Structured Review

Bangalore Genei dntps
Dntps, supplied by Bangalore Genei, used in various techniques. Bioz Stars score: 99/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntps/product/Bangalore Genei
Average 99 stars, based on 81 article reviews
Price from $9.99 to $1999.99
dntps - by Bioz Stars, 2020-03
99/100 stars

Images

Related Articles

Clone Assay:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Amplicons were fractionated on 3 % agarose gel and desired bands were excised from gel, eluted, cloned in pGMET-Easy vector (Promega) and sequenced using the ABI prism Big Dye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, USA).

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: Total genomic DNA of donor mother plant and the in vitro raised clones of S. calva were extracted from young leaf tissue (2 g) by using the cetyl trimethyl ammonium bromide (CTAB) method as described by Saghai-Maroof et al. ( ). .. Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ).

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. Ltd., Delhi, India) and ligated into a T-cloning vector using the PCR cloning kit (Banglore Genei, India) according to the manufacturer’s instructions.

Amplification:

Article Title: Development of ITS sequence-based markers to distinguish Berberis aristata DC. from B. lycium Royle and B. asiatica Roxb.
Article Snippet: .. Enzymes (Taq Polymerase and RNase A), buffer, MgCl2 and dNTPs for PCR amplification were purchased from Bangalore Genei (Bangalore, India). .. Genomic DNA extraction Stem samples of B. aristata, B. asiatica and B. lycium were cut into small pieces and dried in a dehydrator at 48–50 °C (Hardfacts, Mumbai, India) until a constant dry weight is obtained.

Article Title: Role of angiotensin II type I (AT1 A1166C) receptor polymorphism in susceptibility of left ventricular dysfunction
Article Snippet: .. Genomic DNA was amplified in a DNA thermal cycler (Eppendorf Germany) using a set of outer (Forward outer (GCCAAATCCCACTCAAACCTTTCAACAA)/Reverse outer AAGCAGGCTAGGGAGATTGCATTTCTGT) and a set of inner [Forward inner (A allele) TCTGCAGCACTTCACTACCAAATGAACA/Reverse inner (C allele) TCTCCTTCAATTCTGAAAAGTAGCTGAG] primers described by Shu Ye et al. PCR was conducted in a total volume of 25 μl with 2 pmol of outer primers and 16 pmol of inner primers, genomic DNA (100–150 ng), 10 mM dNTPs, PCR buffer containing final concentrations of 50 mM KCl; 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2 and 1.5 units of Taq DNA polymerase (Bangalore Genei, India). ..

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: .. For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl. .. The mix was subjected to 35 cycles of amplification in thermal cycler after initial denaturation of the template at 94 °C for 3 min. Each cycle consisted of a denaturation phase of 1 min at 94 °C, followed by annealing at 56 °C for 1 min and primer extension at 72 °C for 1.5 min.

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: .. For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

Article Title: Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport
Article Snippet: .. PCR amplification was performed using 50–100 ng of template DNA, 30 ng of primer, 0.1 mM dNTPs, 1.5 U Taq DNA polymerase (Bangalore Genei Pvt. .. Bangalore, India), 1X PCR buffer (10 Mm Tris pH 8.0, 50 mM KCL and 1.8 mM MgCl2) in volume of 25 μl.

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: .. Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ). .. Amplification conditions using ISSR primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 40 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. Amplification of DNA was performed in a 2720 Thermal cycler (Applied Biosystems, USA).

Article Title: Molecular Typing of Canine parvovirus Occurring in Pondicherry by Multiplex PCR and PCR-RFLP
Article Snippet: The processed samples were screened by primer pair CPV-2ab (F) 5 ′ -gaagagtggttgtaaataatt-3 ′ and 2ab (R) 5 ′ -cctatataaccaaagttagtac-3 ′ that amplified a 681 bp fragment of the gene encoding capsid protein VP2 of both CPV-2a and CPV-2b types [ ]. .. The reaction mixture (50 μl) consisted of 5 μl of 10× Taq PCR buffer (containing 15 mM magnesium chloride), 20 pmol each of CPV-2ab (F) and CPV-2ab (R) primers, 10 mM dNTPs each, 1 unit of Taq DNA polymerase (Bangalore Genei) and nuclease free water to make up the volume.

Article Title: Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers
Article Snippet: .. PCR amplification was carried out in 20 μL volumes containing 50 ng of template DNA, 2.5 μL of 10 × PCR buffer, 0.8 μM SCoT primers, 200 mM dNTPs and 1 U Taq DNA polymerase (Bangalore Genei, India). .. DNA amplifications were carried out in a 2720 thermal cycler (Applied Biosystems, USA).

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR was carried out with initial denaturation at 94°C for 1 min, followed by 31 cycles of denaturation at 94°C for 1 min, annealing 55°C for 10 s and extension 72°C for 1 min, and final extension at 72°C for 10 min. After amplification, 5 μl of the reaction mixture was electrophoresed in a 2% agarose gel, stained with ethidium bromide, and visualized by a Gel documentation system (SynGene, Gene Genius Bio Imaging System, UK).

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India). .. The amplifications were carried out in a Perkin Elmer Cetus 2400 thermal cycler using the following programme: 4 min at 95 °C followed by 35 amplification cycles (45 sec at 94 °C, 45 sec at 35 °C, 1 min at 72 °C) and finally 10 min at 72 °C for elongation.

Article Title: Assessment of genetic purity in rice (Oryza sativa L.) hybrids using microsatellite markers
Article Snippet: .. DNA amplification was carried out in a 25 µL reaction mixture containing 1X PCR assay buffer (50 mM KCl, 10 mM Tris–Cl, 1.5 mM MgCl2 ), 200 µM each of dNTPs, 0.2 µM each of forward and reverse primers, 0.6 units of Taq DNA polymerase (Bangalore Genei Pvt. .. Ltd., Bangalore, India) and 25 ng of genomic DNA template.

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: .. Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei). .. PCR products (25 µl) were separated on a 1.8 % agarose gel containing ethidium bromide.

Article Title: Genetic Diversity Studies Based on Morphological Variability, Pathogenicity and Molecular Phylogeny of the Sclerotinia sclerotiorum Population From Indian Mustard (Brassica juncea)
Article Snippet: Sclerotinia -specific primers as described by Freeman et al. ( ) (Table ) were used to carry out PCR amplification in all the isolates. .. The PCR reaction of 15 μL contained 1.5 μL of 10x PCR buffer with 15 mM MgCl2 , 50 μM dNTPs, 10 μM forward and reverse primers, 1 U Taq DNA polymerase (Bangalore Genei, India) and 50 ng of template DNA was performed in a thermal cycler (Biometra, ILS, USA) and the program made with initial denaturation at 95°C for 4 min followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 57°C for 45 s and extension at 72°C for 1 min, and a final extension at 72°C for 10 min.

Article Title: Sequence-based structural analysis and evaluation of polymorphism in buffalo Nod-like receptor-1 gene
Article Snippet: For the characterization of buffalo NOD1 gene, a total of 2865 nucleotides comprising ORF region including 11 exons were amplified, and 15 sets of overlapping primers were designed from gene sequence of cattle sequence available in Ensembl genome browser (ENSBTAT00000061183), for PCR amplification (Table 1-SI in supplementary information). .. PCR was performed on DNA samples of panel representing 12 pooled samples of 3 animals from each breed above, in a total volume of 20 µl containing approximately 80 ng genomic DNA, 10 × PCR buffer having 15 mM MgCl2 , 0.5 µl of 10 mM dNTPs, 10 pmol of each primer and 1 U of Taq DNA polymerase (Bangalore Genei, India).

Synthesized:

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. Sequencing of Bam H1/ Bam H2 primer amplified PCR products were carried out. (a) Two samples were selected from PCR product amplified by primer pair Bam H1/ Bam H2 (b) BigDye® Terminatorv1.1Cycle Sequencing Kit with following components. (i) Ready reaction premix (ii) Big dye sequencing buffer (5×) (iii) pGEM® -3Zf(+) double stranded control DNA template (c) Performance optimized polymer (POP-6TM ) (Part No. 402837 Applied Biosystems, USA) (d) Sequencing primer Bam HI forward (Synthesized by Sigma-Aldrich, USA) (e) Ethanol (f) EDTA 125 mM (g) Sodium acetate (3 M) (h) 70% Ethanol (i) Formamide (Sigma-Aldrich, USA, Catalog No. F-9037).

Article Title: Assessment of genetic purity in rice (Oryza sativa L.) hybrids using microsatellite markers
Article Snippet: PCR amplification Fifty-one STMS primer pairs (custom synthesized oligo nucleotide sequence) were selected for this study. .. DNA amplification was carried out in a 25 µL reaction mixture containing 1X PCR assay buffer (50 mM KCl, 10 mM Tris–Cl, 1.5 mM MgCl2 ), 200 µM each of dNTPs, 0.2 µM each of forward and reverse primers, 0.6 units of Taq DNA polymerase (Bangalore Genei Pvt.

Electrophoresis:

Article Title: Molecular Typing of Canine parvovirus Occurring in Pondicherry by Multiplex PCR and PCR-RFLP
Article Snippet: The reaction mixture (50 μl) consisted of 5 μl of 10× Taq PCR buffer (containing 15 mM magnesium chloride), 20 pmol each of CPV-2ab (F) and CPV-2ab (R) primers, 10 mM dNTPs each, 1 unit of Taq DNA polymerase (Bangalore Genei) and nuclease free water to make up the volume. .. The PCR amplification was carried out in an automated thermal cycler (Eppendorf Master Cycler, Germany) and the products were analyzed by electrophoresis in 1.5% agarose gel.

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India). .. The amplified PCR products were resolved by electrophoresis on 1·5 % agarose (Sigma, USA) gel and TAE buffer.

Random Hexamer Labeling:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: .. For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

Activity Assay:

Article Title: Molecular Typing of Canine parvovirus Occurring in Pondicherry by Multiplex PCR and PCR-RFLP
Article Snippet: The supernatant was diluted (1:5) in distilled water to reduce residual inhibitors of DNA polymerase activity [ ]. .. The reaction mixture (50 μl) consisted of 5 μl of 10× Taq PCR buffer (containing 15 mM magnesium chloride), 20 pmol each of CPV-2ab (F) and CPV-2ab (R) primers, 10 mM dNTPs each, 1 unit of Taq DNA polymerase (Bangalore Genei) and nuclease free water to make up the volume.

Expressing:

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: Paragraph title: mRNA Expression of GFAP, sGC and ASS ... Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei).

Countercurrent Chromatography:

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: .. For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl. .. The mix was subjected to 35 cycles of amplification in thermal cycler after initial denaturation of the template at 94 °C for 3 min. Each cycle consisted of a denaturation phase of 1 min at 94 °C, followed by annealing at 56 °C for 1 min and primer extension at 72 °C for 1.5 min.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: Paragraph title: Multiplex RT-PCR ... For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C).

Imaging:

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR was carried out with initial denaturation at 94°C for 1 min, followed by 31 cycles of denaturation at 94°C for 1 min, annealing 55°C for 10 s and extension 72°C for 1 min, and final extension at 72°C for 10 min. After amplification, 5 μl of the reaction mixture was electrophoresed in a 2% agarose gel, stained with ethidium bromide, and visualized by a Gel documentation system (SynGene, Gene Genius Bio Imaging System, UK).

Sequencing:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Amplicons were fractionated on 3 % agarose gel and desired bands were excised from gel, eluted, cloned in pGMET-Easy vector (Promega) and sequenced using the ABI prism Big Dye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, USA).

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: The primers Bam H1 5′ TAC TTC CTA TAT AGA TTG AGA CGT 3′ and Bam H2 5′ GAG ATC CTC GTA AGG TGT AAT ATA 3′ were selected from the nucleotide sequence flanking 132 bp repeat sequence located within the Bam HI-H fragment published [ ]. .. PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA).

Article Title: Assessment of genetic purity in rice (Oryza sativa L.) hybrids using microsatellite markers
Article Snippet: PCR amplification Fifty-one STMS primer pairs (custom synthesized oligo nucleotide sequence) were selected for this study. .. DNA amplification was carried out in a 25 µL reaction mixture containing 1X PCR assay buffer (50 mM KCl, 10 mM Tris–Cl, 1.5 mM MgCl2 ), 200 µM each of dNTPs, 0.2 µM each of forward and reverse primers, 0.6 units of Taq DNA polymerase (Bangalore Genei Pvt.

Article Title: Sequence-based structural analysis and evaluation of polymorphism in buffalo Nod-like receptor-1 gene
Article Snippet: Paragraph title: Sequencing and SNP detection in buffalo NOD1 gene ... PCR was performed on DNA samples of panel representing 12 pooled samples of 3 animals from each breed above, in a total volume of 20 µl containing approximately 80 ng genomic DNA, 10 × PCR buffer having 15 mM MgCl2 , 0.5 µl of 10 mM dNTPs, 10 pmol of each primer and 1 U of Taq DNA polymerase (Bangalore Genei, India).

Recombinant:

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The recombinant DNA was isolated using HipurA Plasmid mini kit (Himedia, Mumbai, India) and restricted with NcoI enzyme.

Multiplexing:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Multiplex PCR was also carried out with a multiplexing kit (Qiagen, Hilden, Germany) along with Q-solution following the manufacturer’s instructions.

Staining:

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ). .. The amplified DNA fragments were separated on a 1.2 % (w/v) agarose gel using 0.5X TBE buffer and stained with ethidium bromide (0.5 μg/ml).

Article Title: Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers
Article Snippet: PCR amplification was carried out in 20 μL volumes containing 50 ng of template DNA, 2.5 μL of 10 × PCR buffer, 0.8 μM SCoT primers, 200 mM dNTPs and 1 U Taq DNA polymerase (Bangalore Genei, India). .. The amplification products were resolved on 1.2% agarose gels in 0.5 × Tris–borate EDTA buffer (45 mM Tris–borate and 1 mM EDTA) and stained with ethidium bromide (0.5 μg/mL).

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR was carried out with initial denaturation at 94°C for 1 min, followed by 31 cycles of denaturation at 94°C for 1 min, annealing 55°C for 10 s and extension 72°C for 1 min, and final extension at 72°C for 10 min. After amplification, 5 μl of the reaction mixture was electrophoresed in a 2% agarose gel, stained with ethidium bromide, and visualized by a Gel documentation system (SynGene, Gene Genius Bio Imaging System, UK).

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India). .. Gels were visualized by ethidium bromide staining and recorded with a gel doc 1000 camera using the programme Molecular Analyst version 1·5 (Bio Rad, USA).

DNA Extraction:

Article Title: Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport
Article Snippet: Paragraph title: Genomic DNA extraction and PCR amplification ... PCR amplification was performed using 50–100 ng of template DNA, 30 ng of primer, 0.1 mM dNTPs, 1.5 U Taq DNA polymerase (Bangalore Genei Pvt.

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: Paragraph title: DNA isolation and RAPD and ISSR fingerprinting ... Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ).

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: Soil DNA was extracted using the Powersoil™ DNA isolation kit (Mobio Lab. .. The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min.

Nucleic Acid Electrophoresis:

Article Title: Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport
Article Snippet: PCR amplification was performed using 50–100 ng of template DNA, 30 ng of primer, 0.1 mM dNTPs, 1.5 U Taq DNA polymerase (Bangalore Genei Pvt. .. PCR amplified products of all the primers were subjected to gel electrophoresis and were documented using Alpha Imager 1200TM (Alpha Innotech Corporation, USA).

Isolation:

Article Title: Role of angiotensin II type I (AT1 A1166C) receptor polymorphism in susceptibility of left ventricular dysfunction
Article Snippet: Genomic DNA was isolated from peripheral blood leukocytes according to a standard salting out method. .. Genomic DNA was amplified in a DNA thermal cycler (Eppendorf Germany) using a set of outer (Forward outer (GCCAAATCCCACTCAAACCTTTCAACAA)/Reverse outer AAGCAGGCTAGGGAGATTGCATTTCTGT) and a set of inner [Forward inner (A allele) TCTGCAGCACTTCACTACCAAATGAACA/Reverse inner (C allele) TCTCCTTCAATTCTGAAAAGTAGCTGAG] primers described by Shu Ye et al. PCR was conducted in a total volume of 25 μl with 2 pmol of outer primers and 16 pmol of inner primers, genomic DNA (100–150 ng), 10 mM dNTPs, PCR buffer containing final concentrations of 50 mM KCl; 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2 and 1.5 units of Taq DNA polymerase (Bangalore Genei, India).

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The recombinant DNA was isolated using HipurA Plasmid mini kit (Himedia, Mumbai, India) and restricted with NcoI enzyme.

Marker:

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: The polymerase chain reaction was performed with the genomic DNA of the T1 generation plants to determine the presence of the FMDV bivalent gene (1.3 kb) (ID of “O” and “A22 ”) and also the marker gene nptII, (700 bp). .. For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl.

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: Paragraph title: RAPD analysis and marker selection ... The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India).

Negative Control:

Article Title: Role of angiotensin II type I (AT1 A1166C) receptor polymorphism in susceptibility of left ventricular dysfunction
Article Snippet: As a negative control, PCR mix without DNA sample was used to ensure contamination free PCR product. .. Genomic DNA was amplified in a DNA thermal cycler (Eppendorf Germany) using a set of outer (Forward outer (GCCAAATCCCACTCAAACCTTTCAACAA)/Reverse outer AAGCAGGCTAGGGAGATTGCATTTCTGT) and a set of inner [Forward inner (A allele) TCTGCAGCACTTCACTACCAAATGAACA/Reverse inner (C allele) TCTCCTTCAATTCTGAAAAGTAGCTGAG] primers described by Shu Ye et al. PCR was conducted in a total volume of 25 μl with 2 pmol of outer primers and 16 pmol of inner primers, genomic DNA (100–150 ng), 10 mM dNTPs, PCR buffer containing final concentrations of 50 mM KCl; 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2 and 1.5 units of Taq DNA polymerase (Bangalore Genei, India).

Hot Start PCR:

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl. .. The presence of the marker gene nptII (700 bp) was detected by, hot start PCR with initial denaturation at 94 °C for 4 min followed by 35 cycles of 1 min at 94 °C, annealing for 1 min at 58 °C, primer extension [nptII (L): 5′ GAG GCT ATT CGG CTA TGA CTG 3′ nptII (R): 5′ ATC GGG AGG GGC GAT ACC GTA 3′ at 72 °C] for 1 min, followed by final extension phase at 72 °C for 10 min as described before.

Polymerase Chain Reaction:

Article Title: Development of ITS sequence-based markers to distinguish Berberis aristata DC. from B. lycium Royle and B. asiatica Roxb.
Article Snippet: .. Enzymes (Taq Polymerase and RNase A), buffer, MgCl2 and dNTPs for PCR amplification were purchased from Bangalore Genei (Bangalore, India). .. Genomic DNA extraction Stem samples of B. aristata, B. asiatica and B. lycium were cut into small pieces and dried in a dehydrator at 48–50 °C (Hardfacts, Mumbai, India) until a constant dry weight is obtained.

Article Title: Role of angiotensin II type I (AT1 A1166C) receptor polymorphism in susceptibility of left ventricular dysfunction
Article Snippet: .. Genomic DNA was amplified in a DNA thermal cycler (Eppendorf Germany) using a set of outer (Forward outer (GCCAAATCCCACTCAAACCTTTCAACAA)/Reverse outer AAGCAGGCTAGGGAGATTGCATTTCTGT) and a set of inner [Forward inner (A allele) TCTGCAGCACTTCACTACCAAATGAACA/Reverse inner (C allele) TCTCCTTCAATTCTGAAAAGTAGCTGAG] primers described by Shu Ye et al. PCR was conducted in a total volume of 25 μl with 2 pmol of outer primers and 16 pmol of inner primers, genomic DNA (100–150 ng), 10 mM dNTPs, PCR buffer containing final concentrations of 50 mM KCl; 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2 and 1.5 units of Taq DNA polymerase (Bangalore Genei, India). ..

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: Paragraph title: Genomic DNA PCR analysis ... For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl.

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: .. For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

Article Title: Molecular characterization of EcCIPK24 gene of finger millet (Eleusine coracana) for investigating its regulatory role in calcium transport
Article Snippet: .. PCR amplification was performed using 50–100 ng of template DNA, 30 ng of primer, 0.1 mM dNTPs, 1.5 U Taq DNA polymerase (Bangalore Genei Pvt. .. Bangalore, India), 1X PCR buffer (10 Mm Tris pH 8.0, 50 mM KCL and 1.8 mM MgCl2) in volume of 25 μl.

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: .. Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ). .. Amplification conditions using ISSR primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 40 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. Amplification of DNA was performed in a 2720 Thermal cycler (Applied Biosystems, USA).

Article Title: Molecular Typing of Canine parvovirus Occurring in Pondicherry by Multiplex PCR and PCR-RFLP
Article Snippet: .. The reaction mixture (50 μl) consisted of 5 μl of 10× Taq PCR buffer (containing 15 mM magnesium chloride), 20 pmol each of CPV-2ab (F) and CPV-2ab (R) primers, 10 mM dNTPs each, 1 unit of Taq DNA polymerase (Bangalore Genei) and nuclease free water to make up the volume. ..

Article Title: Genetic diversity analysis among male and female Jojoba genotypes employing gene targeted molecular markers, start codon targeted (SCoT) polymorphism and CAAT box-derived polymorphism (CBDP) markers
Article Snippet: .. PCR amplification was carried out in 20 μL volumes containing 50 ng of template DNA, 2.5 μL of 10 × PCR buffer, 0.8 μM SCoT primers, 200 mM dNTPs and 1 U Taq DNA polymerase (Bangalore Genei, India). .. DNA amplifications were carried out in a 2720 thermal cycler (Applied Biosystems, USA).

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: .. PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR tubes with all the components were transferred to thermal cycler (Eppendorf Master Cycler, Germany).

Article Title: Assessment of genetic purity in rice (Oryza sativa L.) hybrids using microsatellite markers
Article Snippet: .. DNA amplification was carried out in a 25 µL reaction mixture containing 1X PCR assay buffer (50 mM KCl, 10 mM Tris–Cl, 1.5 mM MgCl2 ), 200 µM each of dNTPs, 0.2 µM each of forward and reverse primers, 0.6 units of Taq DNA polymerase (Bangalore Genei Pvt. .. Ltd., Bangalore, India) and 25 ng of genomic DNA template.

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: .. The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The nifH amplicons were gel purified and band extracted as per the manufacturer’s instruction (AuPreP gel extraction kit, Life Technology India Pvt.

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: The PCR conditions for the housekeeping gene, glyceraldehydes 3-phosphate dehydrogenase (GAPDH) were 24 thermal cycles at 95 °C for 50, 56 °C for 50, and 73 °C for 70 s respectively and pursued by a final extension for 8 min at 73 °C. .. Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei).

Article Title: Genetic Diversity Studies Based on Morphological Variability, Pathogenicity and Molecular Phylogeny of the Sclerotinia sclerotiorum Population From Indian Mustard (Brassica juncea)
Article Snippet: .. The PCR reaction of 15 μL contained 1.5 μL of 10x PCR buffer with 15 mM MgCl2 , 50 μM dNTPs, 10 μM forward and reverse primers, 1 U Taq DNA polymerase (Bangalore Genei, India) and 50 ng of template DNA was performed in a thermal cycler (Biometra, ILS, USA) and the program made with initial denaturation at 95°C for 4 min followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 57°C for 45 s and extension at 72°C for 1 min, and a final extension at 72°C for 10 min. .. The PCR amplicons were resolved on 1% agarose gel along with 1 kb standard DNA ladder and visualized in a UV transilluminator.

Article Title: Sequence-based structural analysis and evaluation of polymorphism in buffalo Nod-like receptor-1 gene
Article Snippet: .. PCR was performed on DNA samples of panel representing 12 pooled samples of 3 animals from each breed above, in a total volume of 20 µl containing approximately 80 ng genomic DNA, 10 × PCR buffer having 15 mM MgCl2 , 0.5 µl of 10 mM dNTPs, 10 pmol of each primer and 1 U of Taq DNA polymerase (Bangalore Genei, India). .. Following the initial denaturation step (95 °C for 3 min), samples were subjected to 32 cycles of PCR consisting of 94 °C for 30 s, primer-specific annealing temperature for 30 s (Table 1-SI in supplementary information); and 72 °C for 1 min, followed by a final extension for 10 min at 72 °C.

Salting Out:

Article Title: Role of angiotensin II type I (AT1 A1166C) receptor polymorphism in susceptibility of left ventricular dysfunction
Article Snippet: Genomic DNA was isolated from peripheral blood leukocytes according to a standard salting out method. .. Genomic DNA was amplified in a DNA thermal cycler (Eppendorf Germany) using a set of outer (Forward outer (GCCAAATCCCACTCAAACCTTTCAACAA)/Reverse outer AAGCAGGCTAGGGAGATTGCATTTCTGT) and a set of inner [Forward inner (A allele) TCTGCAGCACTTCACTACCAAATGAACA/Reverse inner (C allele) TCTCCTTCAATTCTGAAAAGTAGCTGAG] primers described by Shu Ye et al. PCR was conducted in a total volume of 25 μl with 2 pmol of outer primers and 16 pmol of inner primers, genomic DNA (100–150 ng), 10 mM dNTPs, PCR buffer containing final concentrations of 50 mM KCl; 10 mM Tris–HCl (pH 8.3); 1.5 mM MgCl2 and 1.5 units of Taq DNA polymerase (Bangalore Genei, India).

Purification:

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: .. For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl. .. The mix was subjected to 35 cycles of amplification in thermal cycler after initial denaturation of the template at 94 °C for 3 min. Each cycle consisted of a denaturation phase of 1 min at 94 °C, followed by annealing at 56 °C for 1 min and primer extension at 72 °C for 1.5 min.

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The nifH amplicons were gel purified and band extracted as per the manufacturer’s instruction (AuPreP gel extraction kit, Life Technology India Pvt.

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: Total RNA was separated and purified from the brain tissues using TRIzol reagent (Invitrogen, Carlsbad, CA, USA). .. Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei).

Article Title: Sequence-based structural analysis and evaluation of polymorphism in buffalo Nod-like receptor-1 gene
Article Snippet: PCR was performed on DNA samples of panel representing 12 pooled samples of 3 animals from each breed above, in a total volume of 20 µl containing approximately 80 ng genomic DNA, 10 × PCR buffer having 15 mM MgCl2 , 0.5 µl of 10 mM dNTPs, 10 pmol of each primer and 1 U of Taq DNA polymerase (Bangalore Genei, India). .. Amplified products were checked on 1.5% agarose gel and sequenced from both ends after column purification.

Plasmid Preparation:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Amplicons were fractionated on 3 % agarose gel and desired bands were excised from gel, eluted, cloned in pGMET-Easy vector (Promega) and sequenced using the ABI prism Big Dye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, USA).

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. Ltd., Delhi, India) and ligated into a T-cloning vector using the PCR cloning kit (Banglore Genei, India) according to the manufacturer’s instructions.

Software:

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei). .. Intensities of the bands were quantified using Gel Doc system (Bio-Rad, Hercules, CA, USA) and Quantity on 1-D analysis software (Bio-Rad).

Multiplex Assay:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: .. For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

Selection:

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: Paragraph title: RAPD analysis and marker selection ... The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India).

Agarose Gel Electrophoresis:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Amplicons were fractionated on 3 % agarose gel and desired bands were excised from gel, eluted, cloned in pGMET-Easy vector (Promega) and sequenced using the ABI prism Big Dye™ Terminator v3.0 Ready Reaction Cycle Sequencing Kit (Applied Biosystems, USA).

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ). .. The amplified DNA fragments were separated on a 1.2 % (w/v) agarose gel using 0.5X TBE buffer and stained with ethidium bromide (0.5 μg/ml).

Article Title: Molecular Typing of Canine parvovirus Occurring in Pondicherry by Multiplex PCR and PCR-RFLP
Article Snippet: The reaction mixture (50 μl) consisted of 5 μl of 10× Taq PCR buffer (containing 15 mM magnesium chloride), 20 pmol each of CPV-2ab (F) and CPV-2ab (R) primers, 10 mM dNTPs each, 1 unit of Taq DNA polymerase (Bangalore Genei) and nuclease free water to make up the volume. .. The PCR amplification was carried out in an automated thermal cycler (Eppendorf Master Cycler, Germany) and the products were analyzed by electrophoresis in 1.5% agarose gel.

Article Title: Characterization of 132 bp Repeats BamH1-H Region in Pathogenic Marek's Disease Virus of Poultry in Gujarat, India, Using PCR and Sequencing
Article Snippet: PCR was carried out in a final reaction volume of 25 μl using 200 μl capacity thin wall PCR tube containing 3 μl template DNA, 10 × PCR buffer (Sigma-Aldrich, USA), 25 mM MgCl2 , 200 μM of the four dNTPs, 10 pmol of each primer (Bangalore Genei, India), and 1U Taq DNA polymerase (Sigma-Aldrich, USA). .. The PCR was carried out with initial denaturation at 94°C for 1 min, followed by 31 cycles of denaturation at 94°C for 1 min, annealing 55°C for 10 s and extension 72°C for 1 min, and final extension at 72°C for 10 min. After amplification, 5 μl of the reaction mixture was electrophoresed in a 2% agarose gel, stained with ethidium bromide, and visualized by a Gel documentation system (SynGene, Gene Genius Bio Imaging System, UK).

Article Title: Genetic Diversity Studies Based on Morphological Variability, Pathogenicity and Molecular Phylogeny of the Sclerotinia sclerotiorum Population From Indian Mustard (Brassica juncea)
Article Snippet: The PCR reaction of 15 μL contained 1.5 μL of 10x PCR buffer with 15 mM MgCl2 , 50 μM dNTPs, 10 μM forward and reverse primers, 1 U Taq DNA polymerase (Bangalore Genei, India) and 50 ng of template DNA was performed in a thermal cycler (Biometra, ILS, USA) and the program made with initial denaturation at 95°C for 4 min followed by 35 cycles of denaturation at 94°C for 45 s, annealing at 57°C for 45 s and extension at 72°C for 1 min, and a final extension at 72°C for 10 min. .. The PCR amplicons were resolved on 1% agarose gel along with 1 kb standard DNA ladder and visualized in a UV transilluminator.

Article Title: Sequence-based structural analysis and evaluation of polymorphism in buffalo Nod-like receptor-1 gene
Article Snippet: PCR was performed on DNA samples of panel representing 12 pooled samples of 3 animals from each breed above, in a total volume of 20 µl containing approximately 80 ng genomic DNA, 10 × PCR buffer having 15 mM MgCl2 , 0.5 µl of 10 mM dNTPs, 10 pmol of each primer and 1 U of Taq DNA polymerase (Bangalore Genei, India). .. Amplified products were checked on 1.5% agarose gel and sequenced from both ends after column purification.

In Vitro:

Article Title: In vitro clonal propagation and genetic fidelity of the regenerants of Spilanthes calva DC. using RAPD and ISSR marker
Article Snippet: Total genomic DNA of donor mother plant and the in vitro raised clones of S. calva were extracted from young leaf tissue (2 g) by using the cetyl trimethyl ammonium bromide (CTAB) method as described by Saghai-Maroof et al. ( ). .. Amplification conditions using RAPD primers were performed as initial DNA denaturation at 94 °C for 4 min, followed by 45 cycles of 1 min denaturation at 94 °C, 1 min annealing at 36 °C and 2 min of extension at 72 °C with a final extension at 72 °C for 7 min. ISSR amplifications were performed in a total volume of 25 μl containing 20 ng of genomic DNA, 2.5 μl of 10X PCR buffer containing 15 mM MgCl2 , 0.2 mM dNTPs, 1 unit Taq polymerase (Bangalore Genei, India) and 20 ng ISSR primer ( Sigma Aldrich, USA ).

Size-exclusion Chromatography:

Article Title: Generation and Characterization of SCARs by Cloning and Sequencing of RAPD Products: A Strategy for Species-specific Marker Development in Bamboo
Article Snippet: The PCR amplifications were carried out in a 50 μL reaction mixture containing 100 ng of genomic DNA, 100 ng of RAPD primer, 1× PCR buffer containing 1·5 m m MgCl2 , 250 μ m of each dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei, India). .. The amplifications were carried out in a Perkin Elmer Cetus 2400 thermal cycler using the following programme: 4 min at 95 °C followed by 35 amplification cycles (45 sec at 94 °C, 45 sec at 35 °C, 1 min at 72 °C) and finally 10 min at 72 °C for elongation.

Spectrophotometry:

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: Inc., Carlsbad, CA, USA) as described by the manufacturer and quantified by ultraviolet (UV) spectrophotometry at 260 nm. .. The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min.

Produced:

Article Title: Role of Bioflavonoid Quercetin on Expression of Urea Cycle Enzymes, Astrocytic and Inflammatory Markers in Hyperammonemic Rats
Article Snippet: The cDNA was produced from 3 µg of total RNA treated with DNAse by reverse transcription according to the kit instructions. .. Amplification reactions were accomplished in a 250 µM of dNTPs, 3.5 U of Taq DNA polymerase, in a volume of 50 µl containing 5 µl of cDNA and 150 pmol of primer (Bangalore Genei).

Concentration Assay:

Article Title: Simultaneous Detection of Major Pome Fruit Viruses and a Viroid
Article Snippet: .. For RT, all conditions were the same except random hexamer primers 100 ng were used for cDNA synthesis and for multiplex PCR reaction 5 μl cDNA, 0.16 pmol of each primers pair, 1.2× Taq buffer, 0.3 mM dNTPs, 1.5 units of Taq DNA polymerase (Bangalore Genei) and 1.5 mM MgCl2 (additional) in final concentration was used. cDNA was amplified for 35 cycles (40 s at 94 °C, 75 s at 58 °C, and 90 s at 72 °C). .. Same reaction composition was carried out with Hot Start Taq DNA polymerase (Fermentas, Vilnius, Lithuania).

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: .. The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The nifH amplicons were gel purified and band extracted as per the manufacturer’s instruction (AuPreP gel extraction kit, Life Technology India Pvt.

CTG Assay:

Article Title: Tissue culture independent transformation of the forage crop sunnhemp (Crotalaria juncea L.): an easy method towards generation of transgenics
Article Snippet: For amplification of the FMDV gene, the reaction mix consisted of 10 ng (2 ul) of the purified genomic DNA, 20 pm of each insert specific primer VP1 (O)Kp.Sp.Ml(L) 5′ GCG GGT ACC GCA TGC GGA CGC GTG TAT GAC CAC CTC CCC GGG TGA G 3′, and VP1(A22) EcoRI (R): 5′ GCG AAT TCG CCG GGG TTC AAA AAC TTG CTT CTC AGG 3′ 25 mM Tris HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl2 , 100 μM each of the four dNTPs and 1 unit of Taq DNA polymerase (Bangalore Genei) in a total volume of 50 μl. .. The presence of the marker gene nptII (700 bp) was detected by, hot start PCR with initial denaturation at 94 °C for 4 min followed by 35 cycles of 1 min at 94 °C, annealing for 1 min at 58 °C, primer extension [nptII (L): 5′ GAG GCT ATT CGG CTA TGA CTG 3′ nptII (R): 5′ ATC GGG AGG GGC GAT ACC GTA 3′ at 72 °C] for 1 min, followed by final extension phase at 72 °C for 10 min as described before.

Gel Extraction:

Article Title: Exploration of nifH gene through soil metagenomes of the western Indian Himalayas
Article Snippet: The polymerase chain reaction (PCR) procedure was performed in 50 μl volumes containing 1X assay buffer with 5 mM MgCl2 (New England Biolabs Inc., Ipwich, MA, UK), 100 pmol of nif H, gene-specific universal primers (PolF—TGC GAY CCS AAR GCB GAC TC and PolR—ATS GCC ATC ATY TCR CCG GA) originally designed by Poly et al. , 250 μMol of dNTPs, 1.25 U of Hot start Taq polymerase (Bangalore Genei, India), and a template DNA concentration of 50–100 ng in a pTC-150 mini-cycler PCR machine (MJ-Research, USA which is now merged in Bio-Rad) for 30 cycles (94 °C for 1 min, 55 °C for 1 min, 72 °C extension for 2 min, followed by a final extension step of 72 °C for 15 min) after initial denaturation at 95 °C for 3 min. .. The nifH amplicons were gel purified and band extracted as per the manufacturer’s instruction (AuPreP gel extraction kit, Life Technology India Pvt.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Bangalore Genei dntp
    Dntp, supplied by Bangalore Genei, used in various techniques. Bioz Stars score: 95/100, based on 34 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Bangalore Genei
    Average 95 stars, based on 34 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-03
    95/100 stars
      Buy from Supplier

    Image Search Results