Structured Review

Metabion International AG dntps
Dntps, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 94/100, based on 5 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntps/product/Metabion International AG
Average 94 stars, based on 5 article reviews
Price from $9.99 to $1999.99
dntps - by Bioz Stars, 2020-04
94/100 stars

Images

Related Articles

DNA Extraction:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: Paragraph title: DNA extraction and marker analysis ... Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG).

Marker:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: Paragraph title: DNA extraction and marker analysis ... Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG).

Centrifugation:

Article Title: Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)
Article Snippet: Total RNA was extracted using TRI Reagent® Solution (Ambion Inc., Austin, TX, USA) following the supplier's protocol ( http://www.ambion.com/techlib/prot/bp_9738.pdf ) with the following modifications: the incubation of the homogenate was extended to 10 min; instead of 100 µl bromochloropropane, 200 µl of ice cold chloroform was used; the steps including the addition of ice cold chloroform, followed by incubation at room temperature and centrifugation at 12 000g were repeated once; in addition to the 500 µl isopropanol, 0.5 µl Glycogen (Sigma-Aldrich, St Louis, Missouri, USA) was added to enhance the RNA yield; the centrifugation following the addition of isopropanol was extended to 10 min. .. For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2 O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.).

Amplification:

Article Title: New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species
Article Snippet: The amplicon lengths varied from 195 to 658 bp depending on the primer set used. .. Thirty-microlitre PCR reactions were set up using 3 µL DNA template, 6 µL 5× Phusion™ HF Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0·6 µL forward primer (10 m m ), 0·6 µL reverse primer (10 m m ), 0·6 µL dNTPs (Metabion International AG, Martinsried, Germany) (10 m m ), 18·96 µL ddH2 O and 0·24 µL Phusion™ Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Inc.).

Article Title: Bruchpilot in Ribbon-Like Axonal Agglomerates, Behavioral Defects, and Early Death in SRPK79D Kinase Mutants of Drosophila
Article Snippet: The oligo-dT-primer used was purchased from MBI Fermentas (oligo(dT18 ), MBI Fermentas; St.Leon-Rot; Germany) and the dNTPs were from Metabion (Metabion international AG; Planegg-Martinsried; Germany). .. The cDNA of the Srpk79D gene was amplified using different sets of specific primers (from Eurofins MWG GmbH; Ebersberg; Germany).

Synthesized:

Article Title: Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)
Article Snippet: First strand cDNA was synthesized using SuperScript™ III Reverse Transcriptase (Invitrogen™ Corporation, Carlsbad, CA, USA) following the manufacturer's instructions. .. For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2 O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.).

Mutagenesis:

Article Title: Bruchpilot in Ribbon-Like Axonal Agglomerates, Behavioral Defects, and Early Death in SRPK79D Kinase Mutants of Drosophila
Article Snippet: The oligo-dT-primer used was purchased from MBI Fermentas (oligo(dT18 ), MBI Fermentas; St.Leon-Rot; Germany) and the dNTPs were from Metabion (Metabion international AG; Planegg-Martinsried; Germany). .. The following primer pairs were used for the transcript analysis (cf.): 1f: 5′ACGAGAATTCGATGGCCGGCCTCATC3′ 1r: 5′GTACGGTGTTGGGCTTG3′ 2f: 5′CGGCGAATTCGATGGATGACTTTGGCT3′ 2r: 5′GTACGGTGTTGGGCTTG3′ 3f: 5′AAAAGCTTACCGGTTTCGAG3′ 3r: 5′TCGAAGGCCAAACAGGC3′ 4f: 5′GTTGTGGTGTGCATGGAAAG3′ 4r: 5′CAATCATATATGTAGGTGTGGCCA3′ 5f: 5′GCCTGTTTGGCCTTCGA3′ 5r: 5′AAAGCGGCCGCGACGAACTCCT3′ For verification of the parental RB rescue line UAS-RB-cDNA-GFP in Srpk79DVN null mutant background the primer pair 6f: 5′ GCGACTTCAACTTCGTCTCC 3′ 6r: 5′ GCGGATTATGTTACGCACCT 3′ was used which gives a 1240 bp product for the wild-type gene and a 1086 bp product for the cDNA transgene.

Isolation:

Article Title: Bruchpilot in Ribbon-Like Axonal Agglomerates, Behavioral Defects, and Early Death in SRPK79D Kinase Mutants of Drosophila
Article Snippet: RNA preparation, cDNA synthesis, PCR, and sequencing Total RNA was isolated using the QIAGEN RNeasy Mini Kit (Qiagen; Hilden; Germany). .. The oligo-dT-primer used was purchased from MBI Fermentas (oligo(dT18 ), MBI Fermentas; St.Leon-Rot; Germany) and the dNTPs were from Metabion (Metabion international AG; Planegg-Martinsried; Germany).

Labeling:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: .. Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG). ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)
Article Snippet: .. For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2 O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.). .. The PCR programme settings were 95°C 5 min, (95°C 1 min, 55°C 1 min, 72°C 1 min) 35 cycles, 72°C 10 min.

Incubation:

Article Title: Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)
Article Snippet: Total RNA was extracted using TRI Reagent® Solution (Ambion Inc., Austin, TX, USA) following the supplier's protocol ( http://www.ambion.com/techlib/prot/bp_9738.pdf ) with the following modifications: the incubation of the homogenate was extended to 10 min; instead of 100 µl bromochloropropane, 200 µl of ice cold chloroform was used; the steps including the addition of ice cold chloroform, followed by incubation at room temperature and centrifugation at 12 000g were repeated once; in addition to the 500 µl isopropanol, 0.5 µl Glycogen (Sigma-Aldrich, St Louis, Missouri, USA) was added to enhance the RNA yield; the centrifugation following the addition of isopropanol was extended to 10 min. .. For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2 O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.).

Polymerase Chain Reaction:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: .. Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG). ..

Article Title: New chloroplast microsatellite markers suitable for assessing genetic diversity of Lolium perenne and other related grass species
Article Snippet: .. Thirty-microlitre PCR reactions were set up using 3 µL DNA template, 6 µL 5× Phusion™ HF Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0·6 µL forward primer (10 m m ), 0·6 µL reverse primer (10 m m ), 0·6 µL dNTPs (Metabion International AG, Martinsried, Germany) (10 m m ), 18·96 µL ddH2 O and 0·24 µL Phusion™ Hot Start High-Fidelity DNA Polymerase (New England Biolabs, Inc.). ..

Article Title: Bruchpilot in Ribbon-Like Axonal Agglomerates, Behavioral Defects, and Early Death in SRPK79D Kinase Mutants of Drosophila
Article Snippet: Paragraph title: RNA preparation, cDNA synthesis, PCR, and sequencing ... The oligo-dT-primer used was purchased from MBI Fermentas (oligo(dT18 ), MBI Fermentas; St.Leon-Rot; Germany) and the dNTPs were from Metabion (Metabion international AG; Planegg-Martinsried; Germany).

Article Title: Complete Chloroplast Genome Sequence of a Major Allogamous Forage Species, Perennial Ryegrass (Lolium perenne L.)
Article Snippet: .. For each gene region, two independent RT–PCR reactions were set up using the following components per 30 µl PCR reaction: 3 µl cDNA, 3 µl 10 x Thermo Buffer (New England Biolabs, Inc., Ipswich, MA, USA), 0.6 µl FP, 0.6 µl RP, 0.6 µl dNTPs (metabion international AG, Martinsried, Germany) (10 mM), 21.9 µl ddH2 O, 0.3 µl Taq-Polymerase (New England Biolabs, Inc.). .. The PCR programme settings were 95°C 5 min, (95°C 1 min, 55°C 1 min, 72°C 1 min) 35 cycles, 72°C 10 min.

Polyacrylamide Gel Electrophoresis:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG). .. PCR fragment lengths were determined by polyacrylamide gel electrophoresis according to Borchert and Gawenda ( ).

Sequencing:

Article Title: Molecular Reconstruction of an Old Pedigree of Diploid and Triploid Hydrangea macrophylla Genotypes
Article Snippet: In addition, we developed one SSR marker based on an RNAseq contig sequence published by Chen et al. ( ). .. Polymerase chain reaction (PCR) assays were done in a total volume of 12.5 μl containing 5 ng DNA, 1x PCR buffer including MgCl2 (Metabion International AG), 0.2 mM dNTPs (Metabion International AG), 0.2 μM unlabeled forward and reverse primers, additionally 0.004 μM primer labeled with IRD700 or 0.006 μM primer labeled with IRD800 (Metabion International AG), and 0.02 U mi-Taq DNA polymerase (Metabion International AG).

Article Title: Bruchpilot in Ribbon-Like Axonal Agglomerates, Behavioral Defects, and Early Death in SRPK79D Kinase Mutants of Drosophila
Article Snippet: Paragraph title: RNA preparation, cDNA synthesis, PCR, and sequencing ... The oligo-dT-primer used was purchased from MBI Fermentas (oligo(dT18 ), MBI Fermentas; St.Leon-Rot; Germany) and the dNTPs were from Metabion (Metabion international AG; Planegg-Martinsried; Germany).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Metabion International AG dntps
    Dntps, supplied by Metabion International AG, used in various techniques. Bioz Stars score: 94/100, based on 6 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/Metabion International AG
    Average 94 stars, based on 6 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-04
    94/100 stars
      Buy from Supplier

    Image Search Results