e coli xl1 blue cells  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89

    Structured Review

    Millipore e coli xl1 blue cells
    YmdB and RNase III interactions. ( A ) Coprecipitation of RNase III with biotin-tagged YmdB. Streptavidin-conjugated agarose beads were added to extracts from <t>XL1</t> cells containing plasmids pDW363 or pDW363-YmdB, and protein coprecipitated with beads was
    E Coli Xl1 Blue Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 89/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli xl1 blue cells/product/Millipore
    Average 89 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli xl1 blue cells - by Bioz Stars, 2020-04
    89/100 stars

    Images

    1) Product Images from "YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity"

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity

    Journal:

    doi: 10.1101/gad.1729508

    YmdB and RNase III interactions. ( A ) Coprecipitation of RNase III with biotin-tagged YmdB. Streptavidin-conjugated agarose beads were added to extracts from XL1 cells containing plasmids pDW363 or pDW363-YmdB, and protein coprecipitated with beads was
    Figure Legend Snippet: YmdB and RNase III interactions. ( A ) Coprecipitation of RNase III with biotin-tagged YmdB. Streptavidin-conjugated agarose beads were added to extracts from XL1 cells containing plasmids pDW363 or pDW363-YmdB, and protein coprecipitated with beads was

    Techniques Used:

    Related Articles

    Clone Assay:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. The gene encoding truncated DAH7PS was amplified from wild-type plasmid and ligated into the pENTR/TEV/dTOPO vector using the Gateway cloning technology (Invitrogen).

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: The gene was subcloned into the pET-YSBLIC-3C vector, in which cloned genes become equipped with a sequence encoding an N-terminal His6 tag. .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Full-length YmdB was cloned into XhoI and BamHI site of pDW363 vector ( ). .. Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Paragraph title: 2.1. Gene cloning, expression and protein purification ... The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: The full-length cDNA clone was named CeTop3α ( C.elegans DNA topoisomerase IIIα), nearly all of which (nt 25–2307) was cloned between the Bam HI and Eco RI sites in pGEX-5X-2 plasmid DNA (Amersham-Pharmacia). .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM.

    Centrifugation:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. Expression of biotin-tagged YmdB was initiated by 1 mM of IPTG when the culture OD600 reached ∼0.4 and induced for 3 h. Cells were harvested by centrifugation at 5000 rpm for 10 min and resuspended in 1/5 volume of ice-cold NP-40 lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris at pH 8.0).

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. The cell lysate was cleared by centrifugation at 12 000 g for 30 min (4°C) and then fractionated by glutathione–agarose column chromatography.

    Amplification:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. The gene encoding truncated DAH7PS was amplified from wild-type plasmid and ligated into the pENTR/TEV/dTOPO vector using the Gateway cloning technology (Invitrogen).

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified. .. They were purified using miniprep kits and the deletion was confirmed by DNA sequencing.

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: The HbpA gene was amplified by PCR from the template plasmid by using the primers 5′-CCAGG GACCA GCAAT GTCGA ATTCT GCAGA AACTG ATGTT CTTAT TGTGG-3′ (forward) and 5′-GAGGA GAAGG CGCGT TACGC CCTCC CAAGG ATGCT CTTCA C-3′ (reverse). .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: The gene encoding A1R958 ( AAur_3069 ) was amplified by PCR from the genomic DNA using the following primers: CCAGGGACCAGCAATGACCACCACCGCGAACGAACTCTC (forward) and GAGGAGAAGGCGCGTTACTGCGCAAGCAACCGGGTTGC (reverse). .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Construct:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: To construct a full-length cDNA of C.elegans DNA topoisomerase IIIα, the CeTop3αSL1 cDNA fragment was excised from the recombinant pGEM-T and cloned between the Bcl I and Pst I sites of recombinant pBluescript SK(–) DNA containing the CeTop3αA cDNA. .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM.

    Incubation:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    Expressing:

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: Experimental Section HbpA gene cloning, expression and protein purification : The gene encoding HbpA was provided by Bartlomiej Tomaszewski (Technical University of Dortmund, Germany). .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. Expression of biotin-tagged YmdB was initiated by 1 mM of IPTG when the culture OD600 reached ∼0.4 and induced for 3 h. Cells were harvested by centrifugation at 5000 rpm for 10 min and resuspended in 1/5 volume of ice-cold NP-40 lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris at pH 8.0).

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Paragraph title: 2.1. Gene cloning, expression and protein purification ... The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Paragraph title: Expression of C.elegans DNA topoisomerase IIIα in E.coli ... Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM.

    BIA-KA:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. The protein concentration was determined by BCA method (BCA Protein Assay Kit, Pierce).

    Transformation Assay:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: .. Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. The gene encoding truncated DAH7PS was amplified from wild-type plasmid and ligated into the pENTR/TEV/dTOPO vector using the Gateway cloning technology (Invitrogen).

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified. .. They were purified using miniprep kits and the deletion was confirmed by DNA sequencing.

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: .. Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. Expression of biotin-tagged YmdB was initiated by 1 mM of IPTG when the culture OD600 reached ∼0.4 and induced for 3 h. Cells were harvested by centrifugation at 5000 rpm for 10 min and resuspended in 1/5 volume of ice-cold NP-40 lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris at pH 8.0).

    Countercurrent Chromatography:

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: First, to prepare the deletion variant, the forward and reverse primers for the deletion were as follows: 5'–GTT TAA CTT TAA GAA GGA GAT ATA CAT ATG CTT GAG CCA CCC CCC TCT ACG TTC–3', and 5'–GAA CGT AGA GGG GGG TGG CTC AAG CAT ATG TAT ATC TCC TTC TTA AAG TTA AAC–3'. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Ligation:

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Following gel analysis of the PCR product, a band of the appropriate size was eluted using a PCR Cleanup kit (Qiagen) and the gene was cloned into the pET-YSBL-LIC-3C vector using a previously described ligation-independent cloning (LIC) procedure (Atkin et al. , 2008 ). .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Cell Culture:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: .. Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. Expression of biotin-tagged YmdB was initiated by 1 mM of IPTG when the culture OD600 reached ∼0.4 and induced for 3 h. Cells were harvested by centrifugation at 5000 rpm for 10 min and resuspended in 1/5 volume of ice-cold NP-40 lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris at pH 8.0).

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    DNA Sequencing:

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified. .. They were purified using miniprep kits and the deletion was confirmed by DNA sequencing.

    Protein Concentration:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. The protein concentration was determined by BCA method (BCA Protein Assay Kit, Pierce).

    Sequencing:

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene. .. The recombinant plasmid containing the HbpA was used to transform E. coli BL21(DE3) cells by using kanamycin (30 μg mL−1 ) as antibiotic marker on lysogeny broth (LB) agar.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen). .. Small cultures of transformants yielded plasmids using standard miniprep techniques that were submitted for sequencing to confirm the integrity of the gene.

    Sonication:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    Recombinant:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. Transformants harboring the recombinant plasmids were grown at 37 °C in Luria-Bertani medium supplemented with ampicillin (100 μg ml−1 ).

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: Paragraph title: Preparation of recombinant ATAS ... Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene. .. The recombinant plasmid containing the HbpA was used to transform E. coli BL21(DE3) cells by using kanamycin (30 μg mL−1 ) as antibiotic marker on lysogeny broth (LB) agar.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen). .. Small cultures of transformants yielded plasmids using standard miniprep techniques that were submitted for sequencing to confirm the integrity of the gene.

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    In Vivo:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Paragraph title: Detection of protein interactions in vivo ... Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C.

    Mutagenesis:

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: To minimize molecular disorder and simplify enzyme purification, a new truncation variant of ATAS was prepared in which the first 12 residues at the N terminus were deleted and replaced by a hexahistidine tag using PCR mutagenesis. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Isolation:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: .. Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. The gene encoding truncated DAH7PS was amplified from wild-type plasmid and ligated into the pENTR/TEV/dTOPO vector using the Gateway cloning technology (Invitrogen).

    Purification:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Standard methodologies were used to amplify the Tma DAH7PS gene (locus tag TM0343) from T. maritima MSB8 (DSM 3109) purified genomic DNA as template and ligate the PCR product into pT7-7 ( ). .. Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen).

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: To minimize molecular disorder and simplify enzyme purification, a new truncation variant of ATAS was prepared in which the first 12 residues at the N terminus were deleted and replaced by a hexahistidine tag using PCR mutagenesis. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. The lysate was further purified through a heparin–agarose column, from which the overexpressed polypeptide was eluted in a buffer solution (20 mM Tris–HCl, pH 8.0, 1 mM DTT) containing 250 mM KCl.

    Protein Purification:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Paragraph title: Bacterial Strains, Plasmids, and Protein Purification ... Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen).

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: Experimental Section HbpA gene cloning, expression and protein purification : The gene encoding HbpA was provided by Bartlomiej Tomaszewski (Technical University of Dortmund, Germany). .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Paragraph title: 2.1. Gene cloning, expression and protein purification ... The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Polymerase Chain Reaction:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: Standard methodologies were used to amplify the Tma DAH7PS gene (locus tag TM0343) from T. maritima MSB8 (DSM 3109) purified genomic DNA as template and ligate the PCR product into pT7-7 ( ). .. Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen).

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: To minimize molecular disorder and simplify enzyme purification, a new truncation variant of ATAS was prepared in which the first 12 residues at the N terminus were deleted and replaced by a hexahistidine tag using PCR mutagenesis. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: Following agarose gel analysis of the PCR product, the relevant band was eluted from the gel by using a PCR Cleanup kit (Qiagen). .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Following gel analysis of the PCR product, a band of the appropriate size was eluted using a PCR Cleanup kit (Qiagen) and the gene was cloned into the pET-YSBL-LIC-3C vector using a previously described ligation-independent cloning (LIC) procedure (Atkin et al. , 2008 ). .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Positron Emission Tomography:

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: The gene was then subcloned into the pET-YSBLIC-3C vector according to published techniques. .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: Following gel analysis of the PCR product, a band of the appropriate size was eluted using a PCR Cleanup kit (Qiagen) and the gene was cloned into the pET-YSBL-LIC-3C vector using a previously described ligation-independent cloning (LIC) procedure (Atkin et al. , 2008 ). .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: First, to prepare the deletion variant, the forward and reverse primers for the deletion were as follows: 5'–GTT TAA CTT TAA GAA GGA GAT ATA CAT ATG CTT GAG CCA CCC CCC TCT ACG TTC–3', and 5'–GAA CGT AGA GGG GGG TGG CTC AAG CAT ATG TAT ATC TCC TTC TTA AAG TTA AAC–3'. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Plasmid Preparation:

    Article Title: Tyrosine Latching of a Regulatory Gate Affords Allosteric Control of Aromatic Amino Acid Biosynthesis *
    Article Snippet: .. Plasmid DNA, isolated from transformed E. coli XL1-Blue cells, was transformed into E. coli BL21(DE3)-Rosetta cells (Novagen). .. The gene encoding truncated DAH7PS was amplified from wild-type plasmid and ligated into the pENTR/TEV/dTOPO vector using the Gateway cloning technology (Invitrogen).

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene. .. The recombinant plasmid containing the HbpA was used to transform E. coli BL21(DE3) cells by using kanamycin (30 μg mL−1 ) as antibiotic marker on lysogeny broth (LB) agar.

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Full-length YmdB was cloned into XhoI and BamHI site of pDW363 vector ( ). .. Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: .. The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen). .. Small cultures of transformants yielded plasmids using standard miniprep techniques that were submitted for sequencing to confirm the integrity of the gene.

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    Binding Assay:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    Agarose Gel Electrophoresis:

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: Following agarose gel analysis of the PCR product, the relevant band was eluted from the gel by using a PCR Cleanup kit (Qiagen). .. [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene.

    Column Chromatography:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. The cell lysate was cleared by centrifugation at 12 000 g for 30 min (4°C) and then fractionated by glutathione–agarose column chromatography.

    Concentration Assay:

    Article Title: Functional characterization of Caenorhabditis elegans DNA topoisomerase III?
    Article Snippet: .. Escherichia coli XL1-Blue cells harboring the recombinant pGEX-5X-2/CeTop3α plasmid were cultured at 30°C until the cell density reached 0.4 OD600 nm and then isopropyl-thio-β- d -galactoside (IPTG; Calbiochem) was added to the culture at a final concentration of 0.5 mM. .. After further incubation for 5 h, the cells were harvested and sonicated in binding buffer [1× phosphate-buffered saline, 1 mM dithiothreitol (DTT), 1 mM phenylmethylsulfonyl fluoride].

    Marker:

    Article Title: Structures of the Apo and FAD-Bound Forms of 2-Hydroxybiphenyl 3-monooxygenase (HbpA) Locate Activity Hotspots Identified by Using Directed Evolution
    Article Snippet: [ ] The recombinant plasmid was used to transform E. coli XL1-Blue cells (Novagen), yielding colonies that, in turn, gave plasmids by standard miniprep procedures; these were sequenced to confirm the identity and sequence of the gene. .. The recombinant plasmid containing the HbpA was used to transform E. coli BL21(DE3) cells by using kanamycin (30 μg mL−1 ) as antibiotic marker on lysogeny broth (LB) agar.

    Article Title: Structures of a γ-aminobutyrate (GABA) transaminase from the s-triazine-degrading organism Arthrobacter aurescens TC1 in complex with PLP and with its external aldimine PLP–GABA adduct
    Article Snippet: The recombinant plasmid was then used to transform E. coli XL1-Blue cells (Novagen). .. The recombinant vector containing the A1R958 gene was then used to transform E. coli BL21 (DE3) cells using 30 µg ml−1 kanamycin as an antibiotic marker on Luria–Bertani (LB) agar.

    Lysis:

    Article Title: YmdB: a stress-responsive ribonuclease-binding regulator of E. coli RNase III activity
    Article Snippet: Then, E. coli XL1 blue cells were transformed with pDW363 or pDW363-YmdB, and the resulting cells were cultured in LB media containing 8 μg/mL of D-biotin (Sigma-Aldrich) at 37°C. .. Expression of biotin-tagged YmdB was initiated by 1 mM of IPTG when the culture OD600 reached ∼0.4 and induced for 3 h. Cells were harvested by centrifugation at 5000 rpm for 10 min and resuspended in 1/5 volume of ice-cold NP-40 lysis buffer (150 mM sodium chloride, 1.0% NP-40, 50 mM Tris at pH 8.0).

    Variant Assay:

    Article Title: Mechanistic Insights from the Binding of Substrate and Carbocation Intermediate Analogues to Aristolochene Synthase
    Article Snippet: First, to prepare the deletion variant, the forward and reverse primers for the deletion were as follows: 5'–GTT TAA CTT TAA GAA GGA GAT ATA CAT ATG CTT GAG CCA CCC CCC TCT ACG TTC–3', and 5'–GAA CGT AGA GGG GGG TGG CTC AAG CAT ATG TAT ATC TCC TTC TTA AAG TTA AAC–3'. .. Plasmids were transformed into Escherichia coli XL1-Blue cells (Novagen) and amplified.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore escherichia coli xl1 blue cells
    Escherichia Coli Xl1 Blue Cells, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli xl1 blue cells/product/Millipore
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    escherichia coli xl1 blue cells - by Bioz Stars, 2020-04
    99/100 stars
      Buy from Supplier

    Image Search Results