e coli transformation  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    transformation
    Description:
    BL21 T1R are competent E coli that are suitable for high level expression production of heterologous proteins regulated by various expression vector systems The cells have transformation efficiency of 3x106 cfu mug when transformed with non saturating amounts of pUC19 plasmid DNA
    Catalog Number:
    b2685
    Price:
    None
    Applications:
    Suitable for expression and production of proteins directed by a range of expression systems with promoters such as lac, trc, tac, lambdaPL and araD
    Buy from Supplier


    Structured Review

    Millipore e coli transformation
    BL21 T1R are competent E coli that are suitable for high level expression production of heterologous proteins regulated by various expression vector systems The cells have transformation efficiency of 3x106 cfu mug when transformed with non saturating amounts of pUC19 plasmid DNA
    https://www.bioz.com/result/e coli transformation/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    e coli transformation - by Bioz Stars, 2020-03
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri
    Article Snippet: PCR amplification for cloning purposes were performed with KOD hot start DNA polymerase (Novagen). .. Prior to restriction digestion, ligation or transformation DNA was precipitated with Pellet Paint Co-precipitant (Novagen).

    Article Title: An efficient CRISPR vector toolbox for engineering large deletions in Arabidopsis thaliana
    Article Snippet: Assembly of SM-sgRNA shuffle-in vector The sgRNA expression units were assembled into SM Destination vectors using Golden gate cloning [ ]. .. The reaction product was directly used for E. coli transformation, with antibiotics of Spectinomycin (Sigma) and X-Gal (X-galactopyranoside, Sigma).

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Preparatory steps of recombineering E. coli strains with BAC clones carrying the studied Arabidopsis genes were obtained from the Arabidopsis Biological Research Center (ABRC) and maintained by selecting for the BAC‐encoded antibiotic resistance marker, if not stated otherwise. .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Paragraph title: Cloning procedures ... Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: A 3,929-bp PCR fragment of the p -aminobenzoic acid synthetase gene (Cc pab1 ) with its promoter and terminator was ligated into the cloning site of plasmids pEASY-Blunt Zero (CB501; Transgen) to generate plasmid pCc pab-1 ( , , ). .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ).

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: Candidate TF coding sequences were transferred from pENTR/D to the TF-overexpression vector pCsVMV-GW generated in this work using the pCsVMV-PP2C-AmiR vector backbone ( ) via Gateway recombination-based cloning (Life Technologies). .. After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid.

    Amplification:

    Article Title: Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri
    Article Snippet: PCR amplification for cloning purposes were performed with KOD hot start DNA polymerase (Novagen). .. Prior to restriction digestion, ligation or transformation DNA was precipitated with Pellet Paint Co-precipitant (Novagen).

    Article Title: Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks
    Article Snippet: The vector pBSV2 and the primer amplicon were digested with KpnI, and then the BBE22 amplicon was ligated into the shuttle vector to create pBSV2+22. .. The transformation mixture was then transferred to 50 ml of BSK-H containing kanamycin (Sigma, St. Louis, MO) and incubated at 37°C.

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Each BAC was verified by PCR amplification using Taq DNA polymerase (New England Biolabs, NEB) with two primers flanking the position of target site (i.e. stop codons) in the studied plant gene (Table and Figure ). .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen). .. Candidate clones were sequenced to confirm the successful introduction of the point mutations.

    Filtration:

    Article Title: TFG clusters COPII-coated transport carriers and promotes early secretory pathway organization
    Article Snippet: Recombinant protein expression was performed using BL21 (T1R , Sigma B2685) E. coli , and purifications were conducted using glutathione agarose beads (for GST fusions) or nickel affinity resin (for His-SUMO-tagged proteins). .. For samples applied to a S200 gel filtration column, the Stokes radius of each protein or protein complex was calculated from its elution volume based on the elution profiles of characterized standards.

    Construct:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen). .. For comparative β-Gal liquid assays deletion constructs of the SmDia inter-domain region have been generated (ID1 and ID2) by an in vitro mutagenesis approach employing the reverse complementary primer pairs SmDia#402 (sense: 5′- CAGAGTGGCTATTATGGCCGGGG AATGATGGTGTCGATCCTGATCC-3′ antisense: 5′-GGATCAGGATCGACACCATCATT CCCCGGCCATAATAGCCACTCTG -3′ ) and SmDia#432 (sense: 5′- CAGAGTGGCTATTATGGCCGGGG GCTGACGCTTCAACTCGTGTTGAG-3′ antisense: 5′-CTCAACACGAGTTGAAGCGTCAGC CCCCGGCCATAATAGCCACTCTG -3′ ), respectively.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: Considering the relative differences in the sizes of the cotransformed molecules, the equal masses introduced corresponded to an approximately twofold molar excess of the gene knockout construct (pDMAT1, 4.5 kb) relative to the selectable marker (pMOcosX, 8.8 kb). .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: Protoplasts were co-transformed following a previously published procedure , with a TF-overexpression (or control) vector (5 μg per 4 kb) and the reporter vector pOmegaCCA1-LUC_SK+ ( ) (1 μg per 4 kb) that contains a CCA1::LUC+ reporter construct. .. After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid.

    Incubation:

    Article Title: Bacterial Cell Morphogenesis Does Not Require a Preexisting Template Structure
    Article Snippet: Proliferating L-form cultures (Δ18 ::tet ) were diluted at 10−3 into fresh NB/MSM medium (10 ml) and incubated at 30°C until OD600 = ∼0.2 (2 days). .. For L-form transformation, 150 μl of the L-form and plasmid mixture was transferred into 450 μl of MSM containing 40% PEG6000 (Sigma-Aldrich) and gently mixed.

    Article Title: Effect of Single and Combined Expression of Lysophosphatidic Acid Acyltransferase, Glycerol-3-Phosphate Acyltransferase, and Diacylglycerol Acyltransferase on Lipid Accumulation and Composition in Neochloris oleoabundans
    Article Snippet: .. The transformation mixture containing 2 µg · ml-1 of linearized plasmid and 25 µg · ml-1 of boiled salmon sperm DNA (D1626, Sigma) were incubated on ice for 15 min. .. The electroporation was performed in 2-mm electroporation cuvettes by applying 6 kV · cm-1 .

    Article Title: Vesicle-Mediated Transfer of Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria
    Article Snippet: Samples (2 ml) for the Vero cell assay (as described below) were collected after 5 and 20 h of incubation after the addition of LB broth. .. To ensure that vesicles were responsible for DNA transformation and not bacteriophages ( , ), vesicle samples were treated with 50 μg of proteinase K (Sigma) ml−1 for 30 min at 37°C to hydrolyze phage coats and release phage contents.

    Article Title: Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks
    Article Snippet: .. The transformation mixture was then transferred to 50 ml of BSK-H containing kanamycin (Sigma, St. Louis, MO) and incubated at 37°C. ..

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: BAC DNA was isolated by the alkaline lysis procedure (Sambrook and Russell, ) following incubation of cells in buffer I (50 mm Tris–HCl (pH 8.0), 50 mm glucose, and 20 mm EDTA and 1 mg mL−1 lysozyme) for 30 min at 20°C. .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ). .. Transformation plates were incubated at 37°C for 2 days, and hygromycin-resistant colonies were transferred onto PDA plates containing 400 μg/ml hygromycin.

    Cell Culture:

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O. .. The recombineering E. coli host SW102 was always cultured at 32°C.

    Expressing:

    Article Title: Bacterial Cell Morphogenesis Does Not Require a Preexisting Template Structure
    Article Snippet: The culture was centrifuged at 8,000 rpm for 10 min, and the L-forms were resuspended in 300 μl of NB/MSM medium and then mixed with 2 μg of murC expression plasmid. .. For L-form transformation, 150 μl of the L-form and plasmid mixture was transferred into 450 μl of MSM containing 40% PEG6000 (Sigma-Aldrich) and gently mixed.

    Article Title: An efficient CRISPR vector toolbox for engineering large deletions in Arabidopsis thaliana
    Article Snippet: Assembly of SM-sgRNA shuffle-in vector The sgRNA expression units were assembled into SM Destination vectors using Golden gate cloning [ ]. .. The reaction product was directly used for E. coli transformation, with antibiotics of Spectinomycin (Sigma) and X-Gal (X-galactopyranoside, Sigma).

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O. .. For recombineering, 4 mL culture was pelleted by 8000 rpm for 1 min in a tabletop centrifuge, resuspended in 1 mL LB medium and incubated by shaking at 42°C for 15 min to induce the expression of λRed genes.

    Article Title: A β-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn’s Disease and Control Subjects
    Article Snippet: To study uptake mechanisms of β-glucan, two endocytosis inhibitors were used; MβCD, which chelates cholesterol from the plasma membrane, has previously been shown to decrease the translocation of β-glucan expressing fungi by inhibiting lipid raft formation. .. Upon M cell-transformation, monolayers were washed and preincubated with HBSS with or without the addition of 3 mM MβCD (Sigma-Aldrich) or 30 µM CPZ (Fluka) at 37°C for 20 minutes.

    Article Title: TFG clusters COPII-coated transport carriers and promotes early secretory pathway organization
    Article Snippet: .. Recombinant protein expression was performed using BL21 (T1R , Sigma B2685) E. coli , and purifications were conducted using glutathione agarose beads (for GST fusions) or nickel affinity resin (for His-SUMO-tagged proteins). .. For samples applied to a S200 gel filtration column, the Stokes radius of each protein or protein complex was calculated from its elution volume based on the elution profiles of characterized standards.

    Modification:

    Article Title: Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks
    Article Snippet: Strain A3-pB was created by transformation with pBSV2 by using methods modified from those of Samuels ( ). .. The transformation mixture was then transferred to 50 ml of BSK-H containing kanamycin (Sigma, St. Louis, MO) and incubated at 37°C.

    Transformation Assay:

    Article Title: Bacterial Cell Morphogenesis Does Not Require a Preexisting Template Structure
    Article Snippet: .. For L-form transformation, 150 μl of the L-form and plasmid mixture was transferred into 450 μl of MSM containing 40% PEG6000 (Sigma-Aldrich) and gently mixed. ..

    Article Title: Restoring catalase activity in Staphylococcus aureus subsp. anaerobius leads to loss of pathogenicity for lambs
    Article Snippet: .. DNA manipulation and transformation Total DNA from S. aureus and S. aureus subsp. anaerobius was extracted by the cetyltrimethylammonium bromide method after pretreatment of bacteria with lysostaphin (30 μg/mL; Sigma-Aldrich, Tres Cantos, Madrid, Spain) at 37 °C for 1 h in Tris/EDTA/sucrose [ ]. .. Plasmid DNA isolation was performed using the Plasmid Purification Kit (Qiagen, Las Matas, Madrid, Spain).

    Article Title: Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri
    Article Snippet: .. Prior to restriction digestion, ligation or transformation DNA was precipitated with Pellet Paint Co-precipitant (Novagen). ..

    Article Title: An efficient CRISPR vector toolbox for engineering large deletions in Arabidopsis thaliana
    Article Snippet: .. The reaction product was directly used for E. coli transformation, with antibiotics of Spectinomycin (Sigma) and X-Gal (X-galactopyranoside, Sigma). .. White colonies were grown in liquid culture (usually one) overnight and plasmids were extracted using the GeneJET Plasmid Miniprep Kit (Thermo Scientific).

    Article Title: Effect of Single and Combined Expression of Lysophosphatidic Acid Acyltransferase, Glycerol-3-Phosphate Acyltransferase, and Diacylglycerol Acyltransferase on Lipid Accumulation and Composition in Neochloris oleoabundans
    Article Snippet: .. The transformation mixture containing 2 µg · ml-1 of linearized plasmid and 25 µg · ml-1 of boiled salmon sperm DNA (D1626, Sigma) were incubated on ice for 15 min. .. The electroporation was performed in 2-mm electroporation cuvettes by applying 6 kV · cm-1 .

    Article Title: Vesicle-Mediated Transfer of Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria
    Article Snippet: .. To ensure that vesicles were responsible for DNA transformation and not bacteriophages ( , ), vesicle samples were treated with 50 μg of proteinase K (Sigma) ml−1 for 30 min at 37°C to hydrolyze phage coats and release phage contents. .. Prior to transformation, proteinase K was removed from treated samples using microconcentrators that exclude molecules with an M r of < 30,000 (Millipore Corp., Bedford, Mass.).

    Article Title: Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks
    Article Snippet: .. The transformation mixture was then transferred to 50 ml of BSK-H containing kanamycin (Sigma, St. Louis, MO) and incubated at 37°C. ..

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O. .. The recombineering E. coli host SW102 was always cultured at 32°C.

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen). .. Candidate clones were sequenced to confirm the successful introduction of the point mutations.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ). .. Transformation plates were incubated at 37°C for 2 days, and hygromycin-resistant colonies were transferred onto PDA plates containing 400 μg/ml hygromycin.

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ). ..

    Article Title: A Conserved Pattern of Primer-Dependent Transcription Initiation in Escherichia coli and Vibrio cholerae Revealed by 5′ RNA-seq
    Article Snippet: .. E . coli experiments Plasmids pPSV38 and pNrnB-VSVG were each separately introduced into MG1655 cells by transformation followed by plating onto LB-agar (LB-agar, Miller; EMD Millipore) containing gentamycin (10 ug/mL). ..

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: Paragraph title: Arabidopsis protoplasts isolation and transformation ... After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid.

    Translocation Assay:

    Article Title: A β-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn’s Disease and Control Subjects
    Article Snippet: Paragraph title: Studies of Yeast-derived β-glucan Translocation ... Upon M cell-transformation, monolayers were washed and preincubated with HBSS with or without the addition of 3 mM MβCD (Sigma-Aldrich) or 30 µM CPZ (Fluka) at 37°C for 20 minutes.

    Electroporation:

    Article Title: Restoring catalase activity in Staphylococcus aureus subsp. anaerobius leads to loss of pathogenicity for lambs
    Article Snippet: DNA manipulation and transformation Total DNA from S. aureus and S. aureus subsp. anaerobius was extracted by the cetyltrimethylammonium bromide method after pretreatment of bacteria with lysostaphin (30 μg/mL; Sigma-Aldrich, Tres Cantos, Madrid, Spain) at 37 °C for 1 h in Tris/EDTA/sucrose [ ]. .. Protoplast transformation was not possible in S. aureus subsp. anaerobius , therefore, plasmids were introduced in this bacterium by electroporation in 0.2-mm cuvettes (Bio-Rad, Alcobendas, Madrid, Spain) at 2.5 kV, 25 μF and 100 Ω, using a Bio-Rad Gene Pulser, as described previously [ ].

    Article Title: Effect of Single and Combined Expression of Lysophosphatidic Acid Acyltransferase, Glycerol-3-Phosphate Acyltransferase, and Diacylglycerol Acyltransferase on Lipid Accumulation and Composition in Neochloris oleoabundans
    Article Snippet: Paragraph title: Transformation of N. oleoabundans by Electroporation ... The transformation mixture containing 2 µg · ml-1 of linearized plasmid and 25 µg · ml-1 of boiled salmon sperm DNA (D1626, Sigma) were incubated on ice for 15 min.

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O. .. The recombineering E. coli host SW102 was always cultured at 32°C.

    Ligation:

    Article Title: Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri
    Article Snippet: .. Prior to restriction digestion, ligation or transformation DNA was precipitated with Pellet Paint Co-precipitant (Novagen). ..

    Introduce:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Two additional sets of primer pairs were designed to induce mutations by site-directed mutagenesis into this sequence by a whole-plasmid (circular template) PCR approach (SmRho G 15 V s: 5′-GTTGGAGATG T TGCATGCGG-3′ /SmRhoG15 V as: 5′-CCGCATGCA A CATCTCCAAC-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange G15V; SmRho Q 64 L s: 5′-CTGCTGGCC T AGAAGATTATG-3′ /SmRho Q 64 L as: 5′-CATAATCTTCT A GGCCAGCAG-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange Q64L). .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Sedimentation:

    Article Title: TFG clusters COPII-coated transport carriers and promotes early secretory pathway organization
    Article Snippet: Recombinant protein expression was performed using BL21 (T1R , Sigma B2685) E. coli , and purifications were conducted using glutathione agarose beads (for GST fusions) or nickel affinity resin (for His-SUMO-tagged proteins). .. Sedimentation values were calculated by comparing the position of the peak with that of characterized standards run on a separate gradient in parallel.

    Generated:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: To avoid unspecific membrane targeting by prenylation of the C-terminally located CAAX motif, SmRho sequence variants without CAAX were generated by a PCR-based strategy using the primer pair Rho-5′Bam ( 5′-CG GGATCC TAATGGCGAGTGCGGTACG-3′ ; containing a Bam HI restriction site) and Rho-3′Bam ( 5′-CG GGATCC CTAGAAGTAGCGAGTCACCA-3′ ; containing a Bam HI restriction site). .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: Candidate TF coding sequences were transferred from pENTR/D to the TF-overexpression vector pCsVMV-GW generated in this work using the pCsVMV-PP2C-AmiR vector backbone ( ) via Gateway recombination-based cloning (Life Technologies). .. After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid.

    Article Title: A β-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn’s Disease and Control Subjects
    Article Snippet: Upon M cell-transformation, monolayers were washed and preincubated with HBSS with or without the addition of 3 mM MβCD (Sigma-Aldrich) or 30 µM CPZ (Fluka) at 37°C for 20 minutes. .. The fluorescence intensity data generated from these measurements were used for subsequent statistical analysis.

    Imaging:

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid. .. Bioluminescence imaging was performed as described below.

    Sequencing:

    Article Title: An efficient CRISPR vector toolbox for engineering large deletions in Arabidopsis thaliana
    Article Snippet: The reaction product was directly used for E. coli transformation, with antibiotics of Spectinomycin (Sigma) and X-Gal (X-galactopyranoside, Sigma). .. We confirmed integration of sgRNA units and the completeness of other components such as pcoCas9 sequences with Sanger sequencing.

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Two additional sets of primer pairs were designed to induce mutations by site-directed mutagenesis into this sequence by a whole-plasmid (circular template) PCR approach (SmRho G 15 V s: 5′-GTTGGAGATG T TGCATGCGG-3′ /SmRhoG15 V as: 5′-CCGCATGCA A CATCTCCAAC-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange G15V; SmRho Q 64 L s: 5′-CTGCTGGCC T AGAAGATTATG-3′ /SmRho Q 64 L as: 5′-CATAATCTTCT A GGCCAGCAG-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange Q64L). .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: Nucleotide base pairs (bp) 750 to 1 of the antisense fragment sequence and bp 101 to 750 of the sense fragment sequence of c hiE1 or c hiIII were ligated into Noc1 and KpnI sites, respectively, of the plasmid pCcExp to generate plasmids pCc chiE1 dsRNA and pCc chiIII dsRNA, respectively. .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ).

    Recombinant:

    Article Title: TFG clusters COPII-coated transport carriers and promotes early secretory pathway organization
    Article Snippet: .. Recombinant protein expression was performed using BL21 (T1R , Sigma B2685) E. coli , and purifications were conducted using glutathione agarose beads (for GST fusions) or nickel affinity resin (for His-SUMO-tagged proteins). .. For samples applied to a S200 gel filtration column, the Stokes radius of each protein or protein complex was calculated from its elution volume based on the elution profiles of characterized standards.

    DNA Extraction:

    Article Title: Restoring catalase activity in Staphylococcus aureus subsp. anaerobius leads to loss of pathogenicity for lambs
    Article Snippet: DNA manipulation and transformation Total DNA from S. aureus and S. aureus subsp. anaerobius was extracted by the cetyltrimethylammonium bromide method after pretreatment of bacteria with lysostaphin (30 μg/mL; Sigma-Aldrich, Tres Cantos, Madrid, Spain) at 37 °C for 1 h in Tris/EDTA/sucrose [ ]. .. Plasmid DNA isolation was performed using the Plasmid Purification Kit (Qiagen, Las Matas, Madrid, Spain).

    Gene Knockout:

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: Considering the relative differences in the sizes of the cotransformed molecules, the equal masses introduced corresponded to an approximately twofold molar excess of the gene knockout construct (pDMAT1, 4.5 kb) relative to the selectable marker (pMOcosX, 8.8 kb). .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Fluorescence:

    Article Title: A β-Glucan-Based Dietary Fiber Reduces Mast Cell-Induced Hyperpermeability in Ileum From Patients With Crohn’s Disease and Control Subjects
    Article Snippet: Upon M cell-transformation, monolayers were washed and preincubated with HBSS with or without the addition of 3 mM MβCD (Sigma-Aldrich) or 30 µM CPZ (Fluka) at 37°C for 20 minutes. .. Basolateral media were collected in triplicates and β-glucan fluorescence was measured in Modulus Microplate Photometer (λex = 525nm, λem = 580–640 nm).

    Mutagenesis:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Two additional sets of primer pairs were designed to induce mutations by site-directed mutagenesis into this sequence by a whole-plasmid (circular template) PCR approach (SmRho G 15 V s: 5′-GTTGGAGATG T TGCATGCGG-3′ /SmRhoG15 V as: 5′-CCGCATGCA A CATCTCCAAC-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange G15V; SmRho Q 64 L s: 5′-CTGCTGGCC T AGAAGATTATG-3′ /SmRho Q 64 L as: 5′-CATAATCTTCT A GGCCAGCAG-3′ ; both primers overlap to complementary introduce a single point mutation leading to the amino acid exchange Q64L). .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Isolation:

    Article Title: Vesicle-Mediated Transfer of Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria
    Article Snippet: Bacteriophages, if present, may contaminate vesicle preparations during isolation. .. To ensure that vesicles were responsible for DNA transformation and not bacteriophages ( , ), vesicle samples were treated with 50 μg of proteinase K (Sigma) ml−1 for 30 min at 37°C to hydrolyze phage coats and release phage contents.

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: BAC DNA was isolated by the alkaline lysis procedure (Sambrook and Russell, ) following incubation of cells in buffer I (50 mm Tris–HCl (pH 8.0), 50 mm glucose, and 20 mm EDTA and 1 mg mL−1 lysozyme) for 30 min at 20°C. .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: Paragraph title: Arabidopsis protoplasts isolation and transformation ... After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid.

    Purification:

    Article Title: Restoring catalase activity in Staphylococcus aureus subsp. anaerobius leads to loss of pathogenicity for lambs
    Article Snippet: DNA manipulation and transformation Total DNA from S. aureus and S. aureus subsp. anaerobius was extracted by the cetyltrimethylammonium bromide method after pretreatment of bacteria with lysostaphin (30 μg/mL; Sigma-Aldrich, Tres Cantos, Madrid, Spain) at 37 °C for 1 h in Tris/EDTA/sucrose [ ]. .. Plasmid DNA isolation was performed using the Plasmid Purification Kit (Qiagen, Las Matas, Madrid, Spain).

    Article Title: Vesicle-Mediated Transfer of Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria
    Article Snippet: To ensure that vesicles were responsible for DNA transformation and not bacteriophages ( , ), vesicle samples were treated with 50 μg of proteinase K (Sigma) ml−1 for 30 min at 37°C to hydrolyze phage coats and release phage contents. .. To further demonstrate that DNA transfer was vesicle mediated, separate experiments were conducted using vesicles that were hydrolyzed with 50 mg of lysozyme ml−1 at 37°C for 30 min. A control experiment was conducted using 20 ng of purified total E. coli O157:H7 DNA.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ). .. Transformants yielding a fragment of the expected size for a gene knockout at dmaW (1.2 kb) were purified to nuclear homogeneity by culturing them from individual, germinated conidia.

    Article Title: TFG clusters COPII-coated transport carriers and promotes early secretory pathway organization
    Article Snippet: Paragraph title: Protein expression and purification and salt shifts ... Recombinant protein expression was performed using BL21 (T1R , Sigma B2685) E. coli , and purifications were conducted using glutathione agarose beads (for GST fusions) or nickel affinity resin (for His-SUMO-tagged proteins).

    Polymerase Chain Reaction:

    Article Title: Exploring optimization parameters to increase ssDNA recombineering in Lactococcus lactis and Lactobacillus reuteri
    Article Snippet: PCR amplification for cloning purposes were performed with KOD hot start DNA polymerase (Novagen). .. Prior to restriction digestion, ligation or transformation DNA was precipitated with Pellet Paint Co-precipitant (Novagen).

    Article Title: Vesicle-Mediated Transfer of Virulence Genes from Escherichia coli O157:H7 to Other Enteric Bacteria
    Article Snippet: For PCR experiments, cells were harvested, pelleted, washed twice, and resuspended in TE buffer. .. To ensure that vesicles were responsible for DNA transformation and not bacteriophages ( , ), vesicle samples were treated with 50 μg of proteinase K (Sigma) ml−1 for 30 min at 37°C to hydrolyze phage coats and release phage contents.

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O. .. The recombineering E. coli host SW102 was always cultured at 32°C.

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: PCR amplifications were done in 50 µl total volume using standard conditions (further technical details are available upon request). .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: The 651-bp dmaW PCR product was ligated into pCR2.1 (Invitrogen, Carlsbad, CA) based on T/A overhangs and was transformed into chemically competent Escherichia coli cells. .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: A 3,929-bp PCR fragment of the p -aminobenzoic acid synthetase gene (Cc pab1 ) with its promoter and terminator was ligated into the cloning site of plasmids pEASY-Blunt Zero (CB501; Transgen) to generate plasmid pCc pab-1 ( , , ). .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ).

    Periodic Counter-current Chromatography:

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: A 3,929-bp PCR fragment of the p -aminobenzoic acid synthetase gene (Cc pab1 ) with its promoter and terminator was ligated into the cloning site of plasmids pEASY-Blunt Zero (CB501; Transgen) to generate plasmid pCc pab-1 ( , , ). .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ).

    Plasmid Preparation:

    Article Title: Bacterial Cell Morphogenesis Does Not Require a Preexisting Template Structure
    Article Snippet: .. For L-form transformation, 150 μl of the L-form and plasmid mixture was transferred into 450 μl of MSM containing 40% PEG6000 (Sigma-Aldrich) and gently mixed. ..

    Article Title: Restoring catalase activity in Staphylococcus aureus subsp. anaerobius leads to loss of pathogenicity for lambs
    Article Snippet: DNA manipulation and transformation Total DNA from S. aureus and S. aureus subsp. anaerobius was extracted by the cetyltrimethylammonium bromide method after pretreatment of bacteria with lysostaphin (30 μg/mL; Sigma-Aldrich, Tres Cantos, Madrid, Spain) at 37 °C for 1 h in Tris/EDTA/sucrose [ ]. .. Plasmid DNA isolation was performed using the Plasmid Purification Kit (Qiagen, Las Matas, Madrid, Spain).

    Article Title: An efficient CRISPR vector toolbox for engineering large deletions in Arabidopsis thaliana
    Article Snippet: Paragraph title: Assembly of SM-sgRNA shuffle-in vector ... The reaction product was directly used for E. coli transformation, with antibiotics of Spectinomycin (Sigma) and X-Gal (X-galactopyranoside, Sigma).

    Article Title: Effect of Single and Combined Expression of Lysophosphatidic Acid Acyltransferase, Glycerol-3-Phosphate Acyltransferase, and Diacylglycerol Acyltransferase on Lipid Accumulation and Composition in Neochloris oleoabundans
    Article Snippet: .. The transformation mixture containing 2 µg · ml-1 of linearized plasmid and 25 µg · ml-1 of boiled salmon sperm DNA (D1626, Sigma) were incubated on ice for 15 min. .. The electroporation was performed in 2-mm electroporation cuvettes by applying 6 kV · cm-1 .

    Article Title: Role of Borrelia burgdorferi Linear Plasmid 25 in Infection of Ixodes scapularis Ticks
    Article Snippet: The vector pBSV2 and the primer amplicon were digested with KpnI, and then the BBE22 amplicon was ligated into the shuttle vector to create pBSV2+22. .. The transformation mixture was then transferred to 50 ml of BSK-H containing kanamycin (Sigma, St. Louis, MO) and incubated at 37°C.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: Cotransformation of the protoplasts with PpuMI-linearized pDMAT1 and the hygromycin resistance-conferring plasmid pMOcosX , which had been linearized at a unique NotI site, was performed as previously described , but with 2 μg of each DNA in 10 μl of water. .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Article Title: Chitinases Play a Key Role in Stipe Cell Wall Extension in the Mushroom Coprinopsis cinerea
    Article Snippet: A 3,929-bp PCR fragment of the p -aminobenzoic acid synthetase gene (Cc pab1 ) with its promoter and terminator was ligated into the cloning site of plasmids pEASY-Blunt Zero (CB501; Transgen) to generate plasmid pCc pab-1 ( , , ). .. For DNA transformation, protoplasts were prepared from oidia of strain AmutBmut using cellulase “Onozuka” R-10 (catalog no. 16419; Serva) and chitinase (catalog no. C6137; Sigma-Aldrich) and cotransformed with indicated plasmids (see Results for details) using polyethylene glycol (PEG)/CaCl2 methods ( , ).

    Article Title: A genome-scale resource for the functional characterization of Arabidopsis transcription factors
    Article Snippet: .. After plasmid co-transformation, cells were resuspended in a solution containing 5% fetal bovine serum (Sigma) and 50 μM luciferin (Biosynth) as described before , and 96-well plates were covered with a transparent plastic lid. .. Bioluminescence imaging was performed as described below.

    Agarose Gel Electrophoresis:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Amplification products of the expected size were eluted from an agarose gel and cloned via Bam HI restriction into pACT2. .. Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen).

    In Vitro:

    Article Title: The Formin-Homology Protein SmDia Interacts with the Src Kinase SmTK and the GTPase SmRho1 in the Gonads of Schistosoma mansoni
    Article Snippet: Amplification products were Dpn I-digested and 1 µl used E. coli transformation (NovaBlue GigaSingles™; Novagen). .. For comparative β-Gal liquid assays deletion constructs of the SmDia inter-domain region have been generated (ID1 and ID2) by an in vitro mutagenesis approach employing the reverse complementary primer pairs SmDia#402 (sense: 5′- CAGAGTGGCTATTATGGCCGGGG AATGATGGTGTCGATCCTGATCC-3′ antisense: 5′-GGATCAGGATCGACACCATCATT CCCCGGCCATAATAGCCACTCTG -3′ ) and SmDia#432 (sense: 5′- CAGAGTGGCTATTATGGCCGGGG GCTGACGCTTCAACTCGTGTTGAG-3′ antisense: 5′-CTCAACACGAGTTGAAGCGTCAGC CCCCGGCCATAATAGCCACTCTG -3′ ), respectively.

    Knock-Out:

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: Paragraph title: Knockout and complementation of dmaW in A. fumigatus . ... The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Alkaline Lysis:

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: BAC DNA was isolated by the alkaline lysis procedure (Sambrook and Russell, ) following incubation of cells in buffer I (50 mm Tris–HCl (pH 8.0), 50 mm glucose, and 20 mm EDTA and 1 mg mL−1 lysozyme) for 30 min at 20°C. .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    BAC Assay:

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Each BAC was verified by PCR amplification using Taq DNA polymerase (New England Biolabs, NEB) with two primers flanking the position of target site (i.e. stop codons) in the studied plant gene (Table and Figure ). .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Marker:

    Article Title: Gene modification by fast‐track recombineering for cellular localization and isolation of components of plant protein complexes
    Article Snippet: Preparatory steps of recombineering E. coli strains with BAC clones carrying the studied Arabidopsis genes were obtained from the Arabidopsis Biological Research Center (ABRC) and maintained by selecting for the BAC‐encoded antibiotic resistance marker, if not stated otherwise. .. Before E. coli transformation by electroporation (Dower et al ., ), the BACs and PCR‐amplified DNA fragments and binary vectors were drop‐dialyzed on Millipore membrane filters (MFTM 0.025 μm VSWP) floating on sterile H2 O.

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: Considering the relative differences in the sizes of the cotransformed molecules, the equal masses introduced corresponded to an approximately twofold molar excess of the gene knockout construct (pDMAT1, 4.5 kb) relative to the selectable marker (pMOcosX, 8.8 kb). .. The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ).

    Homologous Recombination:

    Article Title: An Ergot Alkaloid Biosynthesis Gene and Clustered Hypothetical Genes from Aspergillus fumigatus †
    Article Snippet: The transformation mixture was divided into six aliquots and plated on regeneration medium containing 300 μg/ml hygromycin (Calbiochem, La Jolla, CA) as previously described ( ). .. Transformants were screened for homologous recombination of pDMAT1 with the native dmaW gene by PCR (using the conditions described above, except that the annealing temperature was 57°C) with primer UF (5′-TGTAAAACGACGGCCAGTGAAT-3′), which annealed to vector sequences near the universal primer annealing site of pCR2.1, and primer 3S (5′-AAGTAAGTCCCGAGCTGTTCAT-3′), which annealed to dmaW sequences near the 3′ end of the gene and flanking the intended site of integration (Fig. ).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Millipore e coli transformation
    E Coli Transformation, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli transformation/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    e coli transformation - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results