dtt ultrapure  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    UltraPure Dithiothreitol
    Description:
    UltraPure Dithiothreitol DTT Cleland s reagent which reduces disulfides to their corresponding thiols is used at low concentrations to stabilize enzymes containing free sulfhydryl groups Higher concentrations of DTT are used to cleave disulfide linkages in polypeptides and to facilitate protein denaturation by detergents or chaotropic agents
    Catalog Number:
    15508013
    Price:
    None
    Applications:
    1D Gel Electrophoresis|Novex® Tricine Gel Electrophoresis|Novex® Tris-Glycine Gel Electrophoresis|NuPAGE® Novex® Bis-Tris Gel Electrophoresis|NuPAGE® Novex® Tris-Acetate Gel Electrophoresis|Protein Biology|Protein Gel Electrophoresis
    Category:
    Lab Reagents and Chemicals
    Buy from Supplier


    Structured Review

    Thermo Fisher dtt ultrapure
    Determination of the relative Cu(I)-binding affinity of de-coppering drugs in competition with Cu 1 Cox17. Fractional occupancy of Cu(I)-binding sites in Cox17 at different concentrations of PA ( a ), TR ( b ), <t>BAL</t> ( c ), DMS ( d ) and TTM ( e ) in a metal competition experiment. Conditions: Cox17 1 μM; 20 mM ammonium acetate, pH = 7.3, <t>DTT</t> 50 μM; T = 25 °C. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with hyperbolic equation (y = P1*(1 − [x/(P2 + x)]) + P3), where P2 = C 50 .
    UltraPure Dithiothreitol DTT Cleland s reagent which reduces disulfides to their corresponding thiols is used at low concentrations to stabilize enzymes containing free sulfhydryl groups Higher concentrations of DTT are used to cleave disulfide linkages in polypeptides and to facilitate protein denaturation by detergents or chaotropic agents
    https://www.bioz.com/result/dtt ultrapure/product/Thermo Fisher
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dtt ultrapure - by Bioz Stars, 2020-03
    99/100 stars

    Related Products / Commonly Used Together

    dla
    dms
    diethylammonium detc
    ammonium ttm
    iodoacetamide

    Images

    1) Product Images from "Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent"

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-19873-2

    Determination of the relative Cu(I)-binding affinity of de-coppering drugs in competition with Cu 1 Cox17. Fractional occupancy of Cu(I)-binding sites in Cox17 at different concentrations of PA ( a ), TR ( b ), BAL ( c ), DMS ( d ) and TTM ( e ) in a metal competition experiment. Conditions: Cox17 1 μM; 20 mM ammonium acetate, pH = 7.3, DTT 50 μM; T = 25 °C. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with hyperbolic equation (y = P1*(1 − [x/(P2 + x)]) + P3), where P2 = C 50 .
    Figure Legend Snippet: Determination of the relative Cu(I)-binding affinity of de-coppering drugs in competition with Cu 1 Cox17. Fractional occupancy of Cu(I)-binding sites in Cox17 at different concentrations of PA ( a ), TR ( b ), BAL ( c ), DMS ( d ) and TTM ( e ) in a metal competition experiment. Conditions: Cox17 1 μM; 20 mM ammonium acetate, pH = 7.3, DTT 50 μM; T = 25 °C. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with hyperbolic equation (y = P1*(1 − [x/(P2 + x)]) + P3), where P2 = C 50 .

    Techniques Used: Binding Assay

    Determination of the relative Cu(I)-binding affinity of TTM and DETC in competition with Cu 10 MT. ESI-MS spectra of Cu 10 MT in the presence of 1 μM–20 μM TTM ( a ) and 0.1–7 mM DETC ( c ). Conditions: MT 3 μM; 20 mM ammonium acetate, pH = 7.3, DTT 10 mM; T = 25 °C. Ions with a charge state + 5 are shown; numbers on the peaks denote the metal stoichiometry of the complex. Number of asterisks denotes number of TTM molecules in the complex. Fractional occupancy of Cu(I)-binding sites in MT at different concentrations of TTM ( b ) and DETC ( d ) in a metal competition experiment. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with Hill equation (y = START + (END − START) * x^n / (K^n + x^n)), where K = C 50 .
    Figure Legend Snippet: Determination of the relative Cu(I)-binding affinity of TTM and DETC in competition with Cu 10 MT. ESI-MS spectra of Cu 10 MT in the presence of 1 μM–20 μM TTM ( a ) and 0.1–7 mM DETC ( c ). Conditions: MT 3 μM; 20 mM ammonium acetate, pH = 7.3, DTT 10 mM; T = 25 °C. Ions with a charge state + 5 are shown; numbers on the peaks denote the metal stoichiometry of the complex. Number of asterisks denotes number of TTM molecules in the complex. Fractional occupancy of Cu(I)-binding sites in MT at different concentrations of TTM ( b ) and DETC ( d ) in a metal competition experiment. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with Hill equation (y = START + (END − START) * x^n / (K^n + x^n)), where K = C 50 .

    Techniques Used: Binding Assay, Mass Spectrometry

    2) Product Images from "Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent"

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-19873-2

    Determination of the relative Cu(I)-binding affinity of TTM and DETC in competition with Cu 10 MT. ESI-MS spectra of Cu 10 MT in the presence of 1 μM–20 μM TTM ( a ) and 0.1–7 mM DETC ( c ). Conditions: MT 3 μM; 20 mM ammonium acetate, pH = 7.3, DTT 10 mM; T = 25 °C. Ions with a charge state + 5 are shown; numbers on the peaks denote the metal stoichiometry of the complex. Number of asterisks denotes number of TTM molecules in the complex. Fractional occupancy of Cu(I)-binding sites in MT at different concentrations of TTM ( b ) and DETC ( d ) in a metal competition experiment. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with Hill equation (y = START + (END − START) * x^n / (K^n + x^n)), where K = C 50 .
    Figure Legend Snippet: Determination of the relative Cu(I)-binding affinity of TTM and DETC in competition with Cu 10 MT. ESI-MS spectra of Cu 10 MT in the presence of 1 μM–20 μM TTM ( a ) and 0.1–7 mM DETC ( c ). Conditions: MT 3 μM; 20 mM ammonium acetate, pH = 7.3, DTT 10 mM; T = 25 °C. Ions with a charge state + 5 are shown; numbers on the peaks denote the metal stoichiometry of the complex. Number of asterisks denotes number of TTM molecules in the complex. Fractional occupancy of Cu(I)-binding sites in MT at different concentrations of TTM ( b ) and DETC ( d ) in a metal competition experiment. Results of duplicate experiments are presented with different symbols. The solid line shows the fitting curve with Hill equation (y = START + (END − START) * x^n / (K^n + x^n)), where K = C 50 .

    Techniques Used: Binding Assay, Mass Spectrometry

    Related Articles

    Centrifugation:

    Article Title: Toll-Like Receptor 7 Agonist–Induced Dermatitis Causes Severe Dextran Sulfate Sodium Colitis by Altering the Gut Microbiome and Immune Cells
    Article Snippet: After washing, the colon was further cut into small pieces and incubated with HBSS containing 1 mmol/L dithiothreitol (15508-013; lot H1095A0517; Invitrogen, Carlsbad, CA) and 5 mmol/L EDTA (15575038; lot 1624957; Thermo Fisher Scientific, Waltham, MA) for 30 minutes at 37°C to remove the epithelial layer. .. Percoll gradient separation was performed by centrifugation at 2000 rpm for 20 minutes at 20°C.

    Amplification:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Article Title: Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations
    Article Snippet: .. Materials The following materials were used: “ERCC RNA Spike-In Mix 1” stock (#4456740, Ambion, Thermo), RNA storage solution (Ambion, Thermo), Triton-X 100 (molecular biology grade, Sigma), dNTP mix (Advantage UltraPure PCR Deoxynucleotide Mix 10 mM each dNTP, Clontech), RNAse inhibitor (Clontech), Superscript III enzyme and Superscript III first-strand buffer (Invitrogen, Thermo), ultrapure DTT (Invitrogen, Thermo), Betaine (Sigma), MgCl2 (Sigma), oligo-dT30V primer (IDT), template switch primer (IDT), cDNA amplification primer (IDT) (the sequences are given in ), 2X KAPA2G Robust HotStart ReadyMix (kapabiosystems), AMPure XP beads (Beckman Coulter), NEBNext End Repair Module (New England Biolabs, UK), NEBNext dA-Tailing Module (New England Biolabs, UK). ..

    Cytometry:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer. .. Immunophenotypic studies were performed by polychromatic flow cytometry (as detailed below) on mononuclear cells derived from all tissues.

    Quantitative RT-PCR:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C. .. The RNA was then treated with 2 units of Turbo DNase (Thermo Fisher Scientific; cat#AM2238) for 15 min at 37°C and precipitated by adding equal volume of 7.5 M LiCl followed by incubation at −20°C for at least 1 hour.

    SYBR Green Assay:

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Incubation:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C. .. The RNA was then treated with 2 units of Turbo DNase (Thermo Fisher Scientific; cat#AM2238) for 15 min at 37°C and precipitated by adding equal volume of 7.5 M LiCl followed by incubation at −20°C for at least 1 hour.

    Article Title: Sex-specific hippocampal 5-hydroxymethylcytosine is disrupted in response to acute stress
    Article Snippet: .. Enriched DNA was released from the beads during a 2-hour incubation at room temperature with 100mM DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732–6227). ..

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: .. Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer. .. Lamina propria lymphocytes were separated, following the removal of the intraepithelial lymphocytes, by incubating with collagenase D (400 U/ml; Boehringer Mannheim, Mannheim, Germany) and DNase (1 μg/ml; Invitrogen, Carlsbad, CA) for 2 h at 37°C in Iscove's modified Dulbecco's medium supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin.

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.). .. Ten microliters of each methylation reaction was then denatured and reduced by incubation with an equal volume of 5 m m DTT in 100 m m ammonium bicarbonate containing 0.1% acid-labile detergent RapiGest (Waters) for 30 min at 60 °C, alkylated by incubation with iodoacetamide in 100 m m ammonium bicarbonate in the dark at room temperature for 30 min, and digested with the addition of 10 ng MS-grade trypsin (Thermo Scientific) in 10 μl of 100 m m ammonium bicarbonate and overnight incubation at 37 °C.

    Article Title: Requirement of the human T-cell leukemia virus p12 and p30 products for infectivity of human dendritic cells and macaques but not rabbits
    Article Snippet: Jejunal biopsies were treated with 1mM ultrapure dithiothreitol (Invitrogen) for 25 minutes in Hanks Buffered Saline Solution (Gibco Invitrogen) without calcium chloride, magnesium chloride, and magnesium sulfate. .. The cultures were incubated for 1 hour followed by an additional 4 hours in the presence of the secretion inhibitor monensin (0.5 μL/mL; BD PharMingen) and brefeldin A (10 μg/mL; Sigma).

    Article Title: Toll-Like Receptor 7 Agonist–Induced Dermatitis Causes Severe Dextran Sulfate Sodium Colitis by Altering the Gut Microbiome and Immune Cells
    Article Snippet: .. After washing, the colon was further cut into small pieces and incubated with HBSS containing 1 mmol/L dithiothreitol (15508-013; lot H1095A0517; Invitrogen, Carlsbad, CA) and 5 mmol/L EDTA (15575038; lot 1624957; Thermo Fisher Scientific, Waltham, MA) for 30 minutes at 37°C to remove the epithelial layer. .. After removal of the epithelial layer, the mucosal pieces were washed with HBSS and dissolved in solution by incubation with HBSS containing 1.5% fetal bovine serum (10270-106, lot 42Q1074K; Thermo Fisher Scientific), 1.0 to 3.0 mg/mL collagenase (032-22364, lot PTQ3925; Wako), and 0.1 mg/mL DNase (DN25-1G, lot SLBV1446; Sigma-Aldrich, St. Louis, MO) for 1 hour at 37°C.

    Article Title: Genome-wide disruption of 5-hydroxymethylcytosine in a mouse model of autism
    Article Snippet: .. Enriched DNA was released from the beads during a 2-h incubation at room temperature with 100 m m DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732-6227). ..

    Mass Spectrometry:

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.). .. Ten microliters of each methylation reaction was then denatured and reduced by incubation with an equal volume of 5 m m DTT in 100 m m ammonium bicarbonate containing 0.1% acid-labile detergent RapiGest (Waters) for 30 min at 60 °C, alkylated by incubation with iodoacetamide in 100 m m ammonium bicarbonate in the dark at room temperature for 30 min, and digested with the addition of 10 ng MS-grade trypsin (Thermo Scientific) in 10 μl of 100 m m ammonium bicarbonate and overnight incubation at 37 °C.

    Modification:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer. .. Lamina propria lymphocytes were separated, following the removal of the intraepithelial lymphocytes, by incubating with collagenase D (400 U/ml; Boehringer Mannheim, Mannheim, Germany) and DNase (1 μg/ml; Invitrogen, Carlsbad, CA) for 2 h at 37°C in Iscove's modified Dulbecco's medium supplemented with 10% fetal bovine serum (FBS) and penicillin-streptomycin.

    Western Blot:

    Article Title: Autophagy is dispensable for Kmt2a/Mll-Mllt3/Af9 AML maintenance and anti-leukemic effect of chloroquine
    Article Snippet: .. Cell lysis buffer for western blot contained 63 mM Tris, pH 6.8 (Research Products International,T60050), 2% SDS (Bio-Rad, 161–0302), 10% glycerol (Research Products International, ), 0.01% bromophenol blue (Bio-Rad, 161–0404), 10mM NaF (Sigma-Aldrich, s6521), 4mM dithiothreitol (DTT; ThermoFisher Scientific, 15508013), 0.2 mM sodium orthovanadate (Santa Cruz Biotechnology, sc-24948A),10 mM β-glycerophosphate (Calbiochem,35675), 1 mM PMSF (Santa Cruz Biotechnology, sc-24948A), 5% β-mercaptoethanol (Thermo Fisher, 60–24–2) and proteinase inhibitor cocktail (Santa Cruz Biotechnology; sc-24948A). .. Whole cell lysate was resolved on a 4% to 15% precast gel (Bio-Rad, 456–1086) and transferred to PVDF (EMD Millipore, IPFL00010) using the Bio-Rad Transblot Turbo® system.

    Derivative Assay:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer. .. Immunophenotypic studies were performed by polychromatic flow cytometry (as detailed below) on mononuclear cells derived from all tissues.

    Flow Cytometry:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer. .. Immunophenotypic studies were performed by polychromatic flow cytometry (as detailed below) on mononuclear cells derived from all tissues.

    Concentration Assay:

    Article Title: A novel assay to assess the effect of pharmaceutical compounds on the differentiation of podocytes) A novel assay to assess the effect of pharmaceutical compounds on the differentiation of podocytes
    Article Snippet: Aliquots of 3 μg of total protein from each sample were reduced (2.5 mM DTT ultrapure for 1 h at 60°C, Invitrogen) and alkylated (10 mM iodoacetamide for 30 min at 37°C, Sigma‐Aldrich). .. The tryptic digestion was stopped by adding acetic acid at a final concentration of 1% followed by desalting using ZipTip‐μC18 tips (Merck Millipore, Darmstadt, Germany).

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: Ethanol (200 proof; Gold Shield, cat. no. 412804) Buffer RWT (Qiagen, cat. no. 1067933) HEPES, 1 M (Life Technologies, cat. no. 15630-080) Magnesium chloride, 1 M (MgCl2 ; Ambion, cat. no. AM9530G) Sodium chloride, 5 M (NaCl; Ambion, cat. no. AM9759) Click-IT biotin DIBO alkyne (Life Technologies, cat. no. C-10412) RiboLock RNase inhibitor (40 U/µl; Thermo Scientific, cat. no. EO0384) RNA fragmentation reagents (Ambion, cat. no. AM8740) T4 polynucleotide kinase (PNK; New England BioLabs, cat. no. M0201L) Tris, pH 7.0, 1 M (Ambion, cat. no. AM9850G) FastAP thermosensitive alkaline phosphatase (1 U/µl; Thermo Scientific, cat. no. EF0651) T4 RNA ligase 1 (ssRNA ligase), high concentration (New England BioLabs, cat. no. M0437M) Preadenylylated and 3′-biotin blocked RNA linker (DMSO samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3Biotin/ ▲ CRITICAL 5′preadenylylated and 3′ blocked RNA linkers are important for efficient 3′end RNA ligations. .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary.

    Generated:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Polymerase Chain Reaction:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Article Title: Benchmarking of the Oxford Nanopore MinION sequencing for quantitative and qualitative assessment of cDNA populations
    Article Snippet: .. Materials The following materials were used: “ERCC RNA Spike-In Mix 1” stock (#4456740, Ambion, Thermo), RNA storage solution (Ambion, Thermo), Triton-X 100 (molecular biology grade, Sigma), dNTP mix (Advantage UltraPure PCR Deoxynucleotide Mix 10 mM each dNTP, Clontech), RNAse inhibitor (Clontech), Superscript III enzyme and Superscript III first-strand buffer (Invitrogen, Thermo), ultrapure DTT (Invitrogen, Thermo), Betaine (Sigma), MgCl2 (Sigma), oligo-dT30V primer (IDT), template switch primer (IDT), cDNA amplification primer (IDT) (the sequences are given in ), 2X KAPA2G Robust HotStart ReadyMix (kapabiosystems), AMPure XP beads (Beckman Coulter), NEBNext End Repair Module (New England Biolabs, UK), NEBNext dA-Tailing Module (New England Biolabs, UK). ..

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Sonication:

    Article Title: Sex-specific hippocampal 5-hydroxymethylcytosine is disrupted in response to acute stress
    Article Snippet: Briefly, a total of 10ug of hippocampal was sonicated to 300 bp fragments and incubated for 1 hour at 37°C in the following labeling reaction: 1.5 ul of N3-UDPG (2mM); 1.5ulβ of −GT (60uM); and 3ul of 10X β-GT buffer, in a total of 30ul. .. Enriched DNA was released from the beads during a 2-hour incubation at room temperature with 100mM DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732–6227).

    Article Title: Genome-wide disruption of 5-hydroxymethylcytosine in a mouse model of autism
    Article Snippet: Briefly, a total of 10 µg of striatum DNA was sonicated to 300 bp and incubated for 1 h at 37°C in the following labeling reaction: 1.5 µl of N3-UDPG (2 m m ); 1.5 µlβ of -GT (60 µm) and 3 µl of 10× β-GT buffer, in a total of 30 µl. .. Enriched DNA was released from the beads during a 2-h incubation at room temperature with 100 m m DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732-6227).

    Recombinant:

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent
    Article Snippet: Chemical reagents: PA, TR, BAL, DMS, LA, ammonium TTM, diethylammonium DETC were purchased from Sigma-Aldrich, DTT (ultrapure) from USB Corporation, DLA from Santa Cruz Biotechnology. .. Recombinant human Cu,Zn-SOD was purchased from Biovision Inc. All solutions were prepared immediately before the experiments in 20 mM ammonium acetate, pH 7.3 buffer in the absence of organic solvents.

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: .. Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.). .. S-Adenosyl- l -homocysteine (SAH) levels were measured by bioluminescence using the MTase-GLOTM Reagent (Promega, Madison, WI) according to manufacturer instructions.

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent
    Article Snippet: Reagents Chemical reagents: PA, TR, BAL, DMS, LA, ammonium TTM, diethylammonium DETC were purchased from Sigma-Aldrich, DTT (ultrapure) from USB Corporation, DLA from Santa Cruz Biotechnology. .. Recombinant human Cu,Zn-SOD was purchased from Biovision Inc. All solutions were prepared immediately before the experiments in 20 mM ammonium acetate, pH 7.3 buffer in the absence of organic solvents.

    ATP Bioluminescent Assay:

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: Paragraph title: SMYD2 Methylation Assays, SAH bioluminescence assay, and LC-MS/MS ... Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.).

    Methylation:

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: .. Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.). .. S-Adenosyl- l -homocysteine (SAH) levels were measured by bioluminescence using the MTase-GLOTM Reagent (Promega, Madison, WI) according to manufacturer instructions.

    Isolation:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Mononuclear cells were isolated from blood, rectal, jejunal pinch biopsy, lymph node biopsy, and bone marrow aspirate specimens. .. Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer.

    Electrophoretic Mobility Shift Assay:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Purification:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Lymph nodes were homogenized and passed through a 100-μm cell strainer, and mononuclear cells were purified by density gradient centrifugation (Ficoll). .. Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer.

    Article Title: Quantitative Profiling of the Activity of Protein Lysine Methyltransferase SMYD2 Using SILAC-Based Proteomics *
    Article Snippet: .. Biochemical methylation assays using recombinant full-length human SMYD2 enzyme (purified in-house) were performed in 50 μl reactions overnight at 37 °C with shaking in 20 m m TRIZMA buffer (Sigma-Aldrich), pH 8.5 or 9.1, supplemented with 1 μ m S-adenosyl- l -methionine (Sigma-Aldrich), 0.005% Surfact-Amps® 20 (Thermo Scientific), 4 m m Ultrapure DTT (Thermo Scientific), and 100 n m of the following His-tagged recombinant proteins: full-length BTF3 (Abcam, Cambridge, MA, 139205), full-length PDAP1 (Abcam, ab40188), full-length p53 (purified in-house), AHNAK (amino acids 4105–4634; Bio Basic Inc, Markham, ON), and AHNAK2 (amino acids 832–1491; Bio Basic Inc.). .. S-Adenosyl- l -homocysteine (SAH) levels were measured by bioluminescence using the MTase-GLOTM Reagent (Promega, Madison, WI) according to manufacturer instructions.

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Labeling:

    Article Title: Sex-specific hippocampal 5-hydroxymethylcytosine is disrupted in response to acute stress
    Article Snippet: Briefly, a total of 10ug of hippocampal was sonicated to 300 bp fragments and incubated for 1 hour at 37°C in the following labeling reaction: 1.5 ul of N3-UDPG (2mM); 1.5ulβ of −GT (60uM); and 3ul of 10X β-GT buffer, in a total of 30ul. .. Enriched DNA was released from the beads during a 2-hour incubation at room temperature with 100mM DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732–6227).

    Article Title: Genome-wide disruption of 5-hydroxymethylcytosine in a mouse model of autism
    Article Snippet: Briefly, a total of 10 µg of striatum DNA was sonicated to 300 bp and incubated for 1 h at 37°C in the following labeling reaction: 1.5 µl of N3-UDPG (2 m m ); 1.5 µlβ of -GT (60 µm) and 3 µl of 10× β-GT buffer, in a total of 30 µl. .. Enriched DNA was released from the beads during a 2-h incubation at room temperature with 100 m m DTT (Invitrogen, 15508013), which was removed using a Bio-Rad column (Bio-Rad, 732-6227).

    Polyacrylamide Gel Electrophoresis:

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Lysis:

    Article Title: Autophagy is dispensable for Kmt2a/Mll-Mllt3/Af9 AML maintenance and anti-leukemic effect of chloroquine
    Article Snippet: .. Cell lysis buffer for western blot contained 63 mM Tris, pH 6.8 (Research Products International,T60050), 2% SDS (Bio-Rad, 161–0302), 10% glycerol (Research Products International, ), 0.01% bromophenol blue (Bio-Rad, 161–0404), 10mM NaF (Sigma-Aldrich, s6521), 4mM dithiothreitol (DTT; ThermoFisher Scientific, 15508013), 0.2 mM sodium orthovanadate (Santa Cruz Biotechnology, sc-24948A),10 mM β-glycerophosphate (Calbiochem,35675), 1 mM PMSF (Santa Cruz Biotechnology, sc-24948A), 5% β-mercaptoethanol (Thermo Fisher, 60–24–2) and proteinase inhibitor cocktail (Santa Cruz Biotechnology; sc-24948A). .. Whole cell lysate was resolved on a 4% to 15% precast gel (Bio-Rad, 456–1086) and transferred to PVDF (EMD Millipore, IPFL00010) using the Bio-Rad Transblot Turbo® system.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; catM0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C. .. The RNA was then treated with 2 units of Turbo DNase (Thermo Fisher Scientific; cat#AM2238) for 15 min at 37°C and precipitated by adding equal volume of 7.5 M LiCl followed by incubation at −20°C for at least 1 hour.

    Silver Staining:

    Article Title: Glycosylation and Sialylation of Macrophage-derived Human Apolipoprotein E Analyzed by SDS-PAGE and Mass Spectrometry
    Article Snippet: .. Goat anti-apolipoprotein E polyclonal antibodies to human apoE were obtained from Chemicon International Inc. ZOOM strips (5 × 70 mm, pH 4–7), carrier ampholyte pH 4–7, thiourea, urea, CHAPS, ultrapure dithiothreitol (DTT), ultrapure agarose, DNase I, SilverQuest™ silver staining kit, and SimplyBlue™ SafeStain were purchased from Invitrogen. .. Biotinylated Maackia amurensis lectin II (MAA), biotinylated Sambucus nigra bark lectin (SNA), and horseradish peroxidase (HRP)-avidin D were purchased from Vector Laboratories. α-(2→3,6,8,9)-Neuraminidase, α-(2→3)-neuraminidase, BSA, and RNase A were supplied by Sigma.

    Plasmid Preparation:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Briefly, 40 μL reaction mixtures containing 1 × transcription buffer, 10 mM DTT, 0.8 unit/μl rRNasin (Promega; cat#N2111), 0.5 mM ATP, 0.5 mM CTP, 0.2 mM GTP, 0.02 mM UTP, 40 μCi of [α-32 P]-UTP, 0.8 mM Ribo m7G Cap analog, 0.8 unit/μl T7 RNA polymerase and 1-2 μg of pEM1380 plasmid linearized with EcoRI were incubated for 1 h at 37°C. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Article Title: Glycosylation and Sialylation of Macrophage-derived Human Apolipoprotein E Analyzed by SDS-PAGE and Mass Spectrometry
    Article Snippet: Goat anti-apolipoprotein E polyclonal antibodies to human apoE were obtained from Chemicon International Inc. ZOOM strips (5 × 70 mm, pH 4–7), carrier ampholyte pH 4–7, thiourea, urea, CHAPS, ultrapure dithiothreitol (DTT), ultrapure agarose, DNase I, SilverQuest™ silver staining kit, and SimplyBlue™ SafeStain were purchased from Invitrogen. .. Goat anti-apolipoprotein E polyclonal antibodies to human apoE were obtained from Chemicon International Inc. ZOOM strips (5 × 70 mm, pH 4–7), carrier ampholyte pH 4–7, thiourea, urea, CHAPS, ultrapure dithiothreitol (DTT), ultrapure agarose, DNase I, SilverQuest™ silver staining kit, and SimplyBlue™ SafeStain were purchased from Invitrogen.

    In Vitro:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Radiolabeled PNCTR RNA fragments used in electrophoretic mobility shift assays (EMSA) were generated by in vitro transcription with T7 RNA polymerase (Promega; cat#P2075), as recommended. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Evaporation:

    Article Title: A novel assay to assess the effect of pharmaceutical compounds on the differentiation of podocytes) A novel assay to assess the effect of pharmaceutical compounds on the differentiation of podocytes
    Article Snippet: Aliquots of 3 μg of total protein from each sample were reduced (2.5 mM DTT ultrapure for 1 h at 60°C, Invitrogen) and alkylated (10 mM iodoacetamide for 30 min at 37°C, Sigma‐Aldrich). .. Extracts were then concentrated by evaporation under vacuum and subsequently resolved in 0.1% acetic acid, 2% acetonitrile (ACN).

    Produced:

    Article Title: A Short Tandem Repeat-Enriched RNA Assembles a Nuclear Compartment to Control Alternative Splicing and Promote Cell Survival
    Article Snippet: Unlabeled probes used in EMSA competition assays were produced by transcribing pEM1380 cut with EcoRI (PNCTR fragment) or a PCR fragment amplified from pcDNA3 using KAPA HiFi polymerase (Kapa Biosystems; cat#KK2102) and EMSA_control_F/EMSA_control_R primers ( ; control fragment) using the mMESSAGE mMACHINE T7 RNA polymerase kit. .. To obtain PNCTR RNA fragment used to prepare a standard curve for qRT-PCR quantification, 20 μl reactions containing 1 × RNAPol reaction buffer, 0.5 mM NTP mix, 1 unit of murine RNase inhibitor (New England Biolabs; cat# M0314), 5 mM DTT (Thermo Fisher Scientific; cat# 15508013), 100 units of T7 RNA polymerase (New England Biolabs; cat#M0251S) and 1 μg of pML154 linearized by EcoRI were incubated for 2 hours at 37°C.

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent
    Article Snippet: Chemical reagents: PA, TR, BAL, DMS, LA, ammonium TTM, diethylammonium DETC were purchased from Sigma-Aldrich, DTT (ultrapure) from USB Corporation, DLA from Santa Cruz Biotechnology. .. Rabbit apo-MT2A was purchased from Bestenbalt LLC and apo-Cox173S-S was produced as described previously .

    Article Title: Copper(I)-binding properties of de-coppering drugs for the treatment of Wilson disease. α-Lipoic acid as a potential anti-copper agent
    Article Snippet: Reagents Chemical reagents: PA, TR, BAL, DMS, LA, ammonium TTM, diethylammonium DETC were purchased from Sigma-Aldrich, DTT (ultrapure) from USB Corporation, DLA from Santa Cruz Biotechnology. .. Rabbit apo-MT2A was purchased from Bestenbalt LLC and apo-Cox173S-S was produced as described previously .

    Oligonucleotide Synthesis:

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Staining:

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary. .. Dynabeads MyOne streptavidin C1 (Life Technologies, cat. no. 65002) Tween 20 (Sigma-Aldrich, cat. no. P1379-500ML) UltraPure 1 M Tris-HCI buffer, pH 7.5 (Invitrogen, cat. no. 15567-027) Nonidet P40 (NP-40) (or substitute, IGEPAL CA-630; Roche, cat. no. 11332473001) N -Lauroylsarcosine sodium salt solution (20%, for molecular biology; Sigma-Aldrich, cat. no. L7414-10ML) Deoxycholic acid sodium salt (Fisher Scientific, cat. no. BP349-100) D-Biotin (Molecular Probes, cat. no. ) RNase cocktail enzyme mix (Ambion, cat. no. AM2286) RNaseH (Enzymatics, cat. no. Y9220L) Isopropanol (Molecular Biology Grade; Fisher Scientific, cat. no. BP2618-1) DNA ladder, 25 bp (Invitrogen, cat. no. 10597-011) Gel loading buffer II (Denaturing PAGE; Ambion, cat. no. AM8547) SYBR Gold nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-11494) BlueJuice gel loading buffer, 10× (Invitrogen, cat. no. 10816-015) 40% (wt/vol) acrylamide/Bis solution, 29:1 (Bio-Rad, cat. no. 161-0146) CircLigase II ssDNA ligase (Epicentre, cat. no. CL9025K) Phusion high-fidelity (HF) PCR master mix with HF buffer (New England BioLabs, cat. no. M0531L) SYBR Green I nucleic acid gel stain, 10,000× (Life Technologies, cat. no. S-7563) P5-Solexa PCR primer (IDT, PAGE purified): 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3′ P3-Solexa PCR primer (IDT, PAGE purified): 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTG CTGAACCGCTC TTCCGATCT-3′

    Gradient Centrifugation:

    Article Title: Preexisting Infection with Human T-Cell Lymphotropic Virus Type 2 neither Exacerbates nor Attenuates Simian Immunodeficiency Virus SIVmac251 Infection in Macaques ▿
    Article Snippet: Lymph nodes were homogenized and passed through a 100-μm cell strainer, and mononuclear cells were purified by density gradient centrifugation (Ficoll). .. Rectal and jejunal pinch biopsy specimens were treated with 1 mM ultrapure dithiothreitol (Invitrogen, Carlsbad, CA) for 20 min followed by incubation in 0.1 M EDTA solution in calcium-magnesium-free HBSS with penicillin-streptomycin for 60 min to remove the epithelial layer.

    Article Title: Requirement of the human T-cell leukemia virus p12 and p30 products for infectivity of human dendritic cells and macaques but not rabbits
    Article Snippet: Lymph nodes and appendixes were homogenized and passed through a 100-μm cell strainer, then separated by density gradient centrifugation. .. Jejunal biopsies were treated with 1mM ultrapure dithiothreitol (Invitrogen) for 25 minutes in Hanks Buffered Saline Solution (Gibco Invitrogen) without calcium chloride, magnesium chloride, and magnesium sulfate.

    Hood:

    Article Title: Transcriptome-wide interrogation of RNA secondary structure in living cells with icSHAPE
    Article Snippet: CAUTION Trizol and chloroform are hazardous, and caution should be taken when handling them; work should be performed in a chemical fume hood. .. Preadenylylated and 3′-ddC blocked RNA linker (NAI-N3 samples, IDT, PAGE purified): /5rApp/AGATCGGAAGAGCGGTTCAG/3ddC/ UltraPure DTT (Invitrogen, cat. no. 15508-013) SequaGel UreaGel System, 2.2 liter kit (National Diagnostics, cat. no. EC-833-2.2LTR) Ultrapure TEMED (Invitrogen, cat. no. 15524-010) Ammonium persulfate (APS; Thomas Scientific, cat. no. 0149N94) Ultrapure TBE buffer, 10× (Life Technologies, cat. no. 15581-044) EDTA (Ambion, cat. no. AM9260G) UltraPure 10% (wt/vol) SDS solution (Life Technologies, cat. no. 15553-027) SuperScript III reverse transcriptase (Invitrogen, cat. no. 18080-044) Deoxynucleotide solution mix, 10 mM (dNTPs; New England BioLabs, cat. no. N0447L) RT-primer-1 (IDT, standard desalting purification, underlined portion is the experimental barcode ) /5phos/DDDNNAACCNNNNAGATCGGAAGAGCGTCGTGGA/iSp18/GGATCC/iSp18/TACTGAACCGC; D = A/G/T and N = A/T/G/C are used to discriminate PCR duplicates, ‘AACC’ is the specific experimental barcode) ▲ CRITICAL The quality of the oligonucleotide synthesis should be verified by PAGE analysis; however, bulk PAGE purification before use in RT reactions is not necessary.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Thermo Fisher ultrapure dithiothreitol
    Ultrapure Dithiothreitol, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 11 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/ultrapure dithiothreitol/product/Thermo Fisher
    Average 99 stars, based on 11 article reviews
    Price from $9.99 to $1999.99
    ultrapure dithiothreitol - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results