e coli strain c2925  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs e coli strain c2925
    E Coli Strain C2925, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain c2925/product/New England Biolabs
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    e coli strain c2925 - by Bioz Stars, 2019-10
    99/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: Paragraph title: Cloning of expression constructs ... BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: Paragraph title: PPAR-γ promoter cloning and reporter gene assay ... To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: For cloning of the pol gene fragment encoding the RT polymerase domain, the DNA sequence containing 124 nt from the protease encoding region and RT polymerase domain was amplified by PCR from subtype B YU-2 molecular clone with forward primer F-NLpr-BclI (5'-ACAGTATGATCAGATACTCATAGAAATCTGCGG-3') containing BclI restriction enzyme site and reverse primer polCR2 (5'-ATACTCCATGTACCGGTTCTTTTAGAA-3') with an introduced AgeI site. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation.

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Assessment of chlamydial growth was accomplished by enumeration of progeny EBs from 24 hr cultures as described [ ]. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae. .. Where appropriate, 50 μg/ml carbenicillin was used for E . coli selection while 1.0 μg/ml cycloheximide and 0.6 μg/ml Penicillin G sodium (PenG) was used during chlamydial transformations.

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: This sequence, termed SP-lysozyme, was synthesized by Integrated DNA Technologies, Inc., Iowa, USA and cloned into pIDTSmart plasmid which encoded an ampicillin resistance cassette. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Unless otherwise stated, reagents were purchased from BioShop Canada (Burlington, ON, Canada), enzymes were purchased from New England Biolabs (Pickering, ON, Canada), and oligonucleotides were synthesized by Operon Biotechnologies (Huntsville, AL, USA). .. Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 MATa, ura3 – 52, his3 – 200, ade2 – 101, lys2 – 801, leu2 – 3, 112, trp1 – 901, tyr1 – 501, gal4 -Δ 512, gal80-Δ 538 , ade5::hisG ] was used for plasmid construction via homologous recombination and reporter strain construction.

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The vector pBR325::L2 was constructed by ligation of pL2 cleaved by Bam HI from plasmid PDCPB (this vector is equivalent to pBR322::L2) into Bam HI cleaved pBR325 (GenBank: L08855.1), this cloning was performed in E. coli strain HB101. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: The spliced product, in which the native cetZ promoter was swapped for Ptna , was cloned between the HindIII-BamHI sites of pTA131. .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title:
    Article Snippet: The human p57/coronin-1 construct (pcDNA6-p57) was prepared by insertion of the full-length p57/coronin-1 cDNA from pEGFP-p57FL ( ) into the BamHI/XbaI sites of a pcDNA6/V5-HisA vector (Invitrogen) using ER2925, a strain of Escherichia coli that is deficient for both dam and dcm (New England Biolabs Inc., Ipswich, MA). .. Mutations were introduced into the phosphorylation site(s) of p57/coronin-1 by using a QuikChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. pcDNA6-p57/S2A (in which Ser-2 is replaced with Ala) and pcDNA6-p57/T412A (in which Thr-412 is replaced with Ala) were generated from pcDNA6-p57 by using the following sets of primers: 5′-AGC TCG GAT CCG AAT GGC CCG GCA GGT GGT C-3′ (sense primer for S2A) and 5′-GCG GAC CAC CTG CCG GGC CAT TCG GAT CCG AGC-3′ (antisense primer for S2A) and 5′-AAC CGG GGC CTG GAC GCC GGG CGC AGG AGG-3′ (sense primer for T412A) and 5′-CCT CCT GCG CCC GGC GTC CAG GCC CCG GTT-3′ (antisense primer for T412A). pcDNA6-p57/S2AT412A (a double mutant at Ser-2 and Thr-412) is generated from pcDNA6-p57/S2A by using primers for T412A. pcDNA6-p57/T412D (in which Thr-412 is replaced with Asp) was generated from pcDNA6-p57 by using the primers 5′-AAC CGG GGC CTG GAC GAC GGG CGC AGG AGG-3′ (sense primer for T412D) and 5′-CCT CCT GCG CCC GTC GTC CAG GCC CCG GTT-3′ (antisense primer for T412D). pEGFP-p57LZ/T412A and pEGFP-p57LZ/T412D were generated from pEGFP-p57LZ ( ) by using the primers described above.

    Article Title: Molecular Characterization of UGT94F2 and UGT86C4, Two Glycosyltransferases from Picrorhiza kurrooa: Comparative Structural Insight and Evaluation of Substrate Recognition
    Article Snippet: Paragraph title: Full-length Cloning of UGT94F2 and UGT86C4 ... The resulted amplified full length ORFs were ligated in pJET vector (Fermentas, Burlington, Canada) and subcloned into chemically competent E. coli cells (DH5α; New England Biolabs, Ipswich, MA, USA).

    Centrifugation:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: All EBs were purified from HeLa cells by centrifugation through MD-76R (diatrizoate meglumine and diatrizoate sodium injection U.S.P. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Amplification:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: The flgBp /kan R amplicon was generated using P255 and P846, the latter possessing a KpnI site. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: The 1.0 kb DNA fragment harboring the mouse PPAR-γ proximal promoter was amplified from mouse genomic DNA using PCR. .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Identical fragments from subtype C molecular clone HIV1084i and primary provirus 2669i were PCR amplified with forward primer F-Cpr-BclI (5'-ACAGTATGATCAGATACTTATAGAAATTTGTGG-3'), which also contains the BclI site, and polCR2 primer. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation.

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The amplified fragment was purified and ligated into the pGEM-T vector (Promega, Madison, WI). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Molecular Characterization of UGT94F2 and UGT86C4, Two Glycosyltransferases from Picrorhiza kurrooa: Comparative Structural Insight and Evaluation of Substrate Recognition
    Article Snippet: A high fidelity proof-reading DNA polymerase (New England Biolabs, Ipswich, MA, USA) was used for amplification under following PCR conditions: One cycle of 98°C for 1 min, 35 cycles of 98°C for 20 s, 60°C for 30 s, 72°C for 2 min. .. The resulted amplified full length ORFs were ligated in pJET vector (Fermentas, Burlington, Canada) and subcloned into chemically competent E. coli cells (DH5α; New England Biolabs, Ipswich, MA, USA). .. The full length nucleotide sequences obtained were translated using Translate tool ( http://www.expasy.ch/tools/dna.html ) and the properties of deduced amino acid sequences were estimated using ProtParam ( http://www.expasy.ch/tools/protparam.html ) and Phobius ( http://www.ebi.ac.uk/Tools/pfa/phobius/ ) programs.

    Reporter Assay:

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Saccharomyces cerevisiae YM4271 MATa, ura3 – 52, his3 – 200, ade2 – 101, lys2 – 801, leu2 – 3, 112, trp1 – 901, tyr1 – 501, gal4 -Δ 512, gal80-Δ 538 , ade5::hisG ] was used for plasmid construction via homologous recombination and reporter strain construction.

    Synthesized:

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: This sequence, termed SP-lysozyme, was synthesized by Integrated DNA Technologies, Inc., Iowa, USA and cloned into pIDTSmart plasmid which encoded an ampicillin resistance cassette. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Construct:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: Paragraph title: Cloning of expression constructs ... BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: The final pAE35 construct was verified by DNA sequencing. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: The construct was confirmed by DNA sequencing. .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. To obtain the fully methylated reporter, constructs were incubated with 3 U/μg of SssI methylase (New England Biolabs) in the presence of 160 μM S-adenosylmethionine at 37 °C for 3 hours .

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Paragraph title: Plasmid Constructs ... The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation.

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified . .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The vector pBR325::L2 was constructed by ligation of pL2 cleaved by Bam HI from plasmid PDCPB (this vector is equivalent to pBR322::L2) into Bam HI cleaved pBR325 (GenBank: L08855.1), this cloning was performed in E. coli strain HB101. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: Plasmids for making deletions in H. volcanii were constructed by cloning upstream and downstream DNA fragments that flanked each deletion into pTA131 . .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title:
    Article Snippet: Horseradish peroxidase-conjugated goat antibodies to mouse IgG and IgM were purchased from Kirkegaard & Perry Laboratories Inc. (Guildford, UK) and Jackson ImmunoResearch Laboratories Inc. (West Grove, PA), respectively. .. The human p57/coronin-1 construct (pcDNA6-p57) was prepared by insertion of the full-length p57/coronin-1 cDNA from pEGFP-p57FL ( ) into the BamHI/XbaI sites of a pcDNA6/V5-HisA vector (Invitrogen) using ER2925, a strain of Escherichia coli that is deficient for both dam and dcm (New England Biolabs Inc., Ipswich, MA). .. Mutations were introduced into the phosphorylation site(s) of p57/coronin-1 by using a QuikChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. pcDNA6-p57/S2A (in which Ser-2 is replaced with Ala) and pcDNA6-p57/T412A (in which Thr-412 is replaced with Ala) were generated from pcDNA6-p57 by using the following sets of primers: 5′-AGC TCG GAT CCG AAT GGC CCG GCA GGT GGT C-3′ (sense primer for S2A) and 5′-GCG GAC CAC CTG CCG GGC CAT TCG GAT CCG AGC-3′ (antisense primer for S2A) and 5′-AAC CGG GGC CTG GAC GCC GGG CGC AGG AGG-3′ (sense primer for T412A) and 5′-CCT CCT GCG CCC GGC GTC CAG GCC CCG GTT-3′ (antisense primer for T412A). pcDNA6-p57/S2AT412A (a double mutant at Ser-2 and Thr-412) is generated from pcDNA6-p57/S2A by using primers for T412A. pcDNA6-p57/T412D (in which Thr-412 is replaced with Asp) was generated from pcDNA6-p57 by using the primers 5′-AAC CGG GGC CTG GAC GAC GGG CGC AGG AGG-3′ (sense primer for T412D) and 5′-CCT CCT GCG CCC GTC GTC CAG GCC CCG GTT-3′ (antisense primer for T412D). pEGFP-p57LZ/T412A and pEGFP-p57LZ/T412D were generated from pEGFP-p57LZ ( ) by using the primers described above.

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: Paragraph title: Construction of the Lentiviral Construct Containing CFTR-Puro-EF1α-ClopHensor ... The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: Dihydroxyacetone metabolism in Haloferax volcanii
    Article Snippet: Constructed plasmids were transformed into Stellar Competent Cells (Clontech, Cat. # 636763), according to the directions of the provider, and were plated on LB-amp plates with X-gal. .. Confirmed deletion plasmids (listed in Table ) were subcloned in dam− /dcm− Competent E. coli (New England BioLabs, Cat. # C2925H) to produce demethylated plasmids for transformation of Hfx. volcanii .

    Electrophoresis:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs). .. Following plasmid extraction (Mini Kit, Qiagen), 300 ng of either plasmid (pAE30 or pAE35) were digested with DpnI, MboI, or Sau3AI (New England Biolabs).

    Luciferase:

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. The transfection was performed following the protocol of Lipofectamine-2000 (#12566014, Invitrogen).

    Activity Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Ten picomols of two complementary HPLC-purified U-containing oligos as indicated , with the same silent mutation in the lacZ sequence, were annealed and ligated to Bsa BI/Bcl I-digested vector at 16 °C overnight.

    Expressing:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: Paragraph title: Cloning of expression constructs ... BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified . .. Subsequently the EcoR I and Xba I (New England Biolabs, Ipswich, USA) digested SP-lysozyme insert was ligated into the pSEVA228 plasmid previously digested likewise.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna . .. Transformants were selected as previously described , and then chromosome structures were verified by allele-specific PCR.

    Transformation Assay:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: The cloned sequences were confirmed by Sanger sequencing. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B. .. The protocol was slightly changed and the overnight culture was diluted to an optical density at 600 nm wavelength (OD600 ) of 0.1 in 2 L 2YT-Medium.

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: The final pAE35 construct was verified by DNA sequencing. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs). .. Following plasmid extraction (Mini Kit, Qiagen), 300 ng of either plasmid (pAE30 or pAE35) were digested with DpnI, MboI, or Sau3AI (New England Biolabs).

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: The construct was confirmed by DNA sequencing. .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. To obtain the fully methylated reporter, constructs were incubated with 3 U/μg of SssI methylase (New England Biolabs) in the presence of 160 μM S-adenosylmethionine at 37 °C for 3 hours .

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Identical fragments from subtype C molecular clone HIV1084i and primary provirus 2669i were PCR amplified with forward primer F-Cpr-BclI (5'-ACAGTATGATCAGATACTTATAGAAATTTGTGG-3'), which also contains the BclI site, and polCR2 primer. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation. .. The DNA fragments after digestion with respective restriction enzymes were then ligated with the linearized HIV-1 NL4-3 proviral clones to replace the host gene fragments (Figure ).

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Assessment of chlamydial growth was accomplished by enumeration of progeny EBs from 24 hr cultures as described [ ]. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae. .. Where appropriate, 50 μg/ml carbenicillin was used for E . coli selection while 1.0 μg/ml cycloheximide and 0.6 μg/ml Penicillin G sodium (PenG) was used during chlamydial transformations.

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: This sequence, termed SP-lysozyme, was synthesized by Integrated DNA Technologies, Inc., Iowa, USA and cloned into pIDTSmart plasmid which encoded an ampicillin resistance cassette. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified . .. The construction of this strain leads to a fully efficient restriction after plasmid extraction since no methylation is implemented by this strain.

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The original preparation of the plasmid pBR325::L2 DNA (used to transform C. trachomatis L2 EBs) was performed in E. coli strain HB101, but all subsequent plasmid manipulations for transformation were performed using E. coli GM 2163. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The amplified fragment was purified and ligated into the pGEM-T vector (Promega, Madison, WI). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin. .. Plasmids from positive recombinants were purified using a Wizard Plus SV Minipreps DNA purification system kit (Promega) and digested with the KpnI restriction enzyme (New England BioLabs Inc.).

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The pVLX-mCherry-C1 vector (Clontech Laboratories, Mountain View, CA, ) was similarly digested. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ). .. The minimum CFTR promoter (372 bp) was inserted into the newly created plasmid by digestion of both the plasmid and the PCR product with EcoRI and AgeI.

    Article Title: Dihydroxyacetone metabolism in Haloferax volcanii
    Article Snippet: White colonies were screened via colony PCR using the external primers of the target gene flanking regions. .. Confirmed deletion plasmids (listed in Table ) were subcloned in dam− /dcm− Competent E. coli (New England BioLabs, Cat. # C2925H) to produce demethylated plasmids for transformation of Hfx. volcanii . .. Hfx. volcanii H26 colonies were screened for deleted genes via PCR using the external primers of the target gene flanking regions.

    Countercurrent Chromatography:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Transfection:

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. To obtain the fully methylated reporter, constructs were incubated with 3 U/μg of SssI methylase (New England Biolabs) in the presence of 160 μM S-adenosylmethionine at 37 °C for 3 hours .

    Ligation:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: Following ligation of the two amplicons, a single kan R -bh0463A construct driven by the B . hermsii flgB promoter was ligated to pJet1.2/blunt in a separate reaction. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: The final pSUmC construct is then propagated in and purified from methyltransferase-deficient E.coli prior to transforming chlamydiae and initiation of the FRAEM approach. .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The vector pBR325::L2 was constructed by ligation of pL2 cleaved by Bam HI from plasmid PDCPB (this vector is equivalent to pBR322::L2) into Bam HI cleaved pBR325 (GenBank: L08855.1), this cloning was performed in E. coli strain HB101. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. The linear form of the plasmid was isolated from a 0.8% agarose gel and the concentration of the plasmid DNA measured by NanoView (GE Healthcare).

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The amplified fragment was purified and ligated into the pGEM-T vector (Promega, Madison, WI). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin. .. Plasmids from positive recombinants were purified using a Wizard Plus SV Minipreps DNA purification system kit (Promega) and digested with the KpnI restriction enzyme (New England BioLabs Inc.).

    Transferring:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Infection:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: ; Mallingckrodt Pharmaceuticals, Mulhuddart, Ireland) density gradients (DG-purified) as previously described [ ] and were used as the infection source for all experiments. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Generated:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: The flgBp /kan R amplicon was generated using P255 and P846, the latter possessing a KpnI site. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Where appropriate, intrinsically fluorescent chlamydiae were generated by labeling bacteria with CellTracker Red CMPTX (Life technologies) as described [ ]. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: Briefly, the norB ::Gen strain was generated by amplifying the norB gene (NE 2004) from N. europaea ATCC 19718 genomic DNA using primers Ne_2004F (5′-ACC CAG AAG CTT GCT TAC CC-3′) and Ne_2004R (5′-TGT TCG GTG ACG ATG ACA CT-3′). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    DNA Sequencing:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: The final pAE35 construct was verified by DNA sequencing. .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Protein Concentration:

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA). .. The transfection was performed following the protocol of Lipofectamine-2000 (#12566014, Invitrogen).

    Polymerase Chain Reaction:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: Both PCR products were cleaned using a PCR cleanup kit (Qiagen, Valencia, CA) and digested with KpnI (New England Biolabs). .. Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs).

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: The 1.0 kb DNA fragment harboring the mouse PPAR-γ proximal promoter was amplified from mouse genomic DNA using PCR. .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Identical fragments from subtype C molecular clone HIV1084i and primary provirus 2669i were PCR amplified with forward primer F-Cpr-BclI (5'-ACAGTATGATCAGATACTTATAGAAATTTGTGG-3'), which also contains the BclI site, and polCR2 primer. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation.

    Article Title: The non-specific adenine DNA methyltransferase M.EcoGII
    Article Snippet: Restriction endonucleases, T4-DNA ligase, Phusion-HF DNA polymerase, proteinase K, S-adenosylmethionine (SAM), Hi-Scribe in vitro transcription kit and competent E. coli cells were from New England Biolabs Inc. (Ipswich, MA, USA). .. Tritiated SAM (specific activity 55–85Ci/mmol) was acquired from Perkin Elmer.

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: Confirmation of the nirK ::Kan strain was done by PCR using primers nir10f (5′-GGG CGA CAT ACC CAA GAG TG-3′), nir10r (5′-CAA GCC TAT GGG GGT TTA TAG-3′), and nir26r (5′-GTC ATA GCT GTT TCC TGT GTG AAA TT-3′) as described previously ( ). norB ::Gen and nirK ::Kan norB ::Gen N. europaea strains were created by following a methodology described elsewhere ( ). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title: Molecular Characterization of UGT94F2 and UGT86C4, Two Glycosyltransferases from Picrorhiza kurrooa: Comparative Structural Insight and Evaluation of Substrate Recognition
    Article Snippet: A high fidelity proof-reading DNA polymerase (New England Biolabs, Ipswich, MA, USA) was used for amplification under following PCR conditions: One cycle of 98°C for 1 min, 35 cycles of 98°C for 20 s, 60°C for 30 s, 72°C for 2 min. .. The resulted amplified full length ORFs were ligated in pJET vector (Fermentas, Burlington, Canada) and subcloned into chemically competent E. coli cells (DH5α; New England Biolabs, Ipswich, MA, USA).

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The CFTR channel and pH sensor contained in the plasmid pcDNA3-ClopHensor (Addgene, Cambridge, MA, ) were amplified by polymerase chain reaction (PCR) producing a 2.455-kb product. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Article Title: Dihydroxyacetone metabolism in Haloferax volcanii
    Article Snippet: White colonies were screened via colony PCR using the external primers of the target gene flanking regions. .. Confirmed deletion plasmids (listed in Table ) were subcloned in dam− /dcm− Competent E. coli (New England BioLabs, Cat. # C2925H) to produce demethylated plasmids for transformation of Hfx. volcanii .

    Injection:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: All EBs were purified from HeLa cells by centrifugation through MD-76R (diatrizoate meglumine and diatrizoate sodium injection U.S.P. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Binding Assay:

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: The genetic system was designed with the following functional modules (5′ towards 3′): EcoR I restriction site, an optimized ribosome binding site (RBS; underlined) intended for strong ribosome recruitment as well as 8 conserved nucleotides (italics) AGGAGG AAAAACAT , the amyP gene 63 nucleotide leader sequence of P . stutzeri encoding for the SP amino acids MSHILRAAVLAAMLLPLPSMA ((http://www.signalpeptide.de/index.php?sess= & m=listspdb_bacteria & s=details & id=27286 & listname=) & (UniProtKB - P13507 (AMT4_PSEST)), lysozyme C precursor sequence of Gallus gallus (NCBI: NP_990612.1) lacking its start codon and finally the Xba I restriction site. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Design of a single plasmid-based modified yeast one-hybrid system for investigation of in vivo protein-protein and protein-DNA interactions
    Article Snippet: Escherichia coli DH5α (Stratagene, La Jolla, CA, USA) or dam− /dcm− C2925H (New England Biolabs) was used for standard cloning and for rescue of plasmids from yeast cells. .. Two yeast reporter strains, YM4271[p53HIS] and YM4271 [p53BLUE], were created according to the Matchmaker One-hybrid System User Manual (Clontech, Palo Alto, CA, USA) for reporter assay analysis in the MY1H.

    Reporter Gene Assay:

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: Paragraph title: PPAR-γ promoter cloning and reporter gene assay ... To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Methylation:

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Identical fragments from subtype C molecular clone HIV1084i and primary provirus 2669i were PCR amplified with forward primer F-Cpr-BclI (5'-ACAGTATGATCAGATACTTATAGAAATTTGTGG-3'), which also contains the BclI site, and polCR2 primer. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation. .. The DNA fragments after digestion with respective restriction enzymes were then ligated with the linearized HIV-1 NL4-3 proviral clones to replace the host gene fragments (Figure ).

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified . .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Dnmt3b Methylates DNA by a Noncooperative Mechanism, and Its Activity Is Unaffected by Manipulations at the Predicted Dimer Interface
    Article Snippet: AdoMet was a mixture of unlabeled and 0.76 μ M 3 H-labeled AdoMet, which yielded a final concentration of 2 μ M. Methylation assays were performed using 30-mer, 509-mer, and 719-mer DNA substrates. .. For these assays, unmethylated pUC19 was purified from the dam− /dcm− Escherichia coli strain (C2925I, NEB).

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The original preparation of the plasmid pBR325::L2 DNA (used to transform C. trachomatis L2 EBs) was performed in E. coli strain HB101, but all subsequent plasmid manipulations for transformation were performed using E. coli GM 2163. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S). .. Plasmid pGFP::SW2 ( ) was constructed from the C. trachomatis SW2 plasmid pSW2, pSP73 and pRSGFPCAT.

    Mutagenesis:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Isolation:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Ten picomols of two complementary HPLC-purified U-containing oligos as indicated , with the same silent mutation in the lacZ sequence, were annealed and ligated to Bsa BI/Bcl I-digested vector at 16 °C overnight.

    Subcloning:

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation. .. To clone the DNA fragments encoding the RT connection and RNase H domains, the integrase, and the Vif into the NL vector, the fragments were PCR amplified from YU-2 and HIV1084i proviral clones with forward primer RTage1F (5'-TAAAAGAACCGGTACATGGAGT-3') with an introduced AgeI site and reverse primer polEcoR1R (5'-TTGTTGCAGAATTCTTATTAT-3') containing the EcoRI restriction enzyme site.

    Labeling:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Where appropriate, intrinsically fluorescent chlamydiae were generated by labeling bacteria with CellTracker Red CMPTX (Life technologies) as described [ ]. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Purification:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: All EBs were purified from HeLa cells by centrifugation through MD-76R (diatrizoate meglumine and diatrizoate sodium injection U.S.P. .. Chemically competent E . coli 10-beta (NEB, Ipswich, MA) was used for routine cloning, and dam - /dcm - E . coli (NEB) was used to propagate plasmids prior to transformation of chlamydiae.

    Article Title: The non-specific adenine DNA methyltransferase M.EcoGII
    Article Snippet: Restriction endonucleases, T4-DNA ligase, Phusion-HF DNA polymerase, proteinase K, S-adenosylmethionine (SAM), Hi-Scribe in vitro transcription kit and competent E. coli cells were from New England Biolabs Inc. (Ipswich, MA, USA). .. Tritiated SAM (specific activity 55–85Ci/mmol) was acquired from Perkin Elmer.

    Article Title: Dnmt3b Methylates DNA by a Noncooperative Mechanism, and Its Activity Is Unaffected by Manipulations at the Predicted Dimer Interface
    Article Snippet: Additionally, cooperativity assays using 100 ng of the pUC19 plasmid as a substrate were performed using the filter binding assay described above. .. For these assays, unmethylated pUC19 was purified from the dam− /dcm− Escherichia coli strain (C2925I, NEB). .. For assays aiming to investigate the ability of an inactive mutant to stimulate wild-type (WT) Dnmt3b-C activity, the activity of a 1:1 μ M mixture of Dnmt3b-C E703A mutant and WT Dnmt3b-C was compared to the activity of WT Dnmt3b-C (1 or 2 μ M), using two different DNA substrates, 1 μ M 30-mer substrate with 1 CpG or 150 nM 509-mer substrate with 58 CpGs.

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The amplified fragment was purified and ligated into the pGEM-T vector (Promega, Madison, WI). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Sequencing:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: The final pSUmC construct is then propagated in and purified from methyltransferase-deficient E.coli prior to transforming chlamydiae and initiation of the FRAEM approach. .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: For cloning of the pol gene fragment encoding the RT polymerase domain, the DNA sequence containing 124 nt from the protease encoding region and RT polymerase domain was amplified by PCR from subtype B YU-2 molecular clone with forward primer F-NLpr-BclI (5'-ACAGTATGATCAGATACTCATAGAAATCTGCGG-3') containing BclI restriction enzyme site and reverse primer polCR2 (5'-ATACTCCATGTACCGGTTCTTTTAGAA-3') with an introduced AgeI site. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation.

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: This sequence, termed SP-lysozyme, was synthesized by Integrated DNA Technologies, Inc., Iowa, USA and cloned into pIDTSmart plasmid which encoded an ampicillin resistance cassette. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S). .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: All PCR-generated fragments were sequence-verified after cloning. .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Filter-binding Assay:

    Article Title: Dnmt3b Methylates DNA by a Noncooperative Mechanism, and Its Activity Is Unaffected by Manipulations at the Predicted Dimer Interface
    Article Snippet: Additionally, cooperativity assays using 100 ng of the pUC19 plasmid as a substrate were performed using the filter binding assay described above. .. For these assays, unmethylated pUC19 was purified from the dam− /dcm− Escherichia coli strain (C2925I, NEB).

    Staining:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    IA:

    Article Title: The non-specific adenine DNA methyltransferase M.EcoGII
    Article Snippet: Restriction endonucleases, T4-DNA ligase, Phusion-HF DNA polymerase, proteinase K, S-adenosylmethionine (SAM), Hi-Scribe in vitro transcription kit and competent E. coli cells were from New England Biolabs Inc. (Ipswich, MA, USA). .. Tritiated SAM (specific activity 55–85Ci/mmol) was acquired from Perkin Elmer.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: Confirmation of the nirK ::Kan strain was done by PCR using primers nir10f (5′-GGG CGA CAT ACC CAA GAG TG-3′), nir10r (5′-CAA GCC TAT GGG GGT TTA TAG-3′), and nir26r (5′-GTC ATA GCT GTT TCC TGT GTG AAA TT-3′) as described previously ( ). norB ::Gen and nirK ::Kan norB ::Gen N. europaea strains were created by following a methodology described elsewhere ( ). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Plasmid Preparation:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: The cloned sequences were confirmed by Sanger sequencing. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B. .. The protocol was slightly changed and the overnight culture was diluted to an optical density at 600 nm wavelength (OD600 ) of 0.1 in 2 L 2YT-Medium.

    Article Title: DNMT1-PPARγ pathway in macrophages regulates chronic inflammation and atherosclerosis development in mice
    Article Snippet: The fragment was then subcloned into a pGL3-Basic vector. .. To obtain the unmethylated promoter, the reporter constructs were transformed into the dam-/dcm- E. coli strain (New England Biolabs, Ipswich, MA, USA).

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: The final pSUmC construct is then propagated in and purified from methyltransferase-deficient E.coli prior to transforming chlamydiae and initiation of the FRAEM approach. .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Article Title: Subtype-associated differences in HIV-1 reverse transcription affect the viral replication
    Article Snippet: Identical fragments from subtype C molecular clone HIV1084i and primary provirus 2669i were PCR amplified with forward primer F-Cpr-BclI (5'-ACAGTATGATCAGATACTTATAGAAATTTGTGG-3'), which also contains the BclI site, and polCR2 primer. .. The fragments were then subcloned into the pGEM-T Easy vector and transformed into dam - /dcm - Competent E. coli (New England BioLabs) since BclI is susceptible to the dam methylation. .. The DNA fragments after digestion with respective restriction enzymes were then ligated with the linearized HIV-1 NL4-3 proviral clones to replace the host gene fragments (Figure ).

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: This sequence, termed SP-lysozyme, was synthesized by Integrated DNA Technologies, Inc., Iowa, USA and cloned into pIDTSmart plasmid which encoded an ampicillin resistance cassette. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified . .. The construction of this strain leads to a fully efficient restriction after plasmid extraction since no methylation is implemented by this strain.

    Article Title: The non-specific adenine DNA methyltransferase M.EcoGII
    Article Snippet: Restriction endonucleases, T4-DNA ligase, Phusion-HF DNA polymerase, proteinase K, S-adenosylmethionine (SAM), Hi-Scribe in vitro transcription kit and competent E. coli cells were from New England Biolabs Inc. (Ipswich, MA, USA). .. Tritiated SAM (specific activity 55–85Ci/mmol) was acquired from Perkin Elmer.

    Article Title: Dnmt3b Methylates DNA by a Noncooperative Mechanism, and Its Activity Is Unaffected by Manipulations at the Predicted Dimer Interface
    Article Snippet: Additionally, cooperativity assays using 100 ng of the pUC19 plasmid as a substrate were performed using the filter binding assay described above. .. For these assays, unmethylated pUC19 was purified from the dam− /dcm− Escherichia coli strain (C2925I, NEB).

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: The original preparation of the plasmid pBR325::L2 DNA (used to transform C. trachomatis L2 EBs) was performed in E. coli strain HB101, but all subsequent plasmid manipulations for transformation were performed using E. coli GM 2163. .. This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Paragraph title: Generation of a double-strand break-containing plasmid ... Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The amplified fragment was purified and ligated into the pGEM-T vector (Promega, Madison, WI). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: Paragraph title: Strain and plasmid construction ... These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Article Title:
    Article Snippet: Horseradish peroxidase-conjugated goat antibodies to mouse IgG and IgM were purchased from Kirkegaard & Perry Laboratories Inc. (Guildford, UK) and Jackson ImmunoResearch Laboratories Inc. (West Grove, PA), respectively. .. The human p57/coronin-1 construct (pcDNA6-p57) was prepared by insertion of the full-length p57/coronin-1 cDNA from pEGFP-p57FL ( ) into the BamHI/XbaI sites of a pcDNA6/V5-HisA vector (Invitrogen) using ER2925, a strain of Escherichia coli that is deficient for both dam and dcm (New England Biolabs Inc., Ipswich, MA). .. Mutations were introduced into the phosphorylation site(s) of p57/coronin-1 by using a QuikChangeTM site-directed mutagenesis kit (Stratagene, La Jolla, CA) according to the manufacturer's instructions. pcDNA6-p57/S2A (in which Ser-2 is replaced with Ala) and pcDNA6-p57/T412A (in which Thr-412 is replaced with Ala) were generated from pcDNA6-p57 by using the following sets of primers: 5′-AGC TCG GAT CCG AAT GGC CCG GCA GGT GGT C-3′ (sense primer for S2A) and 5′-GCG GAC CAC CTG CCG GGC CAT TCG GAT CCG AGC-3′ (antisense primer for S2A) and 5′-AAC CGG GGC CTG GAC GCC GGG CGC AGG AGG-3′ (sense primer for T412A) and 5′-CCT CCT GCG CCC GGC GTC CAG GCC CCG GTT-3′ (antisense primer for T412A). pcDNA6-p57/S2AT412A (a double mutant at Ser-2 and Thr-412) is generated from pcDNA6-p57/S2A by using primers for T412A. pcDNA6-p57/T412D (in which Thr-412 is replaced with Asp) was generated from pcDNA6-p57 by using the primers 5′-AAC CGG GGC CTG GAC GAC GGG CGC AGG AGG-3′ (sense primer for T412D) and 5′-CCT CCT GCG CCC GTC GTC CAG GCC CCG GTT-3′ (antisense primer for T412D). pEGFP-p57LZ/T412A and pEGFP-p57LZ/T412D were generated from pEGFP-p57LZ ( ) by using the primers described above.

    Article Title: Molecular Characterization of UGT94F2 and UGT86C4, Two Glycosyltransferases from Picrorhiza kurrooa: Comparative Structural Insight and Evaluation of Substrate Recognition
    Article Snippet: A high fidelity proof-reading DNA polymerase (New England Biolabs, Ipswich, MA, USA) was used for amplification under following PCR conditions: One cycle of 98°C for 1 min, 35 cycles of 98°C for 20 s, 60°C for 30 s, 72°C for 2 min. .. The resulted amplified full length ORFs were ligated in pJET vector (Fermentas, Burlington, Canada) and subcloned into chemically competent E. coli cells (DH5α; New England Biolabs, Ipswich, MA, USA). .. The full length nucleotide sequences obtained were translated using Translate tool ( http://www.expasy.ch/tools/dna.html ) and the properties of deduced amino acid sequences were estimated using ProtParam ( http://www.expasy.ch/tools/protparam.html ) and Phobius ( http://www.ebi.ac.uk/Tools/pfa/phobius/ ) programs.

    Article Title: Disruption of a Type II Endonuclease (TDE0911) Enables Treponema denticola ATCC 35405 To Accept an Unmethylated Shuttle Vector
    Article Snippet: The Escherichia coli TOP10 strain ( dam+ /dcm+ ; Life Technologies, Carlsbad, CA) was used for routine plasmid constructions and preparations. .. A E. coli dam/dcm- deficient strain (New England BioLabs, Ipswich, MA) was used to prepare unmethylated plasmids.

    Article Title: Modeling Cystic Fibrosis Using Pluripotent Stem Cell-Derived Human Pancreatic Ductal Epithelial Cells
    Article Snippet: The pVLX-mCherry-C1 vector (Clontech Laboratories, Mountain View, CA, ) was similarly digested. .. The two products were then ligated and transformed in Dam− /Dcm− competent Escherichia coli (New England Biolabs, Ipswich, MA, ).

    Functional Assay:

    Article Title: A novel programmable lysozyme-based lysis system in Pseudomonas putida for biopolymer production
    Article Snippet: The genetic system was designed with the following functional modules (5′ towards 3′): EcoR I restriction site, an optimized ribosome binding site (RBS; underlined) intended for strong ribosome recruitment as well as 8 conserved nucleotides (italics) AGGAGG AAAAACAT , the amyP gene 63 nucleotide leader sequence of P . stutzeri encoding for the SP amino acids MSHILRAAVLAAMLLPLPSMA ((http://www.signalpeptide.de/index.php?sess= & m=listspdb_bacteria & s=details & id=27286 & listname=) & (UniProtKB - P13507 (AMT4_PSEST)), lysozyme C precursor sequence of Gallus gallus (NCBI: NP_990612.1) lacking its start codon and finally the Xba I restriction site. .. The resulting vector was named pIDTSmart-SP-lysozyme, which was introduced via transformation into E . coli dam − /dcm − (C2925I, New England Biolabs, Ipswich, USA) as previously specified .

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: A silent mutation in the proline codon (CCC to CCG) was introduced between the Bsa BI and Bcl I sites of the bacterial WT lacZ -containing plasmid pCH110, carrying both bacterial and SV40 promoters, to create a variant (but functional) lacZ plasmid pTV123. .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Recombinant:

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: Paragraph title: E. coli strains, recombinant plasmids and genetic manipulations ... This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S).

    Agarose Gel Electrophoresis:

    Article Title: Characterization of a DNA Adenine Methyltransferase Gene of Borrelia hermsii and Its Dispensability for Murine Infection and Persistence
    Article Snippet: Both plasmids were transformed into a commercially available dam - /dcm - E . coli strain (New England Biolabs). .. Following plasmid extraction (Mini Kit, Qiagen), 300 ng of either plasmid (pAE30 or pAE35) were digested with DpnI, MboI, or Sau3AI (New England Biolabs).

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin. .. Plasmids from positive recombinants were purified using a Wizard Plus SV Minipreps DNA purification system kit (Promega) and digested with the KpnI restriction enzyme (New England BioLabs Inc.).

    In Vitro:

    Article Title: The non-specific adenine DNA methyltransferase M.EcoGII
    Article Snippet: We have subsequently characterized one of those enzymes, M.EcoGII in detail, and find that it is indeed non-specific and, under appropriate conditions, is able to methylate > 85% of A-residues in a DNA substrate in vivo and close to 100% in vitro . .. Restriction endonucleases, T4-DNA ligase, Phusion-HF DNA polymerase, proteinase K, S-adenosylmethionine (SAM), Hi-Scribe in vitro transcription kit and competent E. coli cells were from New England Biolabs Inc. (Ipswich, MA, USA). .. Tritiated SAM (specific activity 55–85Ci/mmol) was acquired from Perkin Elmer.

    Selection:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: The pCMVtag2B vector contains a neomycin selection marker. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Cellular Antioxidant Activity Assay:

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: Confirmation of the nirK ::Kan strain was done by PCR using primers nir10f (5′-GGG CGA CAT ACC CAA GAG TG-3′), nir10r (5′-CAA GCC TAT GGG GGT TTA TAG-3′), and nir26r (5′-GTC ATA GCT GTT TCC TGT GTG AAA TT-3′) as described previously ( ). norB ::Gen and nirK ::Kan norB ::Gen N. europaea strains were created by following a methodology described elsewhere ( ). .. The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin.

    Expression Vector:

    Article Title: CetZ tubulin-like proteins control archaeal cell shape
    Article Snippet: In the first stage, the upstream DNA fragment amplified from DS70 (primer pairs US-f/US-r, ) was spliced by overlap-extension PCR to the corresponding Ptna-cetZ fragment that had been amplified with primer PtnaUS-f (CTGGCGAAAGGGGGATGTGCTGC), the cetZ ORF reverse primer, and the expression-plasmid template ( ). .. These plasmids were demethylated by passage through E. coli C2925 (New England Biolabs), and then used in the “pop-in pop-out” method , to replace the chromosomal cetZ promoters with Ptna .

    Produced:

    Article Title: Dihydroxyacetone metabolism in Haloferax volcanii
    Article Snippet: Confirmed deletion plasmids (listed in Table ) were subcloned in dam− /dcm− Competent E. coli (New England BioLabs, Cat. # C2925H) to produce demethylated plasmids for transformation of Hfx. volcanii . .. Hfx. volcanii H26 colonies were screened for deleted genes via PCR using the external primers of the target gene flanking regions.

    Concentration Assay:

    Article Title: Dnmt3b Methylates DNA by a Noncooperative Mechanism, and Its Activity Is Unaffected by Manipulations at the Predicted Dimer Interface
    Article Snippet: AdoMet was a mixture of unlabeled and 0.76 μ M 3 H-labeled AdoMet, which yielded a final concentration of 2 μ M. Methylation assays were performed using 30-mer, 509-mer, and 719-mer DNA substrates. .. For these assays, unmethylated pUC19 was purified from the dam− /dcm− Escherichia coli strain (C2925I, NEB).

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB). .. To create DSB-containing 3′-P ends, plasmids were digested with Udg and Fpg (both from NEB) at 37 °C for 1 h per the manufacturer's protocol, except that 2 mM EDTA was added to the reaction buffer to avoid non-specific nuclease activity.

    Marker:

    Article Title: Absence of IL-10 production by human PBMCs co-cultivated with human cells expressing or secreting retroviral immunosuppressive domains
    Article Snippet: The pCMVtag2B vector contains a neomycin selection marker. .. BL21 E . coli competent cells (New England Biolabs) were transformed with the vector pet16B.

    Gel Extraction:

    Article Title: Development of a Transformation System for Chlamydia trachomatis: Restoration of Glycogen Biosynthesis by Acquisition of a Plasmid Shuttle Vector
    Article Snippet: This strain is mutated for Dam , Dcm and Mcr methylation systems and was available from New England Biolabs (Cat. no. #E4105S). .. Plasmid pRSGFPCAT is a small in-house vector based on a pUC origin of replication and carrying the cat gene fused to RSGFP and under the control of a neisserial promoter that is constitutively expressed in E. coli (refer to for sequence details).

    Article Title: Revision of N2O-Producing Pathways in the Ammonia-Oxidizing Bacterium Nitrosomonas europaea ATCC 19718
    Article Snippet: The ligation mixture was transformed into competent E. coli cells negative for both dam and dcm (New England BioLabs Inc., Ipswich, MA), and transformants were selected via blue-white screening on LB agar plates containing 0.5 mM isopropyl-β- d -thiogalactopyranoside (IPTG), 80 μg/ml 5-bromo-4-chloro-3-indolyl-β- d -galactopyranoside (X-Gal), and 100 μg/ml of ampicillin. .. The digest was run on a 0.8% agarose gel, and linearized vector was gel purified using the Wizard SV gel and PCR clean-up system kit (Promega).

    Variant Assay:

    Article Title: Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes
    Article Snippet: The variant plasmid was necessary to distinguish it from the WT lacZ (transcribed from HEK293 stable cells), which served as a template for transferring the missing sequence into the gapped variant plasmid ( ). .. Sixty microgram of pTV123, isolated from E. coli dam − dcm − cells (NEB), was digested separately with the two single-cut enzymes Bsa BI and Bcl I (NEB).

    Homologous Recombination:

    Article Title: Chlamydia trachomatis transformation and allelic exchange mutagenesis
    Article Snippet: The final pSUmC construct is then propagated in and purified from methyltransferase-deficient E.coli prior to transforming chlamydiae and initiation of the FRAEM approach. .. pSUmC plasmid DNA pUC18A plasmid DNA pUC19G plasmid DNA Primer pair to amplify the gene targeted for deletion surrounded by approximately 3-kilobase (kb) flanking sequences from chlamydial genomic DNA: X@pUC F and R Primer pair surrounding, but directed away from, the target gene: X-away F and R Primer pair for amplifying the bla-gfp cassette from pUC19G: bla-gfp F: GGAAATGTGCGCGGAACCC bla-gfp R: TTACTTGTATAGTTCATCCATGCCATGTG Primer pair for amplifying the homologous recombination sequence for insertion into pSUmC: HomRR@pSUmC F: CTGCAGGTACCGGTCGACCATTC GGTCTGACGCTCAGTGGAACG HomRR@pSUmC R: GATCTTTCTACGGGGTCTGACGCTC CTGGCGTTACCCAACTTAATCGCC Q5® High-Fidelity DNA Polymerase (M0491S, NEB) DpnI restriction enzyme (R0176S, NEB) Cutsmart buffer (B7204S, NEB) T4 Polynucleotide Kinase (M0201S, NEB) Quick Ligation™ Kit (M2200S, NEB) NEB® 10-beta Competent E. coli (C3019H, NEB) dam− /dcm− Competent E. coli (C2925I, NEB) Zyppy™ Plasmid Miniprep Kit (D4036, Zymo Research) Zymoclean™ Gel DNA Recovery Kit (D4001, Zymo Research) QIAfilter Plasmid Maxi Kit (12262, Qiagen) Spectinomycin dihydrochloride pentahydrate (J61820, Alfa Aesar) Carbenicillin disodium salt (J61949, Alfa Aesar) LB Media (J106, VWR) Agar Powder ( , Alfa Aesar) Agarose LE (BMK-A1705, KSE Scientific) Phenol–Chloroform (6805, EMD Millipore) 3M sodium acetate 100% ethanol Design primers for amplifying gene × flanked upstream and downstream (±) by 3 kb arms for insertion into pUC18A. .. Sequences should be designed with melting temperatures of approximately 60°C which hairpin at temperatures no higher than 40°C, as determined by OligoAnalyzer 3.1 (Integrated DNA Technologies).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    New England Biolabs dam dcm e coli strain
    Dam Dcm E Coli Strain, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dam dcm e coli strain/product/New England Biolabs
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    dam dcm e coli strain - by Bioz Stars, 2019-10
    99/100 stars
      Buy from Supplier

    Image Search Results