replication origin (oriV) for replication in E. coli , and erythromycin-resistance determinant ermC , an rRNA methylase that allows selection in both E. coli and S. aureus . The position of the most terminal site for the restriction enzyme Aci I is indicated as well as the site of hybridization and nucleotide sequence of primer Martn-F (F). Plasmid pFA545 (10,079 bp) encodes the mariner transposase tnp and is a derivative of pSPT181, a shuttle vector consisting of pSP64 with ampicillin resistance ( bla ) for replication and selection in E. coli , and pRN8103, a temperature-sensitive derivative of pT181 (rep ts ) and tetracycline-resistance marker ( tetB tetD ). The presence of rep ts and tetBD allows for replication of pFA545 in S. aureus and other Gram-positive bacteria. (B) Mapping insertion sites by inverse PCR. Genome DNA from a candidate mutant strain is isolated and digested with Aci I. Next, fragment self-ligation and inverse PCR are performed using DNA ligase and primers Martn-F (F) and Martn-ermR (R). PCR products are subjected to DNA sequence analysis using primer Martn-F (F).
    Figure Legend Snippet: Map of transposon bursa aurealis and plasmids used for delivery along with summary of steps involved in the mapping of insertion sites by inverse PCR. (A) Bursa aurealis (3.2 kbp), a mini-mariner transposable element, was cloned into pTS2, with a temperature-sensitive plasmid replicon (rep ts ) and chloramphenicol resistance gene cat to generate pBursa (7,383 bp). Bursa aurealis encompasses mariner terminal inverted repeats (TIR), R6K replication origin (oriV) for replication in E. coli , and erythromycin-resistance determinant ermC , an rRNA methylase that allows selection in both E. coli and S. aureus . The position of the most terminal site for the restriction enzyme Aci I is indicated as well as the site of hybridization and nucleotide sequence of primer Martn-F (F). Plasmid pFA545 (10,079 bp) encodes the mariner transposase tnp and is a derivative of pSPT181, a shuttle vector consisting of pSP64 with ampicillin resistance ( bla ) for replication and selection in E. coli , and pRN8103, a temperature-sensitive derivative of pT181 (rep ts ) and tetracycline-resistance marker ( tetB tetD ). The presence of rep ts and tetBD allows for replication of pFA545 in S. aureus and other Gram-positive bacteria. (B) Mapping insertion sites by inverse PCR. Genome DNA from a candidate mutant strain is isolated and digested with Aci I. Next, fragment self-ligation and inverse PCR are performed using DNA ligase and primers Martn-F (F) and Martn-ermR (R). PCR products are subjected to DNA sequence analysis using primer Martn-F (F).

    Techniques Used: Inverse PCR, Clone Assay, Plasmid Preparation, Selection, Hybridization, Sequencing, Marker, Mutagenesis, Isolation, Ligation, Polymerase Chain Reaction

    14) Product Images from "Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13"

    Article Title: Use of an EZ-Tn5-Based Random Mutagenesis System to Identify a Novel Toxin Regulatory Locus in Clostridium perfringens Strain 13

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0006232

    Modification of the EZ-Tn 5 -encoding vector for random mutagenesis in C. perfringens . To allow selection of C. perfringens transformants after electroporation with the EZ-Tn 5 transposon, a C. perfringens erythromycin resistance determinant ( erm ) was cloned into the multiple cloning site in the Epicentre EZ-TN 5 -encoding pMOD-2 vector creating pJVTN5. This plasmid also contains PvuII-recognized sequences flanking the mosaic end (ME) sites, which are specifically recognized by the EZ-Tn 5 transposase.
    Figure Legend Snippet: Modification of the EZ-Tn 5 -encoding vector for random mutagenesis in C. perfringens . To allow selection of C. perfringens transformants after electroporation with the EZ-Tn 5 transposon, a C. perfringens erythromycin resistance determinant ( erm ) was cloned into the multiple cloning site in the Epicentre EZ-TN 5 -encoding pMOD-2 vector creating pJVTN5. This plasmid also contains PvuII-recognized sequences flanking the mosaic end (ME) sites, which are specifically recognized by the EZ-Tn 5 transposase.

    Techniques Used: Modification, Plasmid Preparation, Mutagenesis, Selection, Electroporation, Clone Assay

    15) Product Images from "LIGHT elevation enhances immune eradication of colon cancer metastases"

    Article Title: LIGHT elevation enhances immune eradication of colon cancer metastases

    Journal: Cancer research

    doi: 10.1158/0008-5472.CAN-16-1655

    LIGHT expressing tumors generated increased T-cell proliferation, a tumor-specific anti-tumor immune response, and significant T-cell mediated tumor regressions (A) Primary flank colorectal cancer cell tumors were established in BALB/c mice. Three weeks after tumor inoculation splenocytes were harvested (n=15). Mice with induced LIGHT expression (+ doxycycline diet) demonstrated increased numbers of CD3, CD4, CD8, and CD11c+ cells compared to CT26LIGHT i tumors fed normal diet and CT26control i tumors fed doxycycline diet. (B) Splenocytes from animals with established colon cancer flank tumors were then used as effector cells, and their cytolytic capacities were assessed against 51 Cr-labeled 4T1 cancer cells or wtCT26 tumor cells. Only lymphocytes from animals with LIGHT expressing CT26 tumors demonstrated tumor-specific cytotoxicity against wtCT26 and not 4T1 cells. (C) CT26LIGHT i colon cell tumors were established in animals fed normal diet (n=18) and once palpable and measurable, randomized on day 6 (arrow) to doxycycline diet (LIGHT induction) or normal diet. Significant tumor regression began only in animals with LIGHT induction and continued with partial and complete tumor responses as measured by total tumor volume, WHO criteria, and RECIST clinical tumor response criteria (pictured). (D) Lymphocyte depletion was performed of specific immunocyte subsets. CT26LIGHT i colon cell tumors were established in animals and on day 6 (arrow) received doxycycline diet (LIGHT induction) as before, confirming significant tumor regressions in animals with LIGHT induction. The anti-tumor immune response was abrogated in the absence of CD3 and CD8 T-lymphocytes.
    Figure Legend Snippet: LIGHT expressing tumors generated increased T-cell proliferation, a tumor-specific anti-tumor immune response, and significant T-cell mediated tumor regressions (A) Primary flank colorectal cancer cell tumors were established in BALB/c mice. Three weeks after tumor inoculation splenocytes were harvested (n=15). Mice with induced LIGHT expression (+ doxycycline diet) demonstrated increased numbers of CD3, CD4, CD8, and CD11c+ cells compared to CT26LIGHT i tumors fed normal diet and CT26control i tumors fed doxycycline diet. (B) Splenocytes from animals with established colon cancer flank tumors were then used as effector cells, and their cytolytic capacities were assessed against 51 Cr-labeled 4T1 cancer cells or wtCT26 tumor cells. Only lymphocytes from animals with LIGHT expressing CT26 tumors demonstrated tumor-specific cytotoxicity against wtCT26 and not 4T1 cells. (C) CT26LIGHT i colon cell tumors were established in animals fed normal diet (n=18) and once palpable and measurable, randomized on day 6 (arrow) to doxycycline diet (LIGHT induction) or normal diet. Significant tumor regression began only in animals with LIGHT induction and continued with partial and complete tumor responses as measured by total tumor volume, WHO criteria, and RECIST clinical tumor response criteria (pictured). (D) Lymphocyte depletion was performed of specific immunocyte subsets. CT26LIGHT i colon cell tumors were established in animals and on day 6 (arrow) received doxycycline diet (LIGHT induction) as before, confirming significant tumor regressions in animals with LIGHT induction. The anti-tumor immune response was abrogated in the absence of CD3 and CD8 T-lymphocytes.

    Techniques Used: Expressing, Generated, Mouse Assay, Labeling

    16) Product Images from "Modulation of Trehalose Dimycolate and Immune System by Rv0774c Protein Enhanced the Intracellular Survival of Mycobacterium smegmatis in Human Macrophages Cell Line"

    Article Title: Modulation of Trehalose Dimycolate and Immune System by Rv0774c Protein Enhanced the Intracellular Survival of Mycobacterium smegmatis in Human Macrophages Cell Line

    Journal: Frontiers in Cellular and Infection Microbiology

    doi: 10.3389/fcimb.2017.00289

    (A) Viability of THP-1 macrophages cell after infection. Viability assay showed that Ms_rv0774c has little effect at MOI of 10:1 and 20:1 for 24 h of infection, while significantly decreased viability was observed at higher MOI of 30:1, 40:1, 50:1, and 48 h of infection (B) Intracellular survival of Ms_ve and Ms_rv0774c . CFU counts at different time intervals after infection of THP-1 macrophages with Ms_ve or Ms_rv0774c at MOI values 10 and 20. Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( * P ≤ 0.05 and ** P ≤ 0.01).
    Figure Legend Snippet: (A) Viability of THP-1 macrophages cell after infection. Viability assay showed that Ms_rv0774c has little effect at MOI of 10:1 and 20:1 for 24 h of infection, while significantly decreased viability was observed at higher MOI of 30:1, 40:1, 50:1, and 48 h of infection (B) Intracellular survival of Ms_ve and Ms_rv0774c . CFU counts at different time intervals after infection of THP-1 macrophages with Ms_ve or Ms_rv0774c at MOI values 10 and 20. Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( * P ≤ 0.05 and ** P ≤ 0.01).

    Techniques Used: Infection, Viability Assay, Mass Spectrometry

    M. smegmatis expressing rv0774c has shown reduction in phosphorylation level of p38MAPK: After infection of activated THP-1 cells, the proteins were isolated, estimated, and immunoblotted by probing with the phosphorylated and unphosphorylated p38 antibody. Density of expressed proteins was quantified and expressed in relative change in phospho-p38 expression. Results shown as mean ± SD are the representation of three independent biological replicates. Statistical analysis was assessed using student's t -test ( ** P ≤ 0.05).
    Figure Legend Snippet: M. smegmatis expressing rv0774c has shown reduction in phosphorylation level of p38MAPK: After infection of activated THP-1 cells, the proteins were isolated, estimated, and immunoblotted by probing with the phosphorylated and unphosphorylated p38 antibody. Density of expressed proteins was quantified and expressed in relative change in phospho-p38 expression. Results shown as mean ± SD are the representation of three independent biological replicates. Statistical analysis was assessed using student's t -test ( ** P ≤ 0.05).

    Techniques Used: Expressing, Infection, Isolation

    Ms_rv0774c manipulates the production of anti and pro-inflammatory cytokines by THP-1 macrophage cells: THP-1 macrophage cells were infected with Ms_rv0774c or Ms_ve at an MOI of 20. Culture supernatants were harvested after 24 h of infection and the concentrations of IL-10 (A) , IL-12 (B) , IFN-γ (C) , TNF-α (D) , and MCP-1 (E) were measured by ELISA. Data shown as mean ± SD and representative of three independent biological replicates. Statistical analysis was assessed using student's t -test ( ** P ≤ 0.01 and *** P ≤ 0.001).
    Figure Legend Snippet: Ms_rv0774c manipulates the production of anti and pro-inflammatory cytokines by THP-1 macrophage cells: THP-1 macrophage cells were infected with Ms_rv0774c or Ms_ve at an MOI of 20. Culture supernatants were harvested after 24 h of infection and the concentrations of IL-10 (A) , IL-12 (B) , IFN-γ (C) , TNF-α (D) , and MCP-1 (E) were measured by ELISA. Data shown as mean ± SD and representative of three independent biological replicates. Statistical analysis was assessed using student's t -test ( ** P ≤ 0.01 and *** P ≤ 0.001).

    Techniques Used: Mass Spectrometry, Infection, Enzyme-linked Immunosorbent Assay

    IgG reactivity for serum samples of TB: LipY (A) and Rv0774c (B) . P-TB and EP-TB represent pulmonary and extra pulmonary TB. Experiments were performed three times in triplicates. Each dot represents mean OD of three individual experiments for individual patient. Statistical analysis was assessed using student's t -test.
    Figure Legend Snippet: IgG reactivity for serum samples of TB: LipY (A) and Rv0774c (B) . P-TB and EP-TB represent pulmonary and extra pulmonary TB. Experiments were performed three times in triplicates. Each dot represents mean OD of three individual experiments for individual patient. Statistical analysis was assessed using student's t -test.

    Techniques Used:

    Effect of expression of rv0774c on colony size, morphology, and its growth: colony size of the M. smegmatis expressing rv0774c ( Ms_rv0774c ) (A) and containing vector alone ( Ms_ve ) (B) . (C) Average diameter (mm) reflecting the size of Ms_rv0774c and Ms_ve on day 5 of incubation at 37°C. Colonies morphology (D) Ms_rv0774c (E) Ms_ve . Colony images were digitally captured by Phase Contrast Microscope (Olympus, USA). (F) Effect of rv0774c expression on growth curve of M. smegmatis : Ms_rv0774c has shown rapid growth in lag phase as compared to Ms_ve . Each dot represents mean OD of three individual experiments.
    Figure Legend Snippet: Effect of expression of rv0774c on colony size, morphology, and its growth: colony size of the M. smegmatis expressing rv0774c ( Ms_rv0774c ) (A) and containing vector alone ( Ms_ve ) (B) . (C) Average diameter (mm) reflecting the size of Ms_rv0774c and Ms_ve on day 5 of incubation at 37°C. Colonies morphology (D) Ms_rv0774c (E) Ms_ve . Colony images were digitally captured by Phase Contrast Microscope (Olympus, USA). (F) Effect of rv0774c expression on growth curve of M. smegmatis : Ms_rv0774c has shown rapid growth in lag phase as compared to Ms_ve . Each dot represents mean OD of three individual experiments.

    Techniques Used: Expressing, Mass Spectrometry, Plasmid Preparation, Incubation, Microscopy

    Effect of Rv0774c on drug susceptibility of M. smegmatis : (A) Mid log-phase M. smegmatis culture diluted in 7H9 medium without tween 80 and were treated with indicated concentrations of streptomycin. Resazurin dye in 20% tween 80 was added after 3 h of incubation with streptomycin, and the color change was monitored after 24 h. Pink color indicates live bacteria, while blue indicates dead bacteria (B) Survival of Ms_rv0774c and Ms_ve was monitored by counting the CFU/mL after treatment of streptomycin. Results were expressed in % survival (CFU counts without drug treatment was considered to be the 100% survival). Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( *** P ≤ 0.001).
    Figure Legend Snippet: Effect of Rv0774c on drug susceptibility of M. smegmatis : (A) Mid log-phase M. smegmatis culture diluted in 7H9 medium without tween 80 and were treated with indicated concentrations of streptomycin. Resazurin dye in 20% tween 80 was added after 3 h of incubation with streptomycin, and the color change was monitored after 24 h. Pink color indicates live bacteria, while blue indicates dead bacteria (B) Survival of Ms_rv0774c and Ms_ve was monitored by counting the CFU/mL after treatment of streptomycin. Results were expressed in % survival (CFU counts without drug treatment was considered to be the 100% survival). Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( *** P ≤ 0.001).

    Techniques Used: Incubation, Mass Spectrometry

    Modulation of mycolipids in Ms_rv0774c : Quantitative estimation of (A) total lipids, (B) polar and apolar lipids extracted from the equal weight of Ms_ve or Ms_rv0774c . (C) Mycolic acid containing glycolipids were separated from the pool of total polar lipids using CHCl 3 :CH 3 OH:NH 4 OH (80:20:2) as mobile phase. (D) TLC results were expressed in term of % relative density of myco-glycolipids measured by Image J programme. Given data are expressed in mean ± SD performed in two independent experiments. Statistical analysis was assessed using student's t -test ( * P ≤ 0.05).
    Figure Legend Snippet: Modulation of mycolipids in Ms_rv0774c : Quantitative estimation of (A) total lipids, (B) polar and apolar lipids extracted from the equal weight of Ms_ve or Ms_rv0774c . (C) Mycolic acid containing glycolipids were separated from the pool of total polar lipids using CHCl 3 :CH 3 OH:NH 4 OH (80:20:2) as mobile phase. (D) TLC results were expressed in term of % relative density of myco-glycolipids measured by Image J programme. Given data are expressed in mean ± SD performed in two independent experiments. Statistical analysis was assessed using student's t -test ( * P ≤ 0.05).

    Techniques Used: Mass Spectrometry, Thin Layer Chromatography

    (A) Measurement of NO secretion in THP-1 cells after infections of macrophages with Ms_ve or Ms_rv0774c for 24 h. (B) Transcript level of iNOS after infections was determined by qPCR. (C) The expression of TLR2 transcript was examined by real time PCR using specific primers after infection. (D) Expression of TLR2 was determined by western blot. Total proteins were isolated from THP-1 cells after infection. After electrophoresis the proteins were transferred onto nitrocellulose membrane and developed with antibodies against TLR2 and β-actin (internal control). Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( * P ≤ 0.05 and ** P ≤ 0.01).
    Figure Legend Snippet: (A) Measurement of NO secretion in THP-1 cells after infections of macrophages with Ms_ve or Ms_rv0774c for 24 h. (B) Transcript level of iNOS after infections was determined by qPCR. (C) The expression of TLR2 transcript was examined by real time PCR using specific primers after infection. (D) Expression of TLR2 was determined by western blot. Total proteins were isolated from THP-1 cells after infection. After electrophoresis the proteins were transferred onto nitrocellulose membrane and developed with antibodies against TLR2 and β-actin (internal control). Data are representative of three independent biological replicates and shown as mean ± SD . Statistical analysis was assessed using student's t -test ( * P ≤ 0.05 and ** P ≤ 0.01).

    Techniques Used: Mass Spectrometry, Real-time Polymerase Chain Reaction, Expressing, Infection, Western Blot, Isolation, Electrophoresis

    Green fluorescent protein expressed at 3′-end of rv0774c gene: (A) Image demonstrating the M. smegmatis expressing Rv0774c and GFP at c-terminal showing green fluorescence (B) Image taken without green fluorescence filter. (C) Expression of GFP in culture filtrate was measured by spectrofluorimetry. Green line represent fluorescence emission of culture filtrate protein of Rv0774c-GFP clone and gray line represent the GFP clone in vector alone.
    Figure Legend Snippet: Green fluorescent protein expressed at 3′-end of rv0774c gene: (A) Image demonstrating the M. smegmatis expressing Rv0774c and GFP at c-terminal showing green fluorescence (B) Image taken without green fluorescence filter. (C) Expression of GFP in culture filtrate was measured by spectrofluorimetry. Green line represent fluorescence emission of culture filtrate protein of Rv0774c-GFP clone and gray line represent the GFP clone in vector alone.

    Techniques Used: Expressing, Fluorescence, Plasmid Preparation

    17) Product Images from "Expression of NS3/NS4A Proteins of Hepatitis C Virus in Huh7 Cells Following Engineering Its Eukaryotic Expression Vector"

    Article Title: Expression of NS3/NS4A Proteins of Hepatitis C Virus in Huh7 Cells Following Engineering Its Eukaryotic Expression Vector

    Journal: Jundishapur Journal of Microbiology

    doi: 10.5812/jjm.27355

    Polymerase Chain Reaction and Restriction Enzyme Analysis A: PCR amplification of NS3/NS4A using specific primers, 1 kb DNA ladder (Vivantis, Malaysia). B: recombinant T/A cloning vector digested by BglII and SacII enzymes, showing the 2055 bp insert, 1 kb DNA ladder (Fermentas, Lithuania). C: pDisplay-NS3/NS4A plasmid digested by BglII and SacII enzymes, showing the 2055 bp insert, 1 kb DNA ladder (Fermentas, Lithuania).
    Figure Legend Snippet: Polymerase Chain Reaction and Restriction Enzyme Analysis A: PCR amplification of NS3/NS4A using specific primers, 1 kb DNA ladder (Vivantis, Malaysia). B: recombinant T/A cloning vector digested by BglII and SacII enzymes, showing the 2055 bp insert, 1 kb DNA ladder (Fermentas, Lithuania). C: pDisplay-NS3/NS4A plasmid digested by BglII and SacII enzymes, showing the 2055 bp insert, 1 kb DNA ladder (Fermentas, Lithuania).

    Techniques Used: Polymerase Chain Reaction, Amplification, Recombinant, Clone Assay, Plasmid Preparation

    18) Product Images from "Expression of Human CTP Synthetase in Saccharomyces cerevisiae Reveals Phosphorylation by Protein Kinase A *"

    Article Title: Expression of Human CTP Synthetase in Saccharomyces cerevisiae Reveals Phosphorylation by Protein Kinase A *

    Journal: The Journal of biological chemistry

    doi:

    Effects of protein kinase A activation on the phosphorylation of human CTP synthetase 1 and on the cellular concentration of CTP in S. cerevisiae . Panel A , cells expressing human CTP synthetase 1 (strain GHY55) were labeled with 32 P i for 3 h in low phosphate YEPA medium. Following the labeling period, glucose was added to a final concentration of 5% to activate the Ras-cAMP pathway and protein kinase A activity. Human CTP synthetase 1 was precipitated from lysates with Ni 2+ -NTA resin, followed by SDS-PAGE and transfer of proteins to PVDF membrane. The membrane was subjected to phosphorimaging and immunoblot analyses followed by the quantification of the signals using ImageQuant software. Relative phosphorylation was calculated by dividing the signal intensity of 32 P-labeled human CTP synthetase 1 by that of enzyme protein. The extent of phosphorylation of human CTP synthetase 1 before glucose addition was set at 1. Panel B , in a separate experiment, the cellular concentration of CTP was measured from unlabeled cells that were activated in the Ras-cAMP pathway. The data are representative of two independent experiments.
    Figure Legend Snippet: Effects of protein kinase A activation on the phosphorylation of human CTP synthetase 1 and on the cellular concentration of CTP in S. cerevisiae . Panel A , cells expressing human CTP synthetase 1 (strain GHY55) were labeled with 32 P i for 3 h in low phosphate YEPA medium. Following the labeling period, glucose was added to a final concentration of 5% to activate the Ras-cAMP pathway and protein kinase A activity. Human CTP synthetase 1 was precipitated from lysates with Ni 2+ -NTA resin, followed by SDS-PAGE and transfer of proteins to PVDF membrane. The membrane was subjected to phosphorimaging and immunoblot analyses followed by the quantification of the signals using ImageQuant software. Relative phosphorylation was calculated by dividing the signal intensity of 32 P-labeled human CTP synthetase 1 by that of enzyme protein. The extent of phosphorylation of human CTP synthetase 1 before glucose addition was set at 1. Panel B , in a separate experiment, the cellular concentration of CTP was measured from unlabeled cells that were activated in the Ras-cAMP pathway. The data are representative of two independent experiments.

    Techniques Used: Activation Assay, Concentration Assay, Expressing, Labeling, Activity Assay, SDS Page, Software

    Reaction catalyzed by CTP synthetase. The figure shows the structures of UTP and CTP and the reaction catalyzed by CTP synthetase.
    Figure Legend Snippet: Reaction catalyzed by CTP synthetase. The figure shows the structures of UTP and CTP and the reaction catalyzed by CTP synthetase.

    Techniques Used:

    Complementation of the CTP synthetase defect of the S. cerevisiae ura 7 Δ ura 8 Δ mutant by the human CTPS1 or CTPS2 gene. Strain SD195, a ura7 Δ ura8 Δ mutant carrying the URA7 gene on a URA3 -based plasmid (pDO134), was transformed to leucine prototrophy with the empty LEU2 -based plasmid (pDO105), or with the same plasmid containing the human CTP synthetase genes (pDO105-hCTPS1 or pDO105-hCTPS2). The transformants were streaked onto SC-leucine plates containing 5FOA and incubated for 3 days at 30 °C. The 5FOA-resistant colonies were produced only from the transformants carrying pDO105-hCTPS1 or pDO105-hCTPS2. Four independent colonies from 5FOA-resistant cells were patched onto SC-leucine plates and grown for 2 days at 30 °C. Strain SD195 carrying pDO105 was included in this analysis as a negative control. The patches were replica plated onto SC-leucine, SC-leucine + 5FOA, and SC-uracil plates. The plates were incubated for 3 days at 30 °C.
    Figure Legend Snippet: Complementation of the CTP synthetase defect of the S. cerevisiae ura 7 Δ ura 8 Δ mutant by the human CTPS1 or CTPS2 gene. Strain SD195, a ura7 Δ ura8 Δ mutant carrying the URA7 gene on a URA3 -based plasmid (pDO134), was transformed to leucine prototrophy with the empty LEU2 -based plasmid (pDO105), or with the same plasmid containing the human CTP synthetase genes (pDO105-hCTPS1 or pDO105-hCTPS2). The transformants were streaked onto SC-leucine plates containing 5FOA and incubated for 3 days at 30 °C. The 5FOA-resistant colonies were produced only from the transformants carrying pDO105-hCTPS1 or pDO105-hCTPS2. Four independent colonies from 5FOA-resistant cells were patched onto SC-leucine plates and grown for 2 days at 30 °C. Strain SD195 carrying pDO105 was included in this analysis as a negative control. The patches were replica plated onto SC-leucine, SC-leucine + 5FOA, and SC-uracil plates. The plates were incubated for 3 days at 30 °C.

    Techniques Used: Mutagenesis, Plasmid Preparation, Transformation Assay, Incubation, Produced, Negative Control

    Expression of human CTP synthetase 1 and human CTP synthetase 2 proteins in S. cerevisiae . The ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 (strain GHY55) or CTPS2 (strain GHY56) genes were grown to the exponential phase of growth. Cell extracts were prepared and samples (20 μg of protein) were subjected to SDS-PAGE, followed by transfer to PVDF membrane. The membrane was probed with anti-His 6 antibodies to detect the His 6 -tagged human CTP synthetase 1 ( hCTPS1 ) and human CTP synthetase 2 ( hCTPS2 ) proteins ( left ). The membrane was stripped of the anti-His 6 antibodies and reprobed with anti-Ura7p antibodies to detect the yeast URA7 -encoded CTP synthetase ( yCTPS ) protein ( middle ). Prior to probing with the antibodies, the PVDF membrane was stained with Ponceau S to detect the total amount of protein on the membrane ( right ). The data shown were representative of two independent experiments.
    Figure Legend Snippet: Expression of human CTP synthetase 1 and human CTP synthetase 2 proteins in S. cerevisiae . The ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 (strain GHY55) or CTPS2 (strain GHY56) genes were grown to the exponential phase of growth. Cell extracts were prepared and samples (20 μg of protein) were subjected to SDS-PAGE, followed by transfer to PVDF membrane. The membrane was probed with anti-His 6 antibodies to detect the His 6 -tagged human CTP synthetase 1 ( hCTPS1 ) and human CTP synthetase 2 ( hCTPS2 ) proteins ( left ). The membrane was stripped of the anti-His 6 antibodies and reprobed with anti-Ura7p antibodies to detect the yeast URA7 -encoded CTP synthetase ( yCTPS ) protein ( middle ). Prior to probing with the antibodies, the PVDF membrane was stained with Ponceau S to detect the total amount of protein on the membrane ( right ). The data shown were representative of two independent experiments.

    Techniques Used: Expressing, Mutagenesis, SDS Page, Staining

    CTP synthetase activities and the synthesis of CTP in S. cerevisiae expressing human CTP synthetase 1 and human CTP synthetase 2. The ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 (strain GHY55) or CTPS2 (strain GHY56) genes were grown to the exponential phase of growth. Panel A , The cytosolic fraction was isolated from the cells and assayed for CTP synthetase activity from the indicated yeast ( yCTPS ) or human CTP synthetase 1 ( hCTPS1 ) and CTP synthetase 2 ( hCTPS2 ) enzymes. Panel B , CTP was extracted from the cells and analyzed by high performance liquid chromatography. Each data point represents the average of duplicate determinations from two independent experiments ± S.D.
    Figure Legend Snippet: CTP synthetase activities and the synthesis of CTP in S. cerevisiae expressing human CTP synthetase 1 and human CTP synthetase 2. The ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 (strain GHY55) or CTPS2 (strain GHY56) genes were grown to the exponential phase of growth. Panel A , The cytosolic fraction was isolated from the cells and assayed for CTP synthetase activity from the indicated yeast ( yCTPS ) or human CTP synthetase 1 ( hCTPS1 ) and CTP synthetase 2 ( hCTPS2 ) enzymes. Panel B , CTP was extracted from the cells and analyzed by high performance liquid chromatography. Each data point represents the average of duplicate determinations from two independent experiments ± S.D.

    Techniques Used: Expressing, Mutagenesis, Isolation, Activity Assay, High Performance Liquid Chromatography

    Phosphorylation of E. coli -expressed human CTP synthetase 1 by protein kinase A. Panel A , pure human CTP synthetase 1 (1 μg) was incubated with [γ- 32 P]ATP (50 μM) and the indicated amounts of protein kinase A for 10 min. Panel B , pure human CTP synthetase 1 (1 μg) was incubated with protein kinase A (1 U/ml) and [γ- 32 P]ATP (50 μM) for the indicated time intervals. Panel C , protein kinase A (1 U/ml) and [γ- 32 P]ATP (50 μM) were incubated with the indicated concentrations of pure human CTP synthetase 1 for 10 min. Panel D , protein kinase A (1 U/ml) and pure human CTP synthetase 1 (1 μg) were incubated with the indicated concentrations of [γ- 32 P]ATP for 10 min. Following the phosphorylation reactions, samples were subjected to SDS-PAGE. The SDS polyacrylamide gels were dried and the phosphorylated proteins were subjected to phosphorimaging analysis. The relative amounts of phosphate incorporated into human CTP synthetase 1 were quantified using ImageQuant software. Portions of the images with the phosphorylated human CTP synthetase 1 are shown above each graph. The data are representative of two independent experiments.
    Figure Legend Snippet: Phosphorylation of E. coli -expressed human CTP synthetase 1 by protein kinase A. Panel A , pure human CTP synthetase 1 (1 μg) was incubated with [γ- 32 P]ATP (50 μM) and the indicated amounts of protein kinase A for 10 min. Panel B , pure human CTP synthetase 1 (1 μg) was incubated with protein kinase A (1 U/ml) and [γ- 32 P]ATP (50 μM) for the indicated time intervals. Panel C , protein kinase A (1 U/ml) and [γ- 32 P]ATP (50 μM) were incubated with the indicated concentrations of pure human CTP synthetase 1 for 10 min. Panel D , protein kinase A (1 U/ml) and pure human CTP synthetase 1 (1 μg) were incubated with the indicated concentrations of [γ- 32 P]ATP for 10 min. Following the phosphorylation reactions, samples were subjected to SDS-PAGE. The SDS polyacrylamide gels were dried and the phosphorylated proteins were subjected to phosphorimaging analysis. The relative amounts of phosphate incorporated into human CTP synthetase 1 were quantified using ImageQuant software. Portions of the images with the phosphorylated human CTP synthetase 1 are shown above each graph. The data are representative of two independent experiments.

    Techniques Used: Incubation, SDS Page, Software

    Phosphorylation of human CTP synthetase 1 in S. cerevisiae. Panel A , the ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 gene (strain GHY55) was grown in 50 ml of growth medium to the exponential phase of growth. Cells were harvested, resuspended in 5 ml of fresh medium containing 32 P i (0.25 mCi/ml), and incubated for 3 h. Cell extracts were prepared from the labeled cells and incubated with Ni 2+ -NTA resin to bind the His 6 -tagged human CTP synthetase 1. Proteins bound to the Ni 2+ -NTA resin were eluted with SDS-PAGE treatment buffer, followed by electrophoresis and transfer to PVDF membrane. The membrane was subjected to phosphorimaging ( left ) followed by immunoblot analysis using anti-His 6 antibodies ( right ). The arrow indicates the position of human CTP synthetase 1 ( hCTPS1 ). Panel B , a PVDF membrane slice containing 32 P-labeled human CTP synthetase 1 was hydrolyzed with 6N HCl for 90 min at 110 °C, and the hydrolysate was separated by 2-dimensional electrophoresis. The positions of the standard phosphoamino acids phosphoserine ( P-Ser ), phosphothreonine ( P-Thr ), and phosphotyrosine ( P-Tyr ) are indicated in the figure. Panel C , a PVDF membrane slice containing 32 P-labeled human CTP synthetase 1 was digested with trypsin. The resulting peptides were separated on cellulose thin layer plates by electrophoresis (from left to right ) in the first dimension and by chromatography (from bottom to top ) in the second dimension. The data shown in the three panels were representative of two independent experiments.
    Figure Legend Snippet: Phosphorylation of human CTP synthetase 1 in S. cerevisiae. Panel A , the ura7 Δ ura8 Δ mutant bearing plasmids with the yeast URA7 gene (strain GHY52) or the human CTPS1 gene (strain GHY55) was grown in 50 ml of growth medium to the exponential phase of growth. Cells were harvested, resuspended in 5 ml of fresh medium containing 32 P i (0.25 mCi/ml), and incubated for 3 h. Cell extracts were prepared from the labeled cells and incubated with Ni 2+ -NTA resin to bind the His 6 -tagged human CTP synthetase 1. Proteins bound to the Ni 2+ -NTA resin were eluted with SDS-PAGE treatment buffer, followed by electrophoresis and transfer to PVDF membrane. The membrane was subjected to phosphorimaging ( left ) followed by immunoblot analysis using anti-His 6 antibodies ( right ). The arrow indicates the position of human CTP synthetase 1 ( hCTPS1 ). Panel B , a PVDF membrane slice containing 32 P-labeled human CTP synthetase 1 was hydrolyzed with 6N HCl for 90 min at 110 °C, and the hydrolysate was separated by 2-dimensional electrophoresis. The positions of the standard phosphoamino acids phosphoserine ( P-Ser ), phosphothreonine ( P-Thr ), and phosphotyrosine ( P-Tyr ) are indicated in the figure. Panel C , a PVDF membrane slice containing 32 P-labeled human CTP synthetase 1 was digested with trypsin. The resulting peptides were separated on cellulose thin layer plates by electrophoresis (from left to right ) in the first dimension and by chromatography (from bottom to top ) in the second dimension. The data shown in the three panels were representative of two independent experiments.

    Techniques Used: Mutagenesis, Incubation, Labeling, SDS Page, Electrophoresis, Chromatography

    19) Product Images from "An amphipathic alpha-helical peptide from Apolipoprotein A1 stabilizes protein polymer vesicles"

    Article Title: An amphipathic alpha-helical peptide from Apolipoprotein A1 stabilizes protein polymer vesicles

    Journal: Journal of controlled release : official journal of the Controlled Release Society

    doi: 10.1016/j.jconrel.2014.07.003

    Fusion to the L4F peptide mediates nanostructure assembly
    Figure Legend Snippet: Fusion to the L4F peptide mediates nanostructure assembly

    Techniques Used:

    Fusion of the L4F peptide depresses the ELP transition temperature
    Figure Legend Snippet: Fusion of the L4F peptide depresses the ELP transition temperature

    Techniques Used:

    L4F nanoparticles prevent hepatic stellate cell activation
    Figure Legend Snippet: L4F nanoparticles prevent hepatic stellate cell activation

    Techniques Used: Activation Assay

    L4F-A192 nanoparticles inhibit activation of hepatic stellate cells (HSCs)
    Figure Legend Snippet: L4F-A192 nanoparticles inhibit activation of hepatic stellate cells (HSCs)

    Techniques Used: Activation Assay

    The nanostructures formed by L4F fusions are peptide vesicles
    Figure Legend Snippet: The nanostructures formed by L4F fusions are peptide vesicles

    Techniques Used:

    Construction of L4F ELP fusions
    Figure Legend Snippet: Construction of L4F ELP fusions

    Techniques Used:

    Pharmacokinetics of L4F-A192 nanoparticles and free L4F do not differ significantly
    Figure Legend Snippet: Pharmacokinetics of L4F-A192 nanoparticles and free L4F do not differ significantly

    Techniques Used:

    20) Product Images from "Characterization of a temperature-responsive two component regulatory system from the Antarctic archaeon, Methanococcoides burtonii"

    Article Title: Characterization of a temperature-responsive two component regulatory system from the Antarctic archaeon, Methanococcoides burtonii

    Journal: Scientific Reports

    doi: 10.1038/srep24278

    Protein domains and structures predicted for LtrK and LtrR. ( a ) Schematic of LtrK and LtrR protein domains and sequence motifs drawn to scale. Protein domains identified using Pfam and NCBI BLAST (blue arrow boxes); predicted TMDs (hatched regions); H, N, G1, F, G2 and G3 blocks (white boxes) diagnostic of TCS histidine kinases 83 84 ; specific histidine residues H367 (H1), H443 (H2), H448 (H3), H502 (H4) of LtrK; specific aspartate residues D54 (D1), D55 (D2) and D98 (D3) of LtrR. ( b ) Homology model of the cytoplasmic domain of LtrK constructed using I-TASSER 78 . Only one subunit of the LtrK dimer is shown. The model with the highest confidence score best aligned with the structure of VicK (PDB 4I5S), a TCS SK from Streptococcus mutans , which has 37% sequence identity to the cytoplasmic domain of LtrK. The HisKA domain includes the α1 and α2 helices. The α1 helix contains the conserved H367 (red) and E368 (green) residues of the H block. The α4 helix (HATPase domain) contains the conserved N480 (orange) and R476 (blue) residues of the N block. A catalytic triad involved in autophosphorylation 45 46 is formed by R476 (blue), E368 (green) and N480 (orange). The α3 helix (between the HisKA and HATPase domains) contains the additional histidine residues H443 and H448 (magenta).
    Figure Legend Snippet: Protein domains and structures predicted for LtrK and LtrR. ( a ) Schematic of LtrK and LtrR protein domains and sequence motifs drawn to scale. Protein domains identified using Pfam and NCBI BLAST (blue arrow boxes); predicted TMDs (hatched regions); H, N, G1, F, G2 and G3 blocks (white boxes) diagnostic of TCS histidine kinases 83 84 ; specific histidine residues H367 (H1), H443 (H2), H448 (H3), H502 (H4) of LtrK; specific aspartate residues D54 (D1), D55 (D2) and D98 (D3) of LtrR. ( b ) Homology model of the cytoplasmic domain of LtrK constructed using I-TASSER 78 . Only one subunit of the LtrK dimer is shown. The model with the highest confidence score best aligned with the structure of VicK (PDB 4I5S), a TCS SK from Streptococcus mutans , which has 37% sequence identity to the cytoplasmic domain of LtrK. The HisKA domain includes the α1 and α2 helices. The α1 helix contains the conserved H367 (red) and E368 (green) residues of the H block. The α4 helix (HATPase domain) contains the conserved N480 (orange) and R476 (blue) residues of the N block. A catalytic triad involved in autophosphorylation 45 46 is formed by R476 (blue), E368 (green) and N480 (orange). The α3 helix (between the HisKA and HATPase domains) contains the additional histidine residues H443 and H448 (magenta).

    Techniques Used: Sequencing, Diagnostic Assay, Construct, Blocking Assay

    21) Product Images from "An RNA-Seq Strategy to Detect the Complete Coding and Non-Coding Transcriptome Including Full-Length Imprinted Macro ncRNAs"

    Article Title: An RNA-Seq Strategy to Detect the Complete Coding and Non-Coding Transcriptome Including Full-Length Imprinted Macro ncRNAs

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0027288

    Optimisation and reproducibility of ribo-depleted RNA-Seq. ( A ) Distribution of different sequence tag types from RNA prepared from CCE differentiated ES cells subject to ribosomal RNA depletion using either the RiboMinus or the Ribo-Zero Kit and fragmented either by RNA-hydrolysis or by cDNA-shearing. Sequencing was performed in two different sequencing locations (Vienna-IMP, Nijmegen, RiboMinus) or in one sequencing location (Vienna-CeMM, Ribo-Zero). The percentage of tags in each category is shown for two technical sequencing replicates (CCE1, CCE2) of material prepared by RiboMinus and cDNA-shearing (sheared, lanes nr. 1,2,5,6) or RiboMinus and RNA-hydrolysis (hydrolysed, lanes nr. 3,4,7,8), for the combination of three technical sequencing replicates of RiboMinus and RNA-hydrolysis (lane nr. 9) and for one sequencing of Ribo-Zero and RNA-hydrolysis (lane nr. 10). green: unique tags matching only once in the genome; blue: rRNA+mitoRNA tags matching to ribosomal (RiboMinus and Ribo-Zero) or mitochondrial (RiboMinus) RNAs; red: repeat tags matching more than once in the genome; purple: nomatch tags do not match to the genome. ( B ) Scatter plots comparing the RPKM ( R eads P er K ilobase of exon model per M illion of reads) transcription levels of RefSeq protein-coding genes between combined tags from RiboMinus and RNA-hydrolysis (H) and RiboMinus and cDNA-shearing (S) from CCE within the same location: Vienna-IMP (left) and Nijmegen (right). ( C ) Scatter plots as in B comparing RPKM transcript levels of all combined tags from the two sequencing locations (Vienna-IMP and Nijmegen, left) or between the combined RiboMinus data and the Ribo-Zero data (right). R: Pearson's correlation, note that a perfect correlation is R = 1.
    Figure Legend Snippet: Optimisation and reproducibility of ribo-depleted RNA-Seq. ( A ) Distribution of different sequence tag types from RNA prepared from CCE differentiated ES cells subject to ribosomal RNA depletion using either the RiboMinus or the Ribo-Zero Kit and fragmented either by RNA-hydrolysis or by cDNA-shearing. Sequencing was performed in two different sequencing locations (Vienna-IMP, Nijmegen, RiboMinus) or in one sequencing location (Vienna-CeMM, Ribo-Zero). The percentage of tags in each category is shown for two technical sequencing replicates (CCE1, CCE2) of material prepared by RiboMinus and cDNA-shearing (sheared, lanes nr. 1,2,5,6) or RiboMinus and RNA-hydrolysis (hydrolysed, lanes nr. 3,4,7,8), for the combination of three technical sequencing replicates of RiboMinus and RNA-hydrolysis (lane nr. 9) and for one sequencing of Ribo-Zero and RNA-hydrolysis (lane nr. 10). green: unique tags matching only once in the genome; blue: rRNA+mitoRNA tags matching to ribosomal (RiboMinus and Ribo-Zero) or mitochondrial (RiboMinus) RNAs; red: repeat tags matching more than once in the genome; purple: nomatch tags do not match to the genome. ( B ) Scatter plots comparing the RPKM ( R eads P er K ilobase of exon model per M illion of reads) transcription levels of RefSeq protein-coding genes between combined tags from RiboMinus and RNA-hydrolysis (H) and RiboMinus and cDNA-shearing (S) from CCE within the same location: Vienna-IMP (left) and Nijmegen (right). ( C ) Scatter plots as in B comparing RPKM transcript levels of all combined tags from the two sequencing locations (Vienna-IMP and Nijmegen, left) or between the combined RiboMinus data and the Ribo-Zero data (right). R: Pearson's correlation, note that a perfect correlation is R = 1.

    Techniques Used: RNA Sequencing Assay, Sequencing

    The template preparation protocol determines the comparability of ribo-depleted RNA-Seq to polyA RNA-Seq. The cDNA size distribution of genes showing more than 8× expression difference ( Figure S2 ), in the comparison of ( A ) FH RiboMinus - FH-RiboZero (left) and CCE RiboMinus - CCE Ribo-Zero (right). ( B ) as in A for the comparisons of CCE RiboMinus-Cloonan et al. EB (left), FH RiboMinus-Cui et al. adult mouse brain polyA (middle) and FH RiboMinus-Mortazavi et al. adult mouse brain polyA (right). ( C ) as in A for the comparisons of CCE Ribo-Zero-Cloonan et al. EB (left), FH Ribo-Zero-Cui et al. adult mouse brain polyA (middle) and FH Ribo-Zero-Mortazavi et al. adult mouse brain polyA (right). For Cloonan et al. EB both the gene expression data from the published alignment (shown in B, C, see Materials and methods ) and from an alignment done with the pipeline used here (data not shown) were used and produced the same highly significant differences. Two different size classes are shown with different bin sizes (0–2 kb, 100 bp bins and > 2 kb, 500 bp bins). Genes bigger than 11.5 kb are grouped in the last bin (arrow).
    Figure Legend Snippet: The template preparation protocol determines the comparability of ribo-depleted RNA-Seq to polyA RNA-Seq. The cDNA size distribution of genes showing more than 8× expression difference ( Figure S2 ), in the comparison of ( A ) FH RiboMinus - FH-RiboZero (left) and CCE RiboMinus - CCE Ribo-Zero (right). ( B ) as in A for the comparisons of CCE RiboMinus-Cloonan et al. EB (left), FH RiboMinus-Cui et al. adult mouse brain polyA (middle) and FH RiboMinus-Mortazavi et al. adult mouse brain polyA (right). ( C ) as in A for the comparisons of CCE Ribo-Zero-Cloonan et al. EB (left), FH Ribo-Zero-Cui et al. adult mouse brain polyA (middle) and FH Ribo-Zero-Mortazavi et al. adult mouse brain polyA (right). For Cloonan et al. EB both the gene expression data from the published alignment (shown in B, C, see Materials and methods ) and from an alignment done with the pipeline used here (data not shown) were used and produced the same highly significant differences. Two different size classes are shown with different bin sizes (0–2 kb, 100 bp bins and > 2 kb, 500 bp bins). Genes bigger than 11.5 kb are grouped in the last bin (arrow).

    Techniques Used: RNA Sequencing Assay, Expressing, Produced

    Tag coverage of genes differs between fragmentation methods and ribosomal RNA depletion methods. The coverage of genes with sequence tags is shown as the normalized number of tags at relative positions throughout the gene length. UTRs and coding exons were analysed separately and are plotted as 10 bins for 5′UTRs and 3′UTRs and 100bins for the coding exons (separated by vertical dotted line). ( A ) Comparison of the coverage in the RiboMinus dataset for the combined tags of CCE and FH from RNA-hydrolysis (black) and cDNA-shearing (grey). ( B ) Comparison of the coverage in the RNA-hydrolysis RiboMinus dataset (dotted line, same as in A) and in Ribo-Zero dataset plotted separately for CCE (black) and FH (grey). For all analyses the genes were separated into three groups according to their cDNA length (coding exons and 5′ and 3′ UTRs) as indicated.
    Figure Legend Snippet: Tag coverage of genes differs between fragmentation methods and ribosomal RNA depletion methods. The coverage of genes with sequence tags is shown as the normalized number of tags at relative positions throughout the gene length. UTRs and coding exons were analysed separately and are plotted as 10 bins for 5′UTRs and 3′UTRs and 100bins for the coding exons (separated by vertical dotted line). ( A ) Comparison of the coverage in the RiboMinus dataset for the combined tags of CCE and FH from RNA-hydrolysis (black) and cDNA-shearing (grey). ( B ) Comparison of the coverage in the RNA-hydrolysis RiboMinus dataset (dotted line, same as in A) and in Ribo-Zero dataset plotted separately for CCE (black) and FH (grey). For all analyses the genes were separated into three groups according to their cDNA length (coding exons and 5′ and 3′ UTRs) as indicated.

    Techniques Used: Sequencing

    22) Product Images from "The Expression, Purification, and Characterization of a Ras Oncogene (Bras2) in Silkworm (Bombyx mori)"

    Article Title: The Expression, Purification, and Characterization of a Ras Oncogene (Bras2) in Silkworm (Bombyx mori)

    Journal: International Journal of Genomics

    doi: 10.1155/2013/269609

    Distribution of BmBras2 in different fifth instar larvae tissues. (a) tissue distributions of BmBras2 by western blotting; 1, head; 2, intestine; 3, epidermis; 4, silk gland; 5, fat body; 6, malpighian tubule; 7, ovaries; 8, testis; 9, purified rBmBras2. (b) tissue distributions of BmBras2 analyzed by real-time PCR. Sg, silk gland; Fb, fat body; Mt, malpighian tubule. The relative expression level was calculated by using 2 −ΔΔCT here ΔΔCT = (CT, BmBras2 -CT, 18S rRNA) for different tissues and (CT, BmBras2 -CT, 18S rRNA) fat body.
    Figure Legend Snippet: Distribution of BmBras2 in different fifth instar larvae tissues. (a) tissue distributions of BmBras2 by western blotting; 1, head; 2, intestine; 3, epidermis; 4, silk gland; 5, fat body; 6, malpighian tubule; 7, ovaries; 8, testis; 9, purified rBmBras2. (b) tissue distributions of BmBras2 analyzed by real-time PCR. Sg, silk gland; Fb, fat body; Mt, malpighian tubule. The relative expression level was calculated by using 2 −ΔΔCT here ΔΔCT = (CT, BmBras2 -CT, 18S rRNA) for different tissues and (CT, BmBras2 -CT, 18S rRNA) fat body.

    Techniques Used: Western Blot, Purification, Real-time Polymerase Chain Reaction, Expressing

    Subcellular localization of BmBras2. (a) Negative result amplified by 40 × 2.5; (b) positive result amplified by 40 × 2.5; 1, visible light images; 2, DAPI fluorescence images; 3, Cy3 fluorescence images; 4, mixed images.
    Figure Legend Snippet: Subcellular localization of BmBras2. (a) Negative result amplified by 40 × 2.5; (b) positive result amplified by 40 × 2.5; 1, visible light images; 2, DAPI fluorescence images; 3, Cy3 fluorescence images; 4, mixed images.

    Techniques Used: Amplification, Fluorescence

    (a) The expression and purification of recombinant BmBras2 were analyzed by SDS-PAGE. (b) The expression and purification of recombinant BmBras2 were analyzed by Western blotting. M, protein mass marker; 1, purified recombinant protein by Ni-NTA superflow cartridges; 2, the lysate of E. coli Rosetta with pET-28a (+)- BmBras2 without induction; 3, the lysate of E. coli Rosetta with pET-28a (+)- BmBras2 after IPTG induction. (c) The lysate of Bm5 was analyzed by SDS-PAGE. (d) The Bm5 cells were collected for western bolt with anti-BmBras2. (Bm5 cells were seeded at 1 × 10 5 cells per flask in culture flask and cultured for three days at 37°C in a 5% CO 2 incubator.) M, protein mass marker; 1, the lysate of Bm5 cells.
    Figure Legend Snippet: (a) The expression and purification of recombinant BmBras2 were analyzed by SDS-PAGE. (b) The expression and purification of recombinant BmBras2 were analyzed by Western blotting. M, protein mass marker; 1, purified recombinant protein by Ni-NTA superflow cartridges; 2, the lysate of E. coli Rosetta with pET-28a (+)- BmBras2 without induction; 3, the lysate of E. coli Rosetta with pET-28a (+)- BmBras2 after IPTG induction. (c) The lysate of Bm5 was analyzed by SDS-PAGE. (d) The Bm5 cells were collected for western bolt with anti-BmBras2. (Bm5 cells were seeded at 1 × 10 5 cells per flask in culture flask and cultured for three days at 37°C in a 5% CO 2 incubator.) M, protein mass marker; 1, the lysate of Bm5 cells.

    Techniques Used: Expressing, Purification, Recombinant, SDS Page, Western Blot, Marker, Positron Emission Tomography, Cell Culture

    The expression analysis of BmBras2 during different silkworm developmental stages. (a) The expression levels of BmBras2 by western blotting; 1, fifth instar larvae; 2, pupae; 3, moth; 4, egg; 5, purified rBmBras2. (b) The relative expression levels of BmBras2 analyzed by real-time PCR. The relative expression level was calculated by using 2 −ΔΔCT , where ΔΔCT = (CT, BmBras2 -CT, 18S rRNA) for different stages and (CT, BmBras2 -CT, 18S rRNA) pupae.
    Figure Legend Snippet: The expression analysis of BmBras2 during different silkworm developmental stages. (a) The expression levels of BmBras2 by western blotting; 1, fifth instar larvae; 2, pupae; 3, moth; 4, egg; 5, purified rBmBras2. (b) The relative expression levels of BmBras2 analyzed by real-time PCR. The relative expression level was calculated by using 2 −ΔΔCT , where ΔΔCT = (CT, BmBras2 -CT, 18S rRNA) for different stages and (CT, BmBras2 -CT, 18S rRNA) pupae.

    Techniques Used: Expressing, Western Blot, Purification, Real-time Polymerase Chain Reaction

    (a) Alignment of amino acid sequence of BmBras2 with members of the R-Ras superfamily from Homo sapiens . BmBras2 shares 69% of its amino acid identity with R-Ras, 77% with TC21 (R-Ras2) and 59% with M-Ras (R-Ras3). (b) Alignment of BmBras2 amino acid sequence with homologous proteins from different species.
    Figure Legend Snippet: (a) Alignment of amino acid sequence of BmBras2 with members of the R-Ras superfamily from Homo sapiens . BmBras2 shares 69% of its amino acid identity with R-Ras, 77% with TC21 (R-Ras2) and 59% with M-Ras (R-Ras3). (b) Alignment of BmBras2 amino acid sequence with homologous proteins from different species.

    Techniques Used: Sequencing

    23) Product Images from "A bacterial reporter panel for the detection and classification of antibiotic substances"

    Article Title: A bacterial reporter panel for the detection and classification of antibiotic substances

    Journal: Microbial biotechnology

    doi: 10.1111/j.1751-7915.2012.00333.x

    Plasmids pBR2TTS (A) and pBRlux‐trp (B) with the relevant restriction sites. (C) Plasmid pBRlux‐trp restores the ability of the E. coli Δ trpE strain (SM335) to grow on a tryptophan‐free medium (bottom), where the E. coli Δ trpE strain (SM301) does not grow (top).
    Figure Legend Snippet: Plasmids pBR2TTS (A) and pBRlux‐trp (B) with the relevant restriction sites. (C) Plasmid pBRlux‐trp restores the ability of the E. coli Δ trpE strain (SM335) to grow on a tryptophan‐free medium (bottom), where the E. coli Δ trpE strain (SM301) does not grow (top).

    Techniques Used: Plasmid Preparation

    24) Product Images from "Infectious alphavirus production from a simple plasmid transfection+"

    Article Title: Infectious alphavirus production from a simple plasmid transfection+

    Journal: Virology Journal

    doi: 10.1186/1743-422X-8-356

    Plasmid constructs . The full-length double subgenomic Sindbis genome TE3'2J was engineered behind a cytomegalovirus promoter (CMV), and a 3' hepatitis delta virus ribozyme (HDV) was added after a 35 base adenine repeat (A35) to cleave the viral RNA from the over length transcript. pBG167 possess a unique XbaI site after the second SGP, and is analogous to pTE3'2J [ 17 ]. pBG218 is pBG167 with GFP inserted at XbaI site via ligation between the unique XbaI site in pBG167 and engineered NheI sites flanking the GFP ORF. pBG210 and pBG211 have the attR1/attR2 Gateway Recombination Cassettes ligated into the pBG167 XbaI site in forward and reverse orientation, respectively. pBG212 is the product of a LR Clonase reaction between pBG210 and pBG440 and places GFP in the sense orientation. pBG213 is a recombination between pBG211 and pBG440, and places GFP in the reverse orientation. pBG451 is the product of a recombination between pBG210 and pBG403, and places Renilla luciferase in the sense orientation. pBG452 is the product of a recombination between pBG210 and pBG344 and places mCherry in the sense orientation.
    Figure Legend Snippet: Plasmid constructs . The full-length double subgenomic Sindbis genome TE3'2J was engineered behind a cytomegalovirus promoter (CMV), and a 3' hepatitis delta virus ribozyme (HDV) was added after a 35 base adenine repeat (A35) to cleave the viral RNA from the over length transcript. pBG167 possess a unique XbaI site after the second SGP, and is analogous to pTE3'2J [ 17 ]. pBG218 is pBG167 with GFP inserted at XbaI site via ligation between the unique XbaI site in pBG167 and engineered NheI sites flanking the GFP ORF. pBG210 and pBG211 have the attR1/attR2 Gateway Recombination Cassettes ligated into the pBG167 XbaI site in forward and reverse orientation, respectively. pBG212 is the product of a LR Clonase reaction between pBG210 and pBG440 and places GFP in the sense orientation. pBG213 is a recombination between pBG211 and pBG440, and places GFP in the reverse orientation. pBG451 is the product of a recombination between pBG210 and pBG403, and places Renilla luciferase in the sense orientation. pBG452 is the product of a recombination between pBG210 and pBG344 and places mCherry in the sense orientation.

    Techniques Used: Plasmid Preparation, Construct, Ligation, Luciferase

    25) Product Images from "Design, Recombinant Fusion Expression and Biological Evaluation of Vasoactive Intestinal Peptide Analogue as Novel Antimicrobial Agent"

    Article Title: Design, Recombinant Fusion Expression and Biological Evaluation of Vasoactive Intestinal Peptide Analogue as Novel Antimicrobial Agent

    Journal: Molecules : A Journal of Synthetic Chemistry and Natural Product Chemistry

    doi: 10.3390/molecules22111963

    Expression, purification and identification of recombinant VIP analogue 8. ( A ) Expression of pET32a-VIP8 fusion protein analysed by SDS-PAGE. lane M: protein molecular mass marker; lane 1: un-induced BL21(DE3)-pET32a-VIP8; lane 2: induced BL21(DE3)-pET32a-VIP8 by isopropyl-β- d -thiogalactoside; lane 3: supernatant of bacterial lysate; lane 4: precipitation of bacterial lysate; ( B ) Purification of pET32a-VIP8 fusion protein by BeaverBeads TM His-tag Protein Purification kit; lane M: protein molecular mass marker; lane 1: induced whole BL21(DE3)-pET32a-VIP8 protein; lane 2: supernatant of bacterial lysate; and lane 3: purified pET-32a-VIP8 fusion protein; ( C ) Effect of post-induction time on the expression of BL21(DE3)-pET32a-VIP8 protein; lane M: protein molecular marker; lane 1: un-induced BL21(DE3)-pET32a-VIP8; lane 2, 3, 4, 5: induced BL21(DE3)-pET32a-VIP8 by isopropyl-β- d -thiogalactoside for 2, 4, 8, and 20 h respectively; ( D ) A 12% Tricine-SDS-PAGE analysis of the cleavage reaction and purification of the recombinant VIP8. Lane M: low protein molecular weight standard; lane 1: Trx-VIP8 fusion protein without enterokinase digestion; lane 2: purified recombinant VIP8 after enterokinase digestion.
    Figure Legend Snippet: Expression, purification and identification of recombinant VIP analogue 8. ( A ) Expression of pET32a-VIP8 fusion protein analysed by SDS-PAGE. lane M: protein molecular mass marker; lane 1: un-induced BL21(DE3)-pET32a-VIP8; lane 2: induced BL21(DE3)-pET32a-VIP8 by isopropyl-β- d -thiogalactoside; lane 3: supernatant of bacterial lysate; lane 4: precipitation of bacterial lysate; ( B ) Purification of pET32a-VIP8 fusion protein by BeaverBeads TM His-tag Protein Purification kit; lane M: protein molecular mass marker; lane 1: induced whole BL21(DE3)-pET32a-VIP8 protein; lane 2: supernatant of bacterial lysate; and lane 3: purified pET-32a-VIP8 fusion protein; ( C ) Effect of post-induction time on the expression of BL21(DE3)-pET32a-VIP8 protein; lane M: protein molecular marker; lane 1: un-induced BL21(DE3)-pET32a-VIP8; lane 2, 3, 4, 5: induced BL21(DE3)-pET32a-VIP8 by isopropyl-β- d -thiogalactoside for 2, 4, 8, and 20 h respectively; ( D ) A 12% Tricine-SDS-PAGE analysis of the cleavage reaction and purification of the recombinant VIP8. Lane M: low protein molecular weight standard; lane 1: Trx-VIP8 fusion protein without enterokinase digestion; lane 2: purified recombinant VIP8 after enterokinase digestion.

    Techniques Used: Expressing, Purification, Recombinant, SDS Page, Marker, Protein Purification, Positron Emission Tomography, Molecular Weight

    26) Product Images from "Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis"

    Article Title: Optimization and evaluation of T7 based RNA linear amplification protocols for cDNA microarray analysis

    Journal: BMC Genomics

    doi: 10.1186/1471-2164-3-31

    Effects of in vitro transcription time on the fidelity of T7 based amplification and the yield of aRNA amplified from BC2 total RNA. Average correlation coefficients between amplified samples vs. unamplified poly(A) + RNA at each time point are shown in A and average yields of aRNA from each time point in B.
    Figure Legend Snippet: Effects of in vitro transcription time on the fidelity of T7 based amplification and the yield of aRNA amplified from BC2 total RNA. Average correlation coefficients between amplified samples vs. unamplified poly(A) + RNA at each time point are shown in A and average yields of aRNA from each time point in B.

    Techniques Used: In Vitro, Amplification

    27) Product Images from "Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae"

    Article Title: Genes encoding norcoclaurine synthase occur as tandem fusions in the Papaveraceae

    Journal: Scientific Reports

    doi: 10.1038/srep39256

    Functional characterization of 14 recombinant NCS enzymes from different plant species produced in Escherichia coli . ( A ) Six of the 14 soluble recombinant NCS candidates showed NCS activity in vitro . Crude soluble protein from E. coli producing each candidate was assayed for NCS activity using [8- 14 C]-dopamine and 4-HPAA. Affinity-purified, recombinant TFLNCSΔ19 and a total protein extract from E. coli harboring the empty pET29b vector were used as positive and negative controls for NCS activity. The [ 14 C]-norcoclaurine reaction product (labeled with asterisks) was separated using thin layer chromatography and visualized by autoradiography. [ 14 C]-Norcoclaurine was not detected in corresponding protein extracts denatured by boiling for 5 min. ( B ) Truncation of the first 25 amino acids from the N-terminus of each of the 8 inactive full-length NCS candidates resulted in the detection of NCS activity in two proteins. Affinity-purified, recombinant TFLNCSΔ19 was used as a positive control for NCS activity.
    Figure Legend Snippet: Functional characterization of 14 recombinant NCS enzymes from different plant species produced in Escherichia coli . ( A ) Six of the 14 soluble recombinant NCS candidates showed NCS activity in vitro . Crude soluble protein from E. coli producing each candidate was assayed for NCS activity using [8- 14 C]-dopamine and 4-HPAA. Affinity-purified, recombinant TFLNCSΔ19 and a total protein extract from E. coli harboring the empty pET29b vector were used as positive and negative controls for NCS activity. The [ 14 C]-norcoclaurine reaction product (labeled with asterisks) was separated using thin layer chromatography and visualized by autoradiography. [ 14 C]-Norcoclaurine was not detected in corresponding protein extracts denatured by boiling for 5 min. ( B ) Truncation of the first 25 amino acids from the N-terminus of each of the 8 inactive full-length NCS candidates resulted in the detection of NCS activity in two proteins. Affinity-purified, recombinant TFLNCSΔ19 was used as a positive control for NCS activity.

    Techniques Used: Functional Assay, Recombinant, Produced, Activity Assay, In Vitro, Affinity Purification, Plasmid Preparation, Labeling, Thin Layer Chromatography, Autoradiography, Positive Control

    28) Product Images from "Construction of an Expression Vector Containing Mtb72F of Mycobacterium tuberculosis"

    Article Title: Construction of an Expression Vector Containing Mtb72F of Mycobacterium tuberculosis

    Journal: Cell Journal (Yakhteh)

    doi:

    PCR products of the amplified fragments. Mtb32N fragment 632bp (A), Mtb39 fragment 1197bp (B), and 100 bp DNA size marker (M).
    Figure Legend Snippet: PCR products of the amplified fragments. Mtb32N fragment 632bp (A), Mtb39 fragment 1197bp (B), and 100 bp DNA size marker (M).

    Techniques Used: Polymerase Chain Reaction, Amplification, Marker

    Restriction enzyme analysis of the final construct using different enzymes: Lane A (arrow): double digestion using NdeI and EcoRI enzymes (1600 bp fragment consisted of Mtb32C and Mtb39); Lane B (arrow): double digestion using BamHI and EcoRI enzymes (1200 bp fragment of Mtb39); Lane C (arrow): double digestion using NdeI and HindIII enzymes (2200 bp fragment consisted of Mtb32C, Mtb39, and Mtb32N).
    Figure Legend Snippet: Restriction enzyme analysis of the final construct using different enzymes: Lane A (arrow): double digestion using NdeI and EcoRI enzymes (1600 bp fragment consisted of Mtb32C and Mtb39); Lane B (arrow): double digestion using BamHI and EcoRI enzymes (1200 bp fragment of Mtb39); Lane C (arrow): double digestion using NdeI and HindIII enzymes (2200 bp fragment consisted of Mtb32C, Mtb39, and Mtb32N).

    Techniques Used: Construct

    29) Product Images from "Exploiting phage receptor binding proteins to enable endolysins to kill Gram-negative bacteria"

    Article Title: Exploiting phage receptor binding proteins to enable endolysins to kill Gram-negative bacteria

    Journal: Scientific Reports

    doi: 10.1038/s41598-020-68983-3

    Muralytic activity of Innolysins Ec. Cleared lysates of the Innolysins Ec1-Ec12 (see Fig. 1 ) were screened for ability to degrade peptidoglycan of P. aeruginosa PAO1 compared to the activity of cleared lysates of cells carrying the empty vector, pVTD (negative control). Phage T5 endolysin (T5 Lys) and receptor binding protein (Pb5) were used as a positive and a negative control, respectively. Average muralytic activities (U/ml cleared lysate) were estimated based on triplicates. *Significant muralytic activity compared to the negative control (cleared lysate of cells carrying the empty vector, pVTD) at P
    Figure Legend Snippet: Muralytic activity of Innolysins Ec. Cleared lysates of the Innolysins Ec1-Ec12 (see Fig. 1 ) were screened for ability to degrade peptidoglycan of P. aeruginosa PAO1 compared to the activity of cleared lysates of cells carrying the empty vector, pVTD (negative control). Phage T5 endolysin (T5 Lys) and receptor binding protein (Pb5) were used as a positive and a negative control, respectively. Average muralytic activities (U/ml cleared lysate) were estimated based on triplicates. *Significant muralytic activity compared to the negative control (cleared lysate of cells carrying the empty vector, pVTD) at P

    Techniques Used: Activity Assay, Plasmid Preparation, Negative Control, Binding Assay

    Growth of E. coli after treatment with Innolysins Ec. Cleared fractions of muralytically active engineered proteins (see Fig. 2 ) were screened for the ability to inhibit growth of E. coli ATCC11303. Art-175 was provided by Lysando AG 29 and used as a positive control. Phage T5 endolysin (T5 Lys) and receptor binding protein (Pb5) were used as negative controls. Growth inhibition was detected as the absence of growth (OD 655nm ) of cells treated with an Innolysin in comparison to the negative control (growth of ATCC11303 cells treated with cleared lysate of cells carrying the empty vector, pVTD) after incubation for 18 h at 37 °C. *Significant bacterial growth inhibition at P
    Figure Legend Snippet: Growth of E. coli after treatment with Innolysins Ec. Cleared fractions of muralytically active engineered proteins (see Fig. 2 ) were screened for the ability to inhibit growth of E. coli ATCC11303. Art-175 was provided by Lysando AG 29 and used as a positive control. Phage T5 endolysin (T5 Lys) and receptor binding protein (Pb5) were used as negative controls. Growth inhibition was detected as the absence of growth (OD 655nm ) of cells treated with an Innolysin in comparison to the negative control (growth of ATCC11303 cells treated with cleared lysate of cells carrying the empty vector, pVTD) after incubation for 18 h at 37 °C. *Significant bacterial growth inhibition at P

    Techniques Used: Positive Control, Binding Assay, Inhibition, Negative Control, Plasmid Preparation, Incubation

    Visual representation of construction of Innolysins Ec. Phage T5 endolysin (T5 Lys) was fused with the whole phage T5 receptor binding protein, Pb5 or its binding domain (Pb5 1-488 ). Fusion was conducted without linkers (Ec1 to Ec4) or with linkers (linker L1: AGAGAG or linker L2: GAGAGAGAGAGAGA) (Ec5 to Ec12) with T5 Lys located in the N-terminus (Ec1 and Ec2; Ec5 to Ec8) or in the C-terminus (Ec3 and Ec4; Ec9 to Ec12) of the engineered endolysins.
    Figure Legend Snippet: Visual representation of construction of Innolysins Ec. Phage T5 endolysin (T5 Lys) was fused with the whole phage T5 receptor binding protein, Pb5 or its binding domain (Pb5 1-488 ). Fusion was conducted without linkers (Ec1 to Ec4) or with linkers (linker L1: AGAGAG or linker L2: GAGAGAGAGAGAGA) (Ec5 to Ec12) with T5 Lys located in the N-terminus (Ec1 and Ec2; Ec5 to Ec8) or in the C-terminus (Ec3 and Ec4; Ec9 to Ec12) of the engineered endolysins.

    Techniques Used: Binding Assay

    30) Product Images from "miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation"

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation

    Journal: The American Journal of Pathology

    doi: 10.1016/j.ajpath.2016.10.021

    Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P
    Figure Legend Snippet: Increased menin expression decreases proliferation. Mz-ChA-1 cells overexpressing menin with pCMV6-MEN1 vector exhibit a decrease in Ki-67 proliferative marker expression. A – C: Increased menin expression in pCMV6-MEN1 Mz-ChA-1 cells by real-time PCR ( A ) and flow cytometry ( B ) decreased Ki-67 proliferative marker expression by real-time PCR ( C ). D: Decreased cell migration as measured by wound healing assay. E: Decreased cell invasion as measured by Boyden chamber assay in pCMV6-MEN1 Mz-ChA-1 cells. Data are expressed as means ± SEM performed in triplicate ( A–E ). ∗ P

    Techniques Used: Expressing, Plasmid Preparation, Marker, Real-time Polymerase Chain Reaction, Flow Cytometry, Migration, Wound Healing Assay, Boyden Chamber Assay

    Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P
    Figure Legend Snippet: Menin expression negatively regulates angiogenesis. A: By real-time PCR, Mz-ChA-1 MEN1 knockout cells increased expression of angiogenic factors compared to Mz-ChA-1 control cells. B: By real-time PCR, pCMV6-MEN1 Mz-ChA-1 cells decreased expression of angiogenic factors compared to Mz-ChA-1 control cells. Data are expressed as means ± SEM performed in triplicate ( A and B ). ∗ P

    Techniques Used: Expressing, Real-time Polymerase Chain Reaction, Knock-Out

    31) Product Images from "Reconstitution of the Very Short Patch Repair Pathway from Escherichia coli *"

    Article Title: Reconstitution of the Very Short Patch Repair Pathway from Escherichia coli *

    Journal: The Journal of Biological Chemistry

    doi: 10.1074/jbc.M112.384321

    SDS-PAGE analysis of purified DNA polymerase I, DNA ligase I, and the Vsr endonuclease. Purified proteins (3 μg) were resolved on an 11% polyacrylamide gel run in the presence of SDS and stained with Coomassie Blue. Lane 1 , molecular mass standards
    Figure Legend Snippet: SDS-PAGE analysis of purified DNA polymerase I, DNA ligase I, and the Vsr endonuclease. Purified proteins (3 μg) were resolved on an 11% polyacrylamide gel run in the presence of SDS and stained with Coomassie Blue. Lane 1 , molecular mass standards

    Techniques Used: SDS Page, Purification, Staining

    DNA polymerase I and the Vsr endonuclease are sufficient to repair a T:G mismatch. The VSP repair reaction contained 50 ng of covalently closed heteroduplex substrate, 52 n m Vsr endonuclease, and a titration of DNA polymerase I from 467 to 0.2 n m as described
    Figure Legend Snippet: DNA polymerase I and the Vsr endonuclease are sufficient to repair a T:G mismatch. The VSP repair reaction contained 50 ng of covalently closed heteroduplex substrate, 52 n m Vsr endonuclease, and a titration of DNA polymerase I from 467 to 0.2 n m as described

    Techniques Used: Titration

    DNA ligase I seals the nick created by DNA polymerase I nick translation. Repair and ligation reactions were conducted as described under “Materials and Methods” using 200 ng of pUC19-VSR heteroduplex DNA (∼1.2 n m molecules), 10
    Figure Legend Snippet: DNA ligase I seals the nick created by DNA polymerase I nick translation. Repair and ligation reactions were conducted as described under “Materials and Methods” using 200 ng of pUC19-VSR heteroduplex DNA (∼1.2 n m molecules), 10

    Techniques Used: Nick Translation, Ligation

    Vsr-catalyzed nicking of a covalently closed circular DNA substrate. Vsr-dependent nicking reactions were as described under “Materials and Methods.” A , the titration of the Vsr endonuclease was from 153 to 0 n m with each DNA substrate,
    Figure Legend Snippet: Vsr-catalyzed nicking of a covalently closed circular DNA substrate. Vsr-dependent nicking reactions were as described under “Materials and Methods.” A , the titration of the Vsr endonuclease was from 153 to 0 n m with each DNA substrate,

    Techniques Used: Titration

    The impact of DNA ligase I concentration on repair track length. Ligation and repair reactions were as described under “Materials and Methods” using 200 ng of covalently closed pUC19-VSR heteroduplex DNA (∼1.2 n m molecules), 10
    Figure Legend Snippet: The impact of DNA ligase I concentration on repair track length. Ligation and repair reactions were as described under “Materials and Methods” using 200 ng of covalently closed pUC19-VSR heteroduplex DNA (∼1.2 n m molecules), 10

    Techniques Used: Concentration Assay, Ligation

    The Vsr endonuclease incises DNA immediately 5′ to the mismatched thymidine. Vsr nicking reactions were as described under “Materials and Methods.” The Vsr endonuclease was incubated with covalently closed pUC19-VSR heteroduplex
    Figure Legend Snippet: The Vsr endonuclease incises DNA immediately 5′ to the mismatched thymidine. Vsr nicking reactions were as described under “Materials and Methods.” The Vsr endonuclease was incubated with covalently closed pUC19-VSR heteroduplex

    Techniques Used: Incubation

    32) Product Images from "Streamlined ex vivo and in vivo genome editing in mouse embryos using recombinant adeno-associated viruses"

    Article Title: Streamlined ex vivo and in vivo genome editing in mouse embryos using recombinant adeno-associated viruses

    Journal: Nature Communications

    doi: 10.1038/s41467-017-02706-7

    Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region
    Figure Legend Snippet: Recombinant AAV vectors can mediate homology-directed repair (HDR). a Schematic representation of the Tyr locus and location of sgRNA in exon 1. The orange and red lines mark the initiation and termination codons respectively. The green line indicates the location of the sgRNA used to target Tyr . b Strategy to introduce a premature stop codon in the Tyr locus using HDR. The 5′ and 3′ homology arms are marked by a thick line. A G to T nucleotide transversion in the PAM sequence converts a glycine codon (GGA) into a stop codon (TGA) disrupting translation of Tyr . Arrows indicate binding sites of the primers used in PCR-TOPO sequencing. c Strategy to insert the blue fluorescent protein (BFP) gene into the Tyr locus using HDR. Brown and purple arrows depict the binding sites of PCR primers used to confirm the insertion of BFP into Tyr locus. P2A, Porcine teschovirus-1 2A peptide; TAA, Stop codon. d Histogram showing the frequency of single-nucleotide transversion and BFP insertion by HDR using two different mixtures of rAAV vectors. e Analysis of single-nucleotide transversion in individual embryos or pups using PCR-TOPO sequencing. Each bar represents an individual sample. For pups, only DNA from tail snips and ear punches was analyzed. f Confirmation of BFP insertion using PCR. Four out of seven E3.5 embryos tested showed correct insertion of BFP into the Tyr locus. The top panel shows amplification of the 5′-junction of the targeted Tyr locus using a forward primer that binds to genomic DNA upstream of the homology region and a reverse primer that binds to the BFP gene as shown in ( c ). The bottom panel shows amplification of the 3′-junction of the Tyr- edited allele using a forward primer that binds to the BFP gene and a reverse primer that binds to genomic DNA downstream of the homology region

    Techniques Used: Recombinant, Introduce, Sequencing, Binding Assay, Polymerase Chain Reaction, Amplification

    33) Product Images from "Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts"

    Article Title: Transcription Factor ZBED6 Mediates IGF2 Gene Expression by Regulating Promoter Activity and DNA Methylation in Myoblasts

    Journal: Scientific Reports

    doi: 10.1038/srep04570

    Recombinant vectors used to assay the sequence activity of IGF2 gene intron 3. (A) Luciferase activity of IGF2 (Black bars) intron 3 sequence 3106G > A mutant constructs in C2C12 cells. The location and size of each fragment is indicated to the left of each bar relative to the intron 3 start codon. IGF2 promoter activity modulated by genetic polymorphisms (intron 3–3106G > A). Luciferase activity were transfected with recombinant plasmids containing the intron 3–3106 G-SNP and −3106 A-SNP and the bovine IGF2 P3 promoter in cell lines. Results from pGL3-Basic plasmid are given as a negative control. (B) Comparison of luciferase activity levels of IGF2 in C2C12 cell lines between transfected with pcDNA3.1 + (control), pcDNA3.1 + -ZBED6. The blank expression vector (pcDNA3.1 + and pGL3-Basic) was used to maintain equivalent amounts of DNA. Gray solid bar show luciferase activities from cell lines transfected with the wild type haplotype IGF2 439G-SNP-pGL3 construct containing the wild-type allele. Black solid bar represent luciferase activities from cell lines transfected with the mutant haplotype 439A-SNP-pGL3 construct containing the mutant allele. Data are mean ± SEM of normalized luciferase activity. (Values represent the mean ± SEM of three duplications.) *P
    Figure Legend Snippet: Recombinant vectors used to assay the sequence activity of IGF2 gene intron 3. (A) Luciferase activity of IGF2 (Black bars) intron 3 sequence 3106G > A mutant constructs in C2C12 cells. The location and size of each fragment is indicated to the left of each bar relative to the intron 3 start codon. IGF2 promoter activity modulated by genetic polymorphisms (intron 3–3106G > A). Luciferase activity were transfected with recombinant plasmids containing the intron 3–3106 G-SNP and −3106 A-SNP and the bovine IGF2 P3 promoter in cell lines. Results from pGL3-Basic plasmid are given as a negative control. (B) Comparison of luciferase activity levels of IGF2 in C2C12 cell lines between transfected with pcDNA3.1 + (control), pcDNA3.1 + -ZBED6. The blank expression vector (pcDNA3.1 + and pGL3-Basic) was used to maintain equivalent amounts of DNA. Gray solid bar show luciferase activities from cell lines transfected with the wild type haplotype IGF2 439G-SNP-pGL3 construct containing the wild-type allele. Black solid bar represent luciferase activities from cell lines transfected with the mutant haplotype 439A-SNP-pGL3 construct containing the mutant allele. Data are mean ± SEM of normalized luciferase activity. (Values represent the mean ± SEM of three duplications.) *P

    Techniques Used: Recombinant, Sequencing, Activity Assay, Luciferase, Mutagenesis, Construct, Transfection, Plasmid Preparation, Negative Control, Expressing

    ZBED6 mediated IGF2 expression in C2C12 cell lines and bovine primary myocyte cells. (A) Comparison of mRNA expression levels of bovine ZBED6 and IGF2 in C2C12 cell lines between transfected with pcDNA3.1 + (control), pcDNA3.1 + -ZBED6. A blank expression vector (pcDNA3.1 + ) was used to maintain equivalent amounts of DNA. (B) The qPCR analysis of ZBED6 and IGF2 mRNA levels in bovine primary myocyte cells transfected with Ad-EGFP (control) and Ad-ZBED6. A blank expression vector (Ad-EGFP) was used to maintain equivalent amounts of DNA. The mRNA expression was normalized to the geometric mean of the suitable housekeeping genes (GAPDH and ACTINB) and expressed relative to gene expression in the control group. Error bars represent standard error of the mean (SEM). Each column value represents the mean ± SEM of at least three independent experiments (n = 3 or 4). *P
    Figure Legend Snippet: ZBED6 mediated IGF2 expression in C2C12 cell lines and bovine primary myocyte cells. (A) Comparison of mRNA expression levels of bovine ZBED6 and IGF2 in C2C12 cell lines between transfected with pcDNA3.1 + (control), pcDNA3.1 + -ZBED6. A blank expression vector (pcDNA3.1 + ) was used to maintain equivalent amounts of DNA. (B) The qPCR analysis of ZBED6 and IGF2 mRNA levels in bovine primary myocyte cells transfected with Ad-EGFP (control) and Ad-ZBED6. A blank expression vector (Ad-EGFP) was used to maintain equivalent amounts of DNA. The mRNA expression was normalized to the geometric mean of the suitable housekeeping genes (GAPDH and ACTINB) and expressed relative to gene expression in the control group. Error bars represent standard error of the mean (SEM). Each column value represents the mean ± SEM of at least three independent experiments (n = 3 or 4). *P

    Techniques Used: Expressing, Transfection, Plasmid Preparation, Real-time Polymerase Chain Reaction

    34) Product Images from "Whole exome sequencing reveals HSPA1L as a genetic risk factor for spontaneous preterm birth"

    Article Title: Whole exome sequencing reveals HSPA1L as a genetic risk factor for spontaneous preterm birth

    Journal: PLoS Genetics

    doi: 10.1371/journal.pgen.1007394

    HSPA1L and GR protein levels in decidualized human endometrial stromal fibroblasts. Cultured ESFs were transfected with WT or Ala268Thr HSPA1L -pcDNA3.1 constructs or with empty pcDNA3.1 vector (control). Cells were treated with decidualization media supplemented with 100nM dexamethasone (glucocorticoids) for 72h. Both cytosolic and nuclear protein were extracted, and HSPA1L and GR protein levels were measured by Western blot. Band intensity of HSPA1L or GR was normalized to band intensity of the corresponding β-actin. Cytosolic (A) and nuclear (B) HSPA1L levels as well as cytosolic (C) and nuclear (D) GR levels are shown for control (empty vector), WT and Ala268Thr sample groups. Each experiment was performed as triplicates in three different passages (n = 9 each group, except n = 8 for nuclear control group) and bars represent mean + SEM. Significant p-value
    Figure Legend Snippet: HSPA1L and GR protein levels in decidualized human endometrial stromal fibroblasts. Cultured ESFs were transfected with WT or Ala268Thr HSPA1L -pcDNA3.1 constructs or with empty pcDNA3.1 vector (control). Cells were treated with decidualization media supplemented with 100nM dexamethasone (glucocorticoids) for 72h. Both cytosolic and nuclear protein were extracted, and HSPA1L and GR protein levels were measured by Western blot. Band intensity of HSPA1L or GR was normalized to band intensity of the corresponding β-actin. Cytosolic (A) and nuclear (B) HSPA1L levels as well as cytosolic (C) and nuclear (D) GR levels are shown for control (empty vector), WT and Ala268Thr sample groups. Each experiment was performed as triplicates in three different passages (n = 9 each group, except n = 8 for nuclear control group) and bars represent mean + SEM. Significant p-value

    Techniques Used: Cell Culture, Transfection, Construct, Plasmid Preparation, Western Blot

    35) Product Images from "In vivo dissection of the chromosome condensation machinery"

    Article Title: In vivo dissection of the chromosome condensation machinery

    Journal: The Journal of Cell Biology

    doi: 10.1083/jcb.200109056

    Topo II and phospho-H3 are not essential for rDNA condensation. CH325 ( top2-4 ), JHY90 ( WT ), JHY91 ( H3-S10A ), and JHY93 ( H3-S10,28A ) cultures were synchronized in G1, and released into a Nz block either at 37°C (top2-4) or 23°C. After rearrest in M phase, cells were fixed and processed for rDNA FISH. rDNA loops were scored as condensed. Greater than 100 nuclei/sample were scored. Data for the condensins is from Fig. 2 and is shown for comparison.
    Figure Legend Snippet: Topo II and phospho-H3 are not essential for rDNA condensation. CH325 ( top2-4 ), JHY90 ( WT ), JHY91 ( H3-S10A ), and JHY93 ( H3-S10,28A ) cultures were synchronized in G1, and released into a Nz block either at 37°C (top2-4) or 23°C. After rearrest in M phase, cells were fixed and processed for rDNA FISH. rDNA loops were scored as condensed. Greater than 100 nuclei/sample were scored. Data for the condensins is from Fig. 2 and is shown for comparison.

    Techniques Used: Blocking Assay, Fluorescence In Situ Hybridization

    36) Product Images from "Single-cell analysis of the fate of c-kit-positive bone marrow cells"

    Article Title: Single-cell analysis of the fate of c-kit-positive bone marrow cells

    Journal: NPJ Regenerative Medicine

    doi: 10.1038/s41536-017-0032-1

    c-kit-BMCs acquire distinct cardiac cell phenotypes in vivo. a Representative scatter plots illustrating the expression of c-kit, Thy1.2 and CD31 in cardiac cell populations isolated from c-kit-BMC-treated infarcted hearts. The percentage of positive cells is indicated. CTRL: isotype control; SSC: side scatter. b Transcripts for α-myosin heavy chain ( Myh6 ), c-kit, CD31, collagen type III α-1 ( Col3a1 ) and β-2 microglobulin ( B2M ) in isolated cardiomyocytes (Myo), c-kit-BMCs (c-kit), endothelial cells (ECs) and fibroblasts (Fbl). Myocardium (first lane, MC) was used as control. bp: base pairs. c Isolated cardiomyocytes expressing α-sarcomeric actin (α-SA, red), ECs expressing von Willebrand factor (vWF, yellow) and fibroblasts expressing procollagen (Pro-Col, green) are shown. Quantitative data are presented as mean ± SD. Scale bars: Left and central panels = 50 µm; Right panel = 20 µm. d PCR products run on agarose gel correspond to the sites of integration of the viral genome in the DNA of c-kit-BMCs and myocytes. These images correspond to representative examples of experiments conducted in 8 mice. The upper band shows the pCR4-TOPO TA vector. Molecular mass: 100 bp incremental ladders
    Figure Legend Snippet: c-kit-BMCs acquire distinct cardiac cell phenotypes in vivo. a Representative scatter plots illustrating the expression of c-kit, Thy1.2 and CD31 in cardiac cell populations isolated from c-kit-BMC-treated infarcted hearts. The percentage of positive cells is indicated. CTRL: isotype control; SSC: side scatter. b Transcripts for α-myosin heavy chain ( Myh6 ), c-kit, CD31, collagen type III α-1 ( Col3a1 ) and β-2 microglobulin ( B2M ) in isolated cardiomyocytes (Myo), c-kit-BMCs (c-kit), endothelial cells (ECs) and fibroblasts (Fbl). Myocardium (first lane, MC) was used as control. bp: base pairs. c Isolated cardiomyocytes expressing α-sarcomeric actin (α-SA, red), ECs expressing von Willebrand factor (vWF, yellow) and fibroblasts expressing procollagen (Pro-Col, green) are shown. Quantitative data are presented as mean ± SD. Scale bars: Left and central panels = 50 µm; Right panel = 20 µm. d PCR products run on agarose gel correspond to the sites of integration of the viral genome in the DNA of c-kit-BMCs and myocytes. These images correspond to representative examples of experiments conducted in 8 mice. The upper band shows the pCR4-TOPO TA vector. Molecular mass: 100 bp incremental ladders

    Techniques Used: In Vivo, Expressing, Isolation, Polymerase Chain Reaction, Agarose Gel Electrophoresis, Mouse Assay, Plasmid Preparation

    37) Product Images from "CRISPR/Cas9‐mediated knockout of six glycosyltransferase genes in Nicotiana benthamiana for the production of recombinant proteins lacking β‐1,2‐xylose and core α‐1,3‐fucose"

    Article Title: CRISPR/Cas9‐mediated knockout of six glycosyltransferase genes in Nicotiana benthamiana for the production of recombinant proteins lacking β‐1,2‐xylose and core α‐1,3‐fucose

    Journal: Plant Biotechnology Journal

    doi: 10.1111/pbi.12981

    Sequencing and Western blot analysis for the T 2 lines X‐KO #34‐4‐4 and F‐KO #6‐10‐6 and the F 2 line FX‐KO #20‐4. (a) Mutations in XylT 1 and 2 of X‐KO #34‐4‐4 as identified by Sanger sequencing of PCR amplicons ( XylT 1) and TOPO‐cloned PCR products ( XylT 2). The corresponding wild‐type sequence is shown above, the gRNA target sequences are indicated by coloured boxes, and the PAM sequences are shown in bold. (b) Mutations in FucT 1, 2, 3 and 4 of F‐KO #6‐10‐6. The PAM‐distal mismatch between the gRNA and Fuc T 3 and 4 is highlighted in yellow. (c) Mutations in FucT 1‐4 and XylT 1 and 2 of FX‐KO #20‐4. Five of six genes carry homozygous mutations, with the exception of FucT 3 which has biallelic mutations. (d) Western blot of FX‐KO #20‐4 in comparison to N. benthamiana wild type, F‐KO #6‐10‐6 and X‐KO #34‐4‐4. ~10 µg of total soluble protein were loaded for each sample. Anti‐fucose blot: 1st antibody rabbit‐anti‐α1,3‐fucose (1 : 10 000), 2nd antibody goat‐anti‐rabbit H+L AP‐labelled (1 : 10 000, pre‐absorbed). Anti‐xylose blot: 1st antibody rabbit‐anti‐β1,2‐xylose (1 : 5000), 2nd antibody goat‐anti‐rabbit H+L AP‐labelled (1 : 10 000, pre‐absorbed).
    Figure Legend Snippet: Sequencing and Western blot analysis for the T 2 lines X‐KO #34‐4‐4 and F‐KO #6‐10‐6 and the F 2 line FX‐KO #20‐4. (a) Mutations in XylT 1 and 2 of X‐KO #34‐4‐4 as identified by Sanger sequencing of PCR amplicons ( XylT 1) and TOPO‐cloned PCR products ( XylT 2). The corresponding wild‐type sequence is shown above, the gRNA target sequences are indicated by coloured boxes, and the PAM sequences are shown in bold. (b) Mutations in FucT 1, 2, 3 and 4 of F‐KO #6‐10‐6. The PAM‐distal mismatch between the gRNA and Fuc T 3 and 4 is highlighted in yellow. (c) Mutations in FucT 1‐4 and XylT 1 and 2 of FX‐KO #20‐4. Five of six genes carry homozygous mutations, with the exception of FucT 3 which has biallelic mutations. (d) Western blot of FX‐KO #20‐4 in comparison to N. benthamiana wild type, F‐KO #6‐10‐6 and X‐KO #34‐4‐4. ~10 µg of total soluble protein were loaded for each sample. Anti‐fucose blot: 1st antibody rabbit‐anti‐α1,3‐fucose (1 : 10 000), 2nd antibody goat‐anti‐rabbit H+L AP‐labelled (1 : 10 000, pre‐absorbed). Anti‐xylose blot: 1st antibody rabbit‐anti‐β1,2‐xylose (1 : 5000), 2nd antibody goat‐anti‐rabbit H+L AP‐labelled (1 : 10 000, pre‐absorbed).

    Techniques Used: Sequencing, Western Blot, Polymerase Chain Reaction, Clone Assay

    38) Product Images from "Generation of cattle knockout for galactose‐α1,3‐galactose and N‐glycolylneuraminic acid antigens, et al. Generation of cattle knockout for galactose‐α1,3‐galactose and N‐glycolylneuraminic acid antigens"

    Article Title: Generation of cattle knockout for galactose‐α1,3‐galactose and N‐glycolylneuraminic acid antigens, et al. Generation of cattle knockout for galactose‐α1,3‐galactose and N‐glycolylneuraminic acid antigens

    Journal: Xenotransplantation

    doi: 10.1111/xen.12524

    Editing of GGTA1 and CMAH genes in male and female fibroblasts. A, Target sequences for selected sgRNAs and ss CMAH ‐STOP oligo sequence. For each bovine gene ( GGTA1 and CMAH ), target sequences are indicated on the respective exons recognized by the selected sgRNAs. PAM sequences are highlighted in blue. In the ss CMAH ‐STOP oligo sequence, the TAA (STOP) codon is highlighted in bold character; the Afl II restriction site is underlined. B, PCR analyses of female colonies. The results of the PCR analyses performed for the genomic characterization of the female colonies (A1, A2, A3, A4, A5 and A6) selected after Dynabeads sorting are reported as an example. Each colony was analysed for the GGTA1 gene (739 bp) and for the CMAH gene (225 bp). Resulting electrophoretic patterns determined directly that some colonies were characterized by visible Indels , creating bands different from the WT controls. This situation is clear for colonies A1 (double band), A2 (deletion) and A6 (deletion) in PCR analyses for the GGTA1 gene (°) and for colonies A1 (double band) and A5 (deletion) in PCR analyses for the CMAH gene (#). Resulting CMAH ‐PCR products were also digested with the Afl II restriction enzyme, detecting the alleles interested by the targeting event. Due to the introduction of a STOP codon (TAA) in the START position (ATG) of the CMAH gene, only the HDR‐ CMAH alleles will be cut by the restriction enzyme producing two lower bands (152 + 73 bp). A simple agarose electrophoresis enabled us to identify possible additional edited colonies detecting the STOP codon insertion (**) for colonies A2 and A6 and the single insertion (*) for colonies A3 and A4. In these last ones, the not targeted allele resulted uncut (225 bp) as the WT sample. For this reason, the final determination of the exact Indels , occurred in all the edited colonies, was determined by Sanger sequencing of the resulting TOPO TA E coli clones. 100 = 100 bp ladder (Thermo Fisher Scientific); A1, A2, A3, A4, A5 and A6 = transfected females colonies; WT = wild‐type female line; H 2 0 = Nucleases‐free water. C, Sequences alignments of colonies used for the SCNT. Sanger sequencing outlining the mutations affecting the GGTA1 and the CMAH genes of colonies selected for the SCNT step. For the GGTA1 gene, the exon 9 was used as reference for the male colonies and a PCR product including the exon 4 was used for the female ones. In both cases, deletions of different lengths were obtained (Table S1 ). For the CMAH gene, all edited alleles of the edited colonies were aligned using as reference a PCR product including the exon 2 sequence. In this case, in both lines, we were able to determine the TAA substitution, as result of the targeting event mediated by the site‐specific cut, produced by the CRISPR/Cas9 system driven by the sgRNA bt CMAH cr1
    Figure Legend Snippet: Editing of GGTA1 and CMAH genes in male and female fibroblasts. A, Target sequences for selected sgRNAs and ss CMAH ‐STOP oligo sequence. For each bovine gene ( GGTA1 and CMAH ), target sequences are indicated on the respective exons recognized by the selected sgRNAs. PAM sequences are highlighted in blue. In the ss CMAH ‐STOP oligo sequence, the TAA (STOP) codon is highlighted in bold character; the Afl II restriction site is underlined. B, PCR analyses of female colonies. The results of the PCR analyses performed for the genomic characterization of the female colonies (A1, A2, A3, A4, A5 and A6) selected after Dynabeads sorting are reported as an example. Each colony was analysed for the GGTA1 gene (739 bp) and for the CMAH gene (225 bp). Resulting electrophoretic patterns determined directly that some colonies were characterized by visible Indels , creating bands different from the WT controls. This situation is clear for colonies A1 (double band), A2 (deletion) and A6 (deletion) in PCR analyses for the GGTA1 gene (°) and for colonies A1 (double band) and A5 (deletion) in PCR analyses for the CMAH gene (#). Resulting CMAH ‐PCR products were also digested with the Afl II restriction enzyme, detecting the alleles interested by the targeting event. Due to the introduction of a STOP codon (TAA) in the START position (ATG) of the CMAH gene, only the HDR‐ CMAH alleles will be cut by the restriction enzyme producing two lower bands (152 + 73 bp). A simple agarose electrophoresis enabled us to identify possible additional edited colonies detecting the STOP codon insertion (**) for colonies A2 and A6 and the single insertion (*) for colonies A3 and A4. In these last ones, the not targeted allele resulted uncut (225 bp) as the WT sample. For this reason, the final determination of the exact Indels , occurred in all the edited colonies, was determined by Sanger sequencing of the resulting TOPO TA E coli clones. 100 = 100 bp ladder (Thermo Fisher Scientific); A1, A2, A3, A4, A5 and A6 = transfected females colonies; WT = wild‐type female line; H 2 0 = Nucleases‐free water. C, Sequences alignments of colonies used for the SCNT. Sanger sequencing outlining the mutations affecting the GGTA1 and the CMAH genes of colonies selected for the SCNT step. For the GGTA1 gene, the exon 9 was used as reference for the male colonies and a PCR product including the exon 4 was used for the female ones. In both cases, deletions of different lengths were obtained (Table S1 ). For the CMAH gene, all edited alleles of the edited colonies were aligned using as reference a PCR product including the exon 2 sequence. In this case, in both lines, we were able to determine the TAA substitution, as result of the targeting event mediated by the site‐specific cut, produced by the CRISPR/Cas9 system driven by the sgRNA bt CMAH cr1

    Techniques Used: Sequencing, Polymerase Chain Reaction, Electrophoresis, Clone Assay, Transfection, Produced, CRISPR

    39) Product Images from "Inactivation of class II transactivator by DNA methylation and histone deacetylation associated with absence of HLA-DR induction by interferon-γ in haematopoietic tumour cells"

    Article Title: Inactivation of class II transactivator by DNA methylation and histone deacetylation associated with absence of HLA-DR induction by interferon-γ in haematopoietic tumour cells

    Journal: British Journal of Cancer

    doi: 10.1038/sj.bjc.6601602

    Bisulphite sequencing of CIITA. Amplified PCR products were cloned into pCR4 vector using a TOPO-TA cloning Kit (Invitrogen) and plasmid DNA was purified. Sequencing reaction was performed using a Big-Dye terminator Kit (Applied Biosystems) and electrophoresed using an ABI3100 system (Applied Biosystems). CpG sites are shown above. Methylated alleles are shown as solid circles; unmethylated alleles as shown as open circles.
    Figure Legend Snippet: Bisulphite sequencing of CIITA. Amplified PCR products were cloned into pCR4 vector using a TOPO-TA cloning Kit (Invitrogen) and plasmid DNA was purified. Sequencing reaction was performed using a Big-Dye terminator Kit (Applied Biosystems) and electrophoresed using an ABI3100 system (Applied Biosystems). CpG sites are shown above. Methylated alleles are shown as solid circles; unmethylated alleles as shown as open circles.

    Techniques Used: Bisulfite Sequencing, Amplification, Polymerase Chain Reaction, Clone Assay, Plasmid Preparation, TA Cloning, Purification, Sequencing, Methylation

    40) Product Images from "Elimination of 01/A′–A0 pre-rRNA processing by-product in human cells involves cooperative action of two nuclear exosome-associated nucleases: RRP6 and DIS3"

    Article Title: Elimination of 01/A′–A0 pre-rRNA processing by-product in human cells involves cooperative action of two nuclear exosome-associated nucleases: RRP6 and DIS3

    Journal: RNA

    doi: 10.1261/rna.066589.118

    Expression of catalytically compromised DIS3 or RRP6 variants does not significantly affect rRNA synthesis and ribosome biogenesis in human cells. ( A ) General principle of the utilized cellular model. Plasmids compatible with Flp-In T-REx system from Invitrogen, containing wild-type or mutated variants of FLAG-tagged DIS3 or RRP6 and an EGFP-sh-miRNA fusion (both under the control of a bidirectional tetracycline-regulated promoter) were integrated into the Hek293 Flp-In T-REx cell line genome. The FLAG-tagged DIS3/RRP6 ORF was recoded in a way rendering it insusceptible to sh-miRNA silencing. Upon induction with tetracycline, stable cell lines produced either wild-type or mutated FLAG-tagged protein fusions and sh-miRNA silencing expression of only the respective endogenous gene. ( B ) sh-miRNA efficiently down-regulate expression of endogenous DIS3 and RRP6 at the mRNA level. Quantitative RT-PCR analysis was performed on total RNA isolated from Hek293 Flp-In T-REx cells (Ø) and established model cell lines subjected to induction with tetracycline and producing either DIS3 (WT, RNB MUT, PIN MUT, or DM) or RRP6 (WT or mut) exogenous variants simultaneously with sh-miRNAs targeting respective endogenous transcript. The graph shows results of quantification of three independent experiments. GAPDH mRNA was used for normalization. The expression level is relative to the parental Hek293 Flp-In T-REx cell line. ( C ) Expression of exogenous DIS3 protein variants is higher than endogenous DIS3, whereas levels of exo- and endogenous RRP6 are comparable. Model cell lines (as in panel B ), or parental Hek293 Flp-In T-REx cells (control), were treated with tetracycline. Proteins extracted from cells were separated in SDS-PAGE and transferred onto nitrocellulose membranes, which were stained with Ponceau S-Red and probed with antibodies specific to FLAG epitope, EGFP, DIS3, RRP6, and β-actin (loading control). ( D ) Exogenous DIS3 is overexpressed around five- and 10-fold compared to endogenous protein. Western blot was performed as in panel C , but using various dilutions of the protein sample from cell line-producing DIS3 WT variant. ( E ) Analysis of nascent rRNA synthesis. Model cell lines cultured in a medium containing tetracycline were pulse labeled with 32 P orthophosphoric acid, followed by chase in normal media for varying times (indicated above each lane). RNA was then isolated from the cells, separated in a denaturing agarose-formaldehyde gel and transferred onto nylon membrane. The blot was first stained with methylene blue ( bottom part) and then subjected to phosphorimaging ( upper part). Positions of 28S and 18S rRNA and other visible rRNA species are indicated on the right . In addition, the membrane was probed with hITS2a oligonucleotide ( middle part) to monitor accumulation of 7S pre-rRNA, a known phenotype of DIS3 enzymatic dysfunction. Results of hybridizations with probes h5.8S and h5S ( middle part) and staining of the membrane with methylene blue ( bottom part) are shown to assess sample loading. ( F ) Selected samples from panel E were resolved in denaturing polyacrylamide gel and subsequently subjected to phosphorimaging to visualize synthesis of small RNAs (5.8S, 5S, and tRNAs) at higher resolution. ( G ) Ribosome/polysome profile analysis. Native cytoplasmic extracts were prepared from model cell lines, grown in the presence of tetracycline, following translation inhibition with cycloheximide, and separated by centrifugation in linear sucrose gradients. Graphs show distribution of absorbance at 254 nm from the top ( left ) to the bottom ( right ). Peaks corresponding to individual subunits (40S and 60S), monosomes (80S), and polysomes are indicated.
    Figure Legend Snippet: Expression of catalytically compromised DIS3 or RRP6 variants does not significantly affect rRNA synthesis and ribosome biogenesis in human cells. ( A ) General principle of the utilized cellular model. Plasmids compatible with Flp-In T-REx system from Invitrogen, containing wild-type or mutated variants of FLAG-tagged DIS3 or RRP6 and an EGFP-sh-miRNA fusion (both under the control of a bidirectional tetracycline-regulated promoter) were integrated into the Hek293 Flp-In T-REx cell line genome. The FLAG-tagged DIS3/RRP6 ORF was recoded in a way rendering it insusceptible to sh-miRNA silencing. Upon induction with tetracycline, stable cell lines produced either wild-type or mutated FLAG-tagged protein fusions and sh-miRNA silencing expression of only the respective endogenous gene. ( B ) sh-miRNA efficiently down-regulate expression of endogenous DIS3 and RRP6 at the mRNA level. Quantitative RT-PCR analysis was performed on total RNA isolated from Hek293 Flp-In T-REx cells (Ø) and established model cell lines subjected to induction with tetracycline and producing either DIS3 (WT, RNB MUT, PIN MUT, or DM) or RRP6 (WT or mut) exogenous variants simultaneously with sh-miRNAs targeting respective endogenous transcript. The graph shows results of quantification of three independent experiments. GAPDH mRNA was used for normalization. The expression level is relative to the parental Hek293 Flp-In T-REx cell line. ( C ) Expression of exogenous DIS3 protein variants is higher than endogenous DIS3, whereas levels of exo- and endogenous RRP6 are comparable. Model cell lines (as in panel B ), or parental Hek293 Flp-In T-REx cells (control), were treated with tetracycline. Proteins extracted from cells were separated in SDS-PAGE and transferred onto nitrocellulose membranes, which were stained with Ponceau S-Red and probed with antibodies specific to FLAG epitope, EGFP, DIS3, RRP6, and β-actin (loading control). ( D ) Exogenous DIS3 is overexpressed around five- and 10-fold compared to endogenous protein. Western blot was performed as in panel C , but using various dilutions of the protein sample from cell line-producing DIS3 WT variant. ( E ) Analysis of nascent rRNA synthesis. Model cell lines cultured in a medium containing tetracycline were pulse labeled with 32 P orthophosphoric acid, followed by chase in normal media for varying times (indicated above each lane). RNA was then isolated from the cells, separated in a denaturing agarose-formaldehyde gel and transferred onto nylon membrane. The blot was first stained with methylene blue ( bottom part) and then subjected to phosphorimaging ( upper part). Positions of 28S and 18S rRNA and other visible rRNA species are indicated on the right . In addition, the membrane was probed with hITS2a oligonucleotide ( middle part) to monitor accumulation of 7S pre-rRNA, a known phenotype of DIS3 enzymatic dysfunction. Results of hybridizations with probes h5.8S and h5S ( middle part) and staining of the membrane with methylene blue ( bottom part) are shown to assess sample loading. ( F ) Selected samples from panel E were resolved in denaturing polyacrylamide gel and subsequently subjected to phosphorimaging to visualize synthesis of small RNAs (5.8S, 5S, and tRNAs) at higher resolution. ( G ) Ribosome/polysome profile analysis. Native cytoplasmic extracts were prepared from model cell lines, grown in the presence of tetracycline, following translation inhibition with cycloheximide, and separated by centrifugation in linear sucrose gradients. Graphs show distribution of absorbance at 254 nm from the top ( left ) to the bottom ( right ). Peaks corresponding to individual subunits (40S and 60S), monosomes (80S), and polysomes are indicated.

    Techniques Used: Expressing, Stable Transfection, Produced, Quantitative RT-PCR, Isolation, SDS Page, Staining, FLAG-tag, Western Blot, Variant Assay, Cell Culture, Labeling, Inhibition, Centrifugation

    Related Articles

    Clone Assay:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Selection:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Isolation:

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Construct:

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Sequencing:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Modification:

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Plasmid Preparation:

    Article Title: A mouse model for inducible overexpression of Prdm14 results in rapid-onset and highly penetrant T-cell acute lymphoblastic leukemia (T-ALL)
    Article Snippet: .. This fragment was ligated into the pENTR1A dual selection vector (Life Technologies) using the Dra I and Sal I restriction sites. .. Gateway recombination using LR Clonase II mix (Life Technologies) was used to transfer the Prdm14 -IRES-nls-EGFP fragment from the pENTR1A vector to pROSA26-DEST (Addgene plasmid 21189).

    Article Title: AIM2 inflammasome is activated by pharmacological disruption of nuclear envelope integrity
    Article Snippet: .. A human Flag-tagged AIM2 or TREX1 construct were cloned into the pENTR 1A dual selection vector (Invitrogen) and then cloned in the pINDUCER21, a GFP tet-inducible lentiviral vector plasmid. .. Lentiviruses were produced as previously described ( ).

    Article Title: A high resolution protein interaction map of the yeast Mediator complex
    Article Snippet: .. The Drosophila Mediator subunit open-reading-frames (ORF) were isolated from cDNA clones made by the Berkeley Drosophila Genome Project (BDGP) and inserted into the Invitrogen Gateway entry vector pENTR1A or a home-made derivative, termed pGATEN. .. The latter was derived from pENTR1A by inserting a SalI–KpnI cloning adapter made of the two complementary oligonucleotides GATEN1 (TCGACTGGGCCTCCATGGCCCAATTGACTAGTAGCGGATCCGGAGGCCTCTACGTAGGTA) and GATEN2 (CTACGTAGAGGCCTCCGGATCCGCTACTAGTCAATTGGGCCATGGAGGCCCAG), between the unique SalI and KpnI sites.

    Article Title: Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1Phytochrome- and Gibberellin-Mediated Regulation of Abscisic Acid Metabolism during Germination of Photoblastic Lettuce Seeds 1 [OA]
    Article Snippet: .. The plasmids were digested with Xho I and Kpn I and ligated into the Gateway entry vector pENTR1A (Invitrogen). .. The inserts were cloned into the pGWB2 vector (provided by Dr. Tsuyoshi Nakagawa, Shimane University) by the LR reaction according to the manufacturer's protocol.

    Article Title: miR-24 Inhibition Increases Menin Expression and Decreases Cholangiocarcinoma Proliferation
    Article Snippet: .. The pCMV6-Entry vector without the Men1 insert was used as a control. .. Transfection efficacy was assessed by measuring menin expression by real-time quantitative PCR and flow cytometry., Cell proliferation was measured by Ki-67 real-time PCR expression, migration via wound healing, invasion via Boyden chamber, and angiogenesis via VEGF-A, VEGF-C, VEGFR-2, VEGFR-3, ANG-1, ANG-2, TIE-1, and TIE-2 real-time PCR expression.

    Article Title: Human Dicer preferentially cleaves dsRNAs at their termini without a requirement for ATP
    Article Snippet: .. Dicer and Dicer-HisC cDNAs were recloned from pBS plasmids into the pENTR1A vector, using the Gateway system (Life Technologies), yielding pENTR-Dicer and pENTR-Dicer-HisC. .. The non-tagged Dicer cDNA was then switched to the pDEST10 vector by the reaction catalysed by LR Clonase mix (Life Technologies), yielding pDEST10-Dicer, used for expression of the N-terminally His6 -tagged Dicer-HisN.

    Article Title: RIP140 increases APC expression and controls intestinal homeostasis and tumorigenesis
    Article Snippet: .. The coding sequence of the human RIP140 gene (BclI/ClaI fragment) was cloned into the BamHI site of the Gateway pENTR-1A vector (Invitrogen) previously modified to include the rabbit β-globin polyA sequence and the CAG promoter. .. The transgene was then transferred into the pDEST-HPRT vector (Nucleis), which was linearized using AgeI and electroporated into HPRT-deficient BPES ES cells by standard methods.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher dna ligase
    Dna Ligase, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 55 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna ligase/product/Thermo Fisher
    Average 99 stars, based on 55 article reviews
    Price from $9.99 to $1999.99
    dna ligase - by Bioz Stars, 2020-10
    99/100 stars
      Buy from Supplier

    Image Search Results