e coli k12 strain novablue de3  (Millipore)


Bioz Verified Symbol Millipore is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Millipore e coli k12 strain novablue de3
    E Coli K12 Strain Novablue De3, supplied by Millipore, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli k12 strain novablue de3/product/Millipore
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    e coli k12 strain novablue de3 - by Bioz Stars, 2020-04
    86/100 stars

    Related Products / Commonly Used Together

    recombinant ε-prototoxin
    expression vector pet-29a

    Images

    Related Articles

    Centrifugation:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , . .. The cells were collected by centrifugation, resuspended in 5% culture volume of B-PER Bacterial Protein Extraction Reagent (Pierce) supplemented with Complete Mini protease inhibitor cocktail (EDTA-free, Roche), and mixed for 10 minutes at room temperature.

    Positron Emission Tomography:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: .. Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI). .. Five 83-mer oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer.

    Synthesized:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI). .. Five 83-mer oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer.

    Protease Inhibitor:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , . .. The cells were collected by centrifugation, resuspended in 5% culture volume of B-PER Bacterial Protein Extraction Reagent (Pierce) supplemented with Complete Mini protease inhibitor cocktail (EDTA-free, Roche), and mixed for 10 minutes at room temperature.

    Purification:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: .. Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , . .. The cells were collected by centrifugation, resuspended in 5% culture volume of B-PER Bacterial Protein Extraction Reagent (Pierce) supplemented with Complete Mini protease inhibitor cocktail (EDTA-free, Roche), and mixed for 10 minutes at room temperature.

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: RecA protein was purified as described ( ). .. Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI).

    Produced:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: ε-toxin purification and cytotoxicity assays Previous studies have demonstrated that native and recombinant ε-toxin produced in E. coli exhibit similar specific activities in standard tissue-culture based assays of toxin activity , , , , , . .. Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , .

    Polymerase Chain Reaction:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: ATP and adenosine 5′-[γ-thio]triphosphate (ATPγS) were purchased from Sigma; T4 polynucleotide kinase, T4 DNA ligase and restriction enzymes were purchased from New England Biolabs (Beverly, MA); DNase I, DTT, BSA, and an Expand High Fidelity PCR kit were purchased from Boehringer Mannheim. .. Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI).

    Protein Extraction:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , . .. The cells were collected by centrifugation, resuspended in 5% culture volume of B-PER Bacterial Protein Extraction Reagent (Pierce) supplemented with Complete Mini protease inhibitor cocktail (EDTA-free, Roche), and mixed for 10 minutes at room temperature.

    Activity Assay:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: ε-toxin purification and cytotoxicity assays Previous studies have demonstrated that native and recombinant ε-toxin produced in E. coli exhibit similar specific activities in standard tissue-culture based assays of toxin activity , , , , , . .. Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , .

    Expressing:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: .. Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI). .. Five 83-mer oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer.

    Sequencing:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI). .. Four others, which had no known sequence homology to M13 DNA contained 84% AT bp: A16(−): 5′-AAATGAACATAAAGTAAATAAGTATAAGGATAATACAAAATAAGTAAATGAATAAACATAGAAAATAAAGTAAAGGATATAAA and its complement, A16(+); ATII(−): 5′-ATGTATATTGATATATTGATTAGTATTAGTTATTGTTATGTTTAGTTTATTT-CTTGATTTGATTATTACTTTGTATTATAGAT, and its complement, ATII(+).

    Recombinant:

    Article Title: Gene-Trap Mutagenesis Identifies Mammalian Genes Contributing to Intoxication by Clostridium perfringens ?-Toxin
    Article Snippet: .. Recombinant ε-prototoxin was expressed in E. coli K12 strain NovaBlue (DE3) (Novagen), and purified essentially as described , . .. The cells were collected by centrifugation, resuspended in 5% culture volume of B-PER Bacterial Protein Extraction Reagent (Pierce) supplemented with Complete Mini protease inhibitor cocktail (EDTA-free, Roche), and mixed for 10 minutes at room temperature.

    Plasmid Preparation:

    Article Title: Recombination activities of HsDmc1 protein, the meiotic human homolog of RecA protein
    Article Snippet: .. Expression vector pET-29a(+) and E. coli K12 strain NovaBlue(DE3) were from Novagen (Madison, WI). .. Five 83-mer oligonucleotides were synthesized on an Applied Biosystems DNA synthesizer.