Structured Review

5 PRIME dntps
Dntps, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 96/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntps/product/5 PRIME
Average 96 stars, based on 41 article reviews
Price from $9.99 to $1999.99
dntps - by Bioz Stars, 2020-03
96/100 stars

Images

Related Articles

Clone Assay:

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: Paragraph title: PCR, cloning and sequencing ... COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer.

Article Title: Analysis of the TCP genes expressed in the inflorescence of the orchid Orchis italica
Article Snippet: The reaction mixture contained 200 μM dNTPs, 0.4 μM of each primer, buffer 1X and 2.5 U HotMaster Taq polymerase (5Prime). .. The amplification product was cloned into the pGEM-T Easy vector (Promega), and the positive clones were sequenced using the plasmid primers T7 and SP6 and analyzed on an ABI 310 Automated Sequencer (Applied Biosystems).

Amplification:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: Paragraph title: 16S ribosomal amplicon pyrosequencing ... Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Article Title: Invaders, natives and their enemies: distribution patterns of amphipods and their microsporidian parasites in the Ruhr Metropolis, Germany
Article Snippet: PCR and sequencing For amphipods, the standard animal barcoding locus CO1 was amplified using the degenerated primer pair LCO1490-JJ (5′-CHACWAAYCATAAAGATATYGG-3′) and HCO2198-JJ (5′-AWACTTCVGGRTGVCCAAARAATCA-3′) of Astrin & Stüben [ ]. .. Each PCR reaction mix (total volume of 12.5 μL) contained 1 μL template DNA, 0.2 mM dNTPs, 1x PCR buffer, 0.5 μM of each primer, 0.025 U/μL Hotmaster Taq -polymerase (5 PRIME GmbH) and made up to a final volume of 12.5 μL with PCR grade water.

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: Paragraph title: Amplification and Pyrosequencing of DNA from Maize Roots ... For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template.

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O. ..

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: A 16S rDNA gene fragment corresponding to V1 and V2 regions was amplified . .. PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA.

Article Title: Induction of Terpene Biosynthesis in Berries of Microvine Transformed with VvDXS1 Alleles
Article Snippet: .. Allele discrimination by VvDXS1 amplicon digestion and sequencing The PCR was performed in a 20 μl reaction volume containing 100 ng of leaf DNA, 0.25 mM dNTPs, 0.3 μM of each primer (Fw: ATTGCTGTCATAGGTGATGGAG; Rv: CTGTTGTCTTGGTACTCTTAAC), 1X Taq Buffer Advanced (5 Prime, Hilden, Germany) and 1 unit of 5 Prime Taq DNA Polymerase (5 Prime, Hilden, Germany). .. The obtained amplicon (423 bp) was digested with the FastDigest StyI restriction enzyme (Thermo Fischer Scientific, Waltham, MA, USA) to detect SNP1822 G/T (StyI recognizes the restriction site when G is present) or sequenced with the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

Article Title: Ectoparasite communities of small-bodied Malagasy primates: seasonal and socioecological influences on tick, mite and lice infestation of Microcebus murinus and M. ravelobensis in northwestern Madagascar
Article Snippet: .. For selected tick specimens, a 760 bp fragment of the cytochrome c oxidase subunit 1 gene ( cox 1) was amplified using primers Cox1F und Cox1R [ ] in a 25 μl reaction mixture containing 18.5 μl double-distilled water, 0.5 μl dNTPs (10 mM each), 1 μl for/rev primer (10 μM each), 2.5 μl 10× buffer, 0.5 μl Taq polymerase (5 Prime, Hilden, Germany) and 1 μl DNA template. .. Thermocycling conditions were as follows: 95 °C for 5 min followed by 40 cycles at 95 °C for 30 s, 55 °C for 1 min and 72 °C for 1 min, and final extension at 72 °C for 5 min. For a tick specimen a 240 bp fragment, and for lice specimens a 209 bp fragment of the 18S rRNA gene was amplified using primers Ns1 and Ns2a [ ] in a reaction setup corresponding to the recipe used for tick specimens.

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: Primer sequences, annealing temperature, and amplification product sizes are shown in . .. PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer.

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: PCRs were performed in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.2 μM of each primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc., Gaithersburg, Maryland, USA) under the following conditions: 94°C for 2 min, then 35 cycles of 94°C for 20 s, 55°C for 30 s, and 65°C for 30 s. Primer pairs that successfully amplified a microsatellite region, as determined by the presence of one or two distinct bands on a 1% agarose gel stained with ethidium bromide, were then used for three-primer PCR. .. These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.).

Article Title: Ectoparasite communities of small-bodied Malagasy primates: seasonal and socioecological influences on tick, mite and lice infestation of Microcebus murinus and M. ravelobensis in northwestern Madagascar
Article Snippet: .. For selected tick specimens, a 760 bp fragment of the cytochrome c oxidase subunit 1 gene (cox 1) was amplified using primers Cox1F und Cox1R [ ] in a 25 μl reaction mixture containing 18.5 μl double-distilled water, 0.5 μl dNTPs (10 mM each), 1 μl for/rev primer (10 μM each), 2.5 μl 10× buffer, 0.5 μl Taq polymerase (5 Prime, Hilden, Germany) and 1 μl DNA template. .. Thermocycling conditions were as follows: 95 °C for 5 min followed by 40 cycles at 95 °C for 30 s, 55 °C for 1 min and 72 °C for 1 min, and final extension at 72 °C for 5 min. For a tick specimen a 240 bp fragment, and for lice specimens a 209 bp fragment of the 18S rRNA gene was amplified using primers Ns1 and Ns2a [ ] in a reaction setup corresponding to the recipe used for tick specimens.

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Paragraph title: NJAY phytoplasma EcDNA amplification and sequence analysis ... Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany).

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: .. COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer. .. The PCR reaction comprised an initial denaturation at 94 °C for 4 mins, followed by 35 cycles at 94 °C for 40 s, 50 °C (COI) or 42 °C (COIII) respectively for 40 s, 68 °C for 90 s and a final extension step at 68 °C for 10 min.

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: Primer pairs ( ) flanking the microsatellite motif, were designed by Primer3 software ( http://frodo.wi.mit.edu/primer3/ ) and further used for specific amplification. .. The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase.

Article Title: Analysis of the TCP genes expressed in the inflorescence of the orchid Orchis italica
Article Snippet: PCR amplification was conducted on 100 ng of genomic DNA of O. italica in a final volume of 50 μl. .. The reaction mixture contained 200 μM dNTPs, 0.4 μM of each primer, buffer 1X and 2.5 U HotMaster Taq polymerase (5Prime).

Construct:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: To pool all 93 samples in a single run, 93 different forward primers were constructed, each containing a different 10 bp long Multiplex Identifier (Roche) between the adaptor sequence and the template specific sequence. .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. .. The reaction cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s denaturation at 94°C, 30 s annealing at varying temperatures (see for specific annealing temperatures), and 30 s extension at 68°C, with a final extension at 68°C for 5 min. Allele-specific primers were constructed by introducing a one-base mismatch sequence before the SNP site.

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: To construct a species phylogeny for the sampled octopods, we amplified partial sequences of cytochrome c oxidase subunit I (COI) and cytochrome c oxidase subunit III (COIII), which are considered selectively neutral, using polymerase chain reaction (PCR) and the primers detailed in [ – ]. .. COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer.

Electrophoresis:

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template. .. After quantification by Nanodrop ND1000 and visualization of the DNA by agarose electrophoresis, the samples were combined in equimolar amounts and pyrosequenced in a Roche Genome Sequencer FLX system using 454 Titanium chemistry at LifeSequencing S.L. (Valencia, Spain).

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA. .. Amplification was checked by electrophoresis in 2% agarose gels stained with SYBR® Safe DNA Gel Stain (Invitrogen™, Carlsbad, USA) and bands were visualized using UV light in a Gel Doc™ EZ Imager (BIO-RAD, Hercules, USA).

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. .. After agarose-gel electrophoresis, the PCR product was visualized with ethidium bromide, photographed, and genotyped.

Incubation:

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: The reaction was incubated for 25 min at 37 °C followed by an inactivation step at 85 °C for 15 min. Purified PCR products were bidirectionally sequenced by GATC-Biotech (Konstanz, Germany). .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O.

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany). .. The reactions included an initial denaturation cycle at 94°C for 2 min, then 30 cycles of 94°C for 20 sec, 53°C for 20 sec and 72°C for 3 min. At the end, the reaction mixtures were incubated at 72°C for 10 min and then stored at 4°C.

In Silico:

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: Initially a set of SSR motifs were discovered in silico in the genomic contigs of each PPO , using Sputnik software ( http://espressosoftware.com/sputnik/index.html ). .. The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase.

Touchdown PCR:

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer. .. Template specificity was enhanced via Touchdown-PCR in 25 μl reaction volume containing final concentrations of 0.2 μmol L−1 dNTPs, 0.05 units μl−1 DreamTaq DNA Polymerase (Thermo Scientific, Germany), 1 x DreamTaq Green buffer (Thermo Scientific, Germany) and 1 μmol L−1 of each primer.

Serial Dilution:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: 16S ribosomal amplicon pyrosequencing Based on ARISA results, samples were selected for pyrosequencing of the bacterial 16S rDNA (pH in situ and 7.67 of all ‘no dilution’ and ‘serial dilution’ treatments and of the ‘initial dilution’ in summer; additionally starting communities). .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Generated:

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: .. For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template. .. The PCR program consisted of an initial denaturation step at 94°C for 4 min, 25 cycles of denaturation at 94°C for 15 s, primer annealing at 55°C for 45 s and extension at 72°C for 1 min, followed by a final step of heating at 72°C for 10 min. Amplicons of the same treatment were pooled to reduce per-PCR variability and purified using the ultracentrifugal filters Ultracel-100 K membranes (Amicon) according to the manufacturer’s instructions.

DNA Sequencing:

Article Title: Applications of DNA barcoding to fish landings: authentication and diversity assessment
Article Snippet: Amplification reactions were performed in a total volume of 23 µl, including 5 PRIME Buffer 1 × (Gaithersburg, MD, USA), 1.5 mM MgCl2 , 0.25 mM dNTPs, 1 µM of each primer, 20 ng of template DNA, and 1.5U of DNA Taq polymerase (5 PRIME). .. The PCR conditions were the following: 12S rDNA: an initial denaturation at 95 °C for 10 min, then 35 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min and extension at 72 °C for 1.5 min, followed by a final extension at 72 °C for 7 min. COI: an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 64–54 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. cyt b : an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 60–50 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. D-Loop: an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. Sequencing was carried out by the DNA sequencing service GATC Biotech (Germany).

Polymerase Chain Reaction:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime). .. The duplicate reactions were combined and purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA, USA).

Article Title: Invaders, natives and their enemies: distribution patterns of amphipods and their microsporidian parasites in the Ruhr Metropolis, Germany
Article Snippet: .. Each PCR reaction mix (total volume of 12.5 μL) contained 1 μL template DNA, 0.2 mM dNTPs, 1x PCR buffer, 0.5 μM of each primer, 0.025 U/μL Hotmaster Taq -polymerase (5 PRIME GmbH) and made up to a final volume of 12.5 μL with PCR grade water. .. PCR cycle conditions were as follows: initial denaturation for 2 min at 94 °C, followed by 36 cycles of 40 s at 94 °C (denaturation), 40 s at 52.5 °C (annealing) and 2 min at 65 °C (elongation), and a final elongation step for 8 min at 65 °C.

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: Amplification and Pyrosequencing of DNA from Maize Roots Polymerase chain reaction (PCR) amplification of the hypervariable V4–V5 regions of the 16S rRNA gene was performed over each individual DNA extraction from soils using universal primers U519F and U926R ( ) joined to a multiplex identifier sequence ( ; ). .. For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template.

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O. ..

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: .. PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA. .. Fragments were amplified under the following conditions: initial denaturation at 94 °C for 3 minutes, followed by 30 cycles with denaturation at 94 °C for 40 seconds, annealing at 52 °C for 40 seconds and extension at 68 °C for 35 seconds, with a final extension at 68 °C for 7 minutes.

Article Title: Induction of Terpene Biosynthesis in Berries of Microvine Transformed with VvDXS1 Alleles
Article Snippet: .. Allele discrimination by VvDXS1 amplicon digestion and sequencing The PCR was performed in a 20 μl reaction volume containing 100 ng of leaf DNA, 0.25 mM dNTPs, 0.3 μM of each primer (Fw: ATTGCTGTCATAGGTGATGGAG; Rv: CTGTTGTCTTGGTACTCTTAAC), 1X Taq Buffer Advanced (5 Prime, Hilden, Germany) and 1 unit of 5 Prime Taq DNA Polymerase (5 Prime, Hilden, Germany). .. The obtained amplicon (423 bp) was digested with the FastDigest StyI restriction enzyme (Thermo Fischer Scientific, Waltham, MA, USA) to detect SNP1822 G/T (StyI recognizes the restriction site when G is present) or sequenced with the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: .. PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. .. The reaction cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s denaturation at 94°C, 30 s annealing at varying temperatures (see for specific annealing temperatures), and 30 s extension at 68°C, with a final extension at 68°C for 5 min. Allele-specific primers were constructed by introducing a one-base mismatch sequence before the SNP site.

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: PCRs were performed in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.2 μM of each primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc., Gaithersburg, Maryland, USA) under the following conditions: 94°C for 2 min, then 35 cycles of 94°C for 20 s, 55°C for 30 s, and 65°C for 30 s. Primer pairs that successfully amplified a microsatellite region, as determined by the presence of one or two distinct bands on a 1% agarose gel stained with ethidium bromide, were then used for three-primer PCR. .. These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.).

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: .. Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany). .. PCR was carried out with an automated thermal cycler (T-Professional Basic, Biometra, Germany).

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: .. COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer. .. The PCR reaction comprised an initial denaturation at 94 °C for 4 mins, followed by 35 cycles at 94 °C for 40 s, 50 °C (COI) or 42 °C (COIII) respectively for 40 s, 68 °C for 90 s and a final extension step at 68 °C for 10 min.

Article Title: Applications of DNA barcoding to fish landings: authentication and diversity assessment
Article Snippet: Fragments of four different mitochondrial genes were amplified by polymerase chain reaction (PCR): 12S rDNA, COI, cyt b and D-Loop ( ). .. Amplification reactions were performed in a total volume of 23 µl, including 5 PRIME Buffer 1 × (Gaithersburg, MD, USA), 1.5 mM MgCl2 , 0.25 mM dNTPs, 1 µM of each primer, 20 ng of template DNA, and 1.5U of DNA Taq polymerase (5 PRIME).

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: .. The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase. .. Temperature conditions were: initial denaturation at 94 °C for 150 s followed by 32 cycles at 94°C for 30 s, 58°C for 45 s, 72°C for 60 s, and a final extension at 72 °C for 5 min. Fragment analysis was performed by an ABI PRISM® 3730 capillary sequencer (Applied Biosystems by Life Technologies, Carlsbad, CA, USA) in a final volume of 0.3 µL of PCR product, 9.67 µL formamide and 0.03 µL of 500-LIZ denaturated for 3 min at 95 °C.

Article Title: Analysis of the TCP genes expressed in the inflorescence of the orchid Orchis italica
Article Snippet: PCR amplification was conducted on 100 ng of genomic DNA of O. italica in a final volume of 50 μl. .. The reaction mixture contained 200 μM dNTPs, 0.4 μM of each primer, buffer 1X and 2.5 U HotMaster Taq polymerase (5Prime).

DNA Extraction:

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: Amplification and Pyrosequencing of DNA from Maize Roots Polymerase chain reaction (PCR) amplification of the hypervariable V4–V5 regions of the 16S rRNA gene was performed over each individual DNA extraction from soils using universal primers U519F and U926R ( ) joined to a multiplex identifier sequence ( ; ). .. For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template.

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: Soil bacterial community composition: 16S rDNA pyrosequencing DNA was extracted from 0.25 g of homogenised soil of each of the 24 samples using the PowerSoil® DNA Isolation Kit (MO BIO Laboratories, Inc., Carlsbad, USA) following manufacturer’s directions. .. PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA.

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: DNA Analysis DNA extraction was carried out on total blood using Archive Pure DNA Blood Kit (5-PRIME, Hamburg, Germany) according to the manufacturer's recommended protocol. .. PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer.

Isolation:

Article Title: Analysis of the TCP genes expressed in the inflorescence of the orchid Orchis italica
Article Snippet: Paragraph title: Isolation of the class II CYC/TB1-like sequences of O. italica ... The reaction mixture contained 200 μM dNTPs, 0.4 μM of each primer, buffer 1X and 2.5 U HotMaster Taq polymerase (5Prime).

Multiplex Assay:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: To pool all 93 samples in a single run, 93 different forward primers were constructed, each containing a different 10 bp long Multiplex Identifier (Roche) between the adaptor sequence and the template specific sequence. .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: Amplification and Pyrosequencing of DNA from Maize Roots Polymerase chain reaction (PCR) amplification of the hypervariable V4–V5 regions of the 16S rRNA gene was performed over each individual DNA extraction from soils using universal primers U519F and U926R ( ) joined to a multiplex identifier sequence ( ; ). .. For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template.

Size-exclusion Chromatography:

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany). .. The reactions included an initial denaturation cycle at 94°C for 2 min, then 30 cycles of 94°C for 20 sec, 53°C for 20 sec and 72°C for 3 min. At the end, the reaction mixtures were incubated at 72°C for 10 min and then stored at 4°C.

Sequencing:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: To pool all 93 samples in a single run, 93 different forward primers were constructed, each containing a different 10 bp long Multiplex Identifier (Roche) between the adaptor sequence and the template specific sequence. .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Article Title: Invaders, natives and their enemies: distribution patterns of amphipods and their microsporidian parasites in the Ruhr Metropolis, Germany
Article Snippet: Paragraph title: PCR and sequencing ... Each PCR reaction mix (total volume of 12.5 μL) contained 1 μL template DNA, 0.2 mM dNTPs, 1x PCR buffer, 0.5 μM of each primer, 0.025 U/μL Hotmaster Taq -polymerase (5 PRIME GmbH) and made up to a final volume of 12.5 μL with PCR grade water.

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: Amplification and Pyrosequencing of DNA from Maize Roots Polymerase chain reaction (PCR) amplification of the hypervariable V4–V5 regions of the 16S rRNA gene was performed over each individual DNA extraction from soils using universal primers U519F and U926R ( ) joined to a multiplex identifier sequence ( ; ). .. For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template.

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O. ..

Article Title: Induction of Terpene Biosynthesis in Berries of Microvine Transformed with VvDXS1 Alleles
Article Snippet: .. Allele discrimination by VvDXS1 amplicon digestion and sequencing The PCR was performed in a 20 μl reaction volume containing 100 ng of leaf DNA, 0.25 mM dNTPs, 0.3 μM of each primer (Fw: ATTGCTGTCATAGGTGATGGAG; Rv: CTGTTGTCTTGGTACTCTTAAC), 1X Taq Buffer Advanced (5 Prime, Hilden, Germany) and 1 unit of 5 Prime Taq DNA Polymerase (5 Prime, Hilden, Germany). .. The obtained amplicon (423 bp) was digested with the FastDigest StyI restriction enzyme (Thermo Fischer Scientific, Waltham, MA, USA) to detect SNP1822 G/T (StyI recognizes the restriction site when G is present) or sequenced with the 3730xl DNA Analyzer (Applied Biosystems, Foster City, CA, USA).

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. .. The reaction cycle conditions consisted of an initial denaturation step at 94°C for 5 min, followed by 35 cycles of 30 s denaturation at 94°C, 30 s annealing at varying temperatures (see for specific annealing temperatures), and 30 s extension at 68°C, with a final extension at 68°C for 5 min. Allele-specific primers were constructed by introducing a one-base mismatch sequence before the SNP site.

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: The long tag is necessary for genotyping with a three-primer PCR protocol, as its product anneals with a third, fluorescently marked primer (6-FAM; Integrated DNA Technologies, Coralville, Iowa, USA) of identical sequence ( ). .. These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.).

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Paragraph title: NJAY phytoplasma EcDNA amplification and sequence analysis ... Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany).

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: Paragraph title: PCR, cloning and sequencing ... COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer.

Article Title: Applications of DNA barcoding to fish landings: authentication and diversity assessment
Article Snippet: Amplification reactions were performed in a total volume of 23 µl, including 5 PRIME Buffer 1 × (Gaithersburg, MD, USA), 1.5 mM MgCl2 , 0.25 mM dNTPs, 1 µM of each primer, 20 ng of template DNA, and 1.5U of DNA Taq polymerase (5 PRIME). .. The PCR conditions were the following: 12S rDNA: an initial denaturation at 95 °C for 10 min, then 35 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min and extension at 72 °C for 1.5 min, followed by a final extension at 72 °C for 7 min. COI: an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 64–54 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. cyt b : an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 60–50 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. D-Loop: an initial denaturation at 94 °C for 5 min, then 10 cycles of denaturation at 94 °C for 1 min, annealing at 57 °C for 1 min and extension at 72 °C for 1.5 min, followed by 25 cycles of denaturation at 94 °C for 1 min, annealing at 54 °C for 1 min and extension at 72 °C for 1.5 min, finally a final extension at 72 °C for 5 min. Sequencing was carried out by the DNA sequencing service GATC Biotech (Germany).

Polyacrylamide Gel Electrophoresis:

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O. .. Allele sizes were determined using polyacrylamide gel electrophoresis on a LI-COR® 4300 DNA Analyzer with the software SagaGT (LI-COR Biosciences, Bad Homburg, Germany).

Lysis:

Article Title: Ectoparasite communities of small-bodied Malagasy primates: seasonal and socioecological influences on tick, mite and lice infestation of Microcebus murinus and M. ravelobensis in northwestern Madagascar
Article Snippet: DNA was extracted from ticks individually homogenized with polystyrene pistils (Roth) using the DirectPCR® Lysis Reagent Cell (PEQLAB Biotechnology GmbH, Erlangen, Germany) following the manufacturer’s instructions. .. For selected tick specimens, a 760 bp fragment of the cytochrome c oxidase subunit 1 gene ( cox 1) was amplified using primers Cox1F und Cox1R [ ] in a 25 μl reaction mixture containing 18.5 μl double-distilled water, 0.5 μl dNTPs (10 mM each), 1 μl for/rev primer (10 μM each), 2.5 μl 10× buffer, 0.5 μl Taq polymerase (5 Prime, Hilden, Germany) and 1 μl DNA template.

Article Title: Ectoparasite communities of small-bodied Malagasy primates: seasonal and socioecological influences on tick, mite and lice infestation of Microcebus murinus and M. ravelobensis in northwestern Madagascar
Article Snippet: DNA was extracted from ticks individually homogenized with polystyrene pistils (Roth) using the DirectPCR® Lysis Reagent Cell (PEQLAB Biotechnology GmbH, Erlangen, Germany) following the manufacturer’s instructions. .. For selected tick specimens, a 760 bp fragment of the cytochrome c oxidase subunit 1 gene (cox 1) was amplified using primers Cox1F und Cox1R [ ] in a 25 μl reaction mixture containing 18.5 μl double-distilled water, 0.5 μl dNTPs (10 mM each), 1 μl for/rev primer (10 μM each), 2.5 μl 10× buffer, 0.5 μl Taq polymerase (5 Prime, Hilden, Germany) and 1 μl DNA template.

Purification:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime). .. The duplicate reactions were combined and purified with the QIAquick PCR purification kit (Qiagen, Valencia, CA, USA).

Article Title: Invaders, natives and their enemies: distribution patterns of amphipods and their microsporidian parasites in the Ruhr Metropolis, Germany
Article Snippet: Each PCR reaction mix (total volume of 12.5 μL) contained 1 μL template DNA, 0.2 mM dNTPs, 1x PCR buffer, 0.5 μM of each primer, 0.025 U/μL Hotmaster Taq -polymerase (5 PRIME GmbH) and made up to a final volume of 12.5 μL with PCR grade water. .. PCR products were purified (JETQUICK PCR Product Purification Spin Kit, Fa.

Article Title: Bacterial Communities in the Rhizosphere of Amilaceous Maize (Zea mays L.) as Assessed by Pyrosequencing
Article Snippet: For each sample, amplicons were generated in several replicate PCRs using mixtures (25 μl) that contained 25 pmol of each primer, 1.8 mM MgCl2 , 0.2 mM dNTPs, 1 × the corresponding Taq buffer, 1 U of Taq Master (5 Prime, USA) and 10 ng of the DNA template. .. The PCR program consisted of an initial denaturation step at 94°C for 4 min, 25 cycles of denaturation at 94°C for 15 s, primer annealing at 55°C for 45 s and extension at 72°C for 1 min, followed by a final step of heating at 72°C for 10 min. Amplicons of the same treatment were pooled to reduce per-PCR variability and purified using the ultracentrifugal filters Ultracel-100 K membranes (Amicon) according to the manufacturer’s instructions.

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: The reaction was incubated for 25 min at 37 °C followed by an inactivation step at 85 °C for 15 min. Purified PCR products were bidirectionally sequenced by GATC-Biotech (Konstanz, Germany). .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O.

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA. .. Each sample was amplified in triplicate, pooled and purified using the QIAquick® PCR Purification Kit (Qiagen, Hilden, Germany).

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Purified PCR products were sequenced and the entire EcDNA of NJAY phytoplasma was sequenced by primer walking using newly designed primers (see Additional File ). .. Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany).

Plasmid Preparation:

Article Title: Analysis of the TCP genes expressed in the inflorescence of the orchid Orchis italica
Article Snippet: The reaction mixture contained 200 μM dNTPs, 0.4 μM of each primer, buffer 1X and 2.5 U HotMaster Taq polymerase (5Prime). .. The amplification product was cloned into the pGEM-T Easy vector (Promega), and the positive clones were sequenced using the plasmid primers T7 and SP6 and analyzed on an ABI 310 Automated Sequencer (Applied Biosystems).

Software:

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O. .. Allele sizes were determined using polyacrylamide gel electrophoresis on a LI-COR® 4300 DNA Analyzer with the software SagaGT (LI-COR Biosciences, Bad Homburg, Germany).

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: The primers were designed with the Primer3 software [ ]. .. PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer.

Article Title: Applications of DNA barcoding to fish landings: authentication and diversity assessment
Article Snippet: The sample is then incubated for 5 min. A vacuum of 35 kPa is applied for 1 min. We employed the QIAxtractor Software application. .. Amplification reactions were performed in a total volume of 23 µl, including 5 PRIME Buffer 1 × (Gaithersburg, MD, USA), 1.5 mM MgCl2 , 0.25 mM dNTPs, 1 µM of each primer, 20 ng of template DNA, and 1.5U of DNA Taq polymerase (5 PRIME).

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: Primer pairs ( ) flanking the microsatellite motif, were designed by Primer3 software ( http://frodo.wi.mit.edu/primer3/ ) and further used for specific amplification. .. The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase.

Negative Control:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime). .. Amplicons were pooled equimolarly, including 2 µl of a negative control with a separate Multiplex Identifier to check for contaminations, and sequenced on 1/2 plate on a Roche 454 GS-FLX Titanium platform at the Institute of Clinical Molecular Biology (IKMB), University of Kiel, Germany.

Agarose Gel Electrophoresis:

Article Title: RyR2 QQ2958 Genotype and Risk of Malignant Ventricular Arrhythmias
Article Snippet: PCR amplifications were carried out in a total reaction volume of 25 μ L, with each reaction containing 100 ng of gDNA, 5 pmol of each primer, 10 mM dNTPs, 2.5 U Taq 5-Prime Eppendorf (5-PRIME, Hamburg, Germany), and 1x reaction buffer. .. After agarose-gel electrophoresis, the PCR product was visualized with ethidium bromide, photographed, and genotyped.

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: PCRs were performed in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.2 μM of each primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc., Gaithersburg, Maryland, USA) under the following conditions: 94°C for 2 min, then 35 cycles of 94°C for 20 s, 55°C for 30 s, and 65°C for 30 s. Primer pairs that successfully amplified a microsatellite region, as determined by the presence of one or two distinct bands on a 1% agarose gel stained with ethidium bromide, were then used for three-primer PCR. .. These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.).

In Situ:

Article Title: Small Changes in pH Have Direct Effects on Marine Bacterial Community Composition: A Microcosm Approach
Article Snippet: 16S ribosomal amplicon pyrosequencing Based on ARISA results, samples were selected for pyrosequencing of the bacterial 16S rDNA (pH in situ and 7.67 of all ‘no dilution’ and ‘serial dilution’ treatments and of the ‘initial dilution’ in summer; additionally starting communities). .. Amplifications were conducted in two duplicate reactions of 50 µl, each containing 20 ng of template DNA, 5 µl Taq Buffer (10×), 10 µl TaqMaster PCR Enhancer (5×), 1.25 µl of each primer (20 µM), 5 µl dNTPs (2.5 mM each), and 2.5 U of Taq DNA polymerase (5 Prime).

Chromosome Walking:

Article Title: On the alleged origin of geminiviruses from extrachromosomal DNAs of phytoplasmas
Article Snippet: Purified PCR products were sequenced and the entire EcDNA of NJAY phytoplasma was sequenced by primer walking using newly designed primers (see Additional File ). .. Amplifications were performed in a 20-μl PCR reaction containing 100 ng of template DNA, 200 μM dNTPs, 1 μM of each primer, 1 U of 5 PRIME DNA polymerase with the recommended PCR buffer containing MgCl2 (5 PRIME, Hamburg, Germany).

Functional Assay:

Article Title: Positive selection in octopus haemocyanin indicates functional links to temperature adaptation
Article Snippet: COI and COIII were amplified in 25 μl PCR mix containing final concentrations of 0.5 μmol L−1 dNTPs, 0.05 units μl−1 Taq DNA Polymerase, 1 x Taq buffer (5 Prime, Germany) and 1 μmol L−1 of each Primer. .. Regions of the haemocyanin gene were amplified using two pairs of degenerate primers, which bind to conserved sites present across all seven functional units (i.e. amino acid sequence PYWDW and WAIWQ, [ ]).

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: Marker development Two types of functional molecular markers related to the PPO elements identified here were newly designed: SSRs and SNPs. .. The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase.

Sampling:

Article Title: Widely distributed and regionally isolated! Drivers of genetic structure in Gammarus fossarum in a human-impacted landscape
Article Snippet: For 420 specimens from ten sampling sites (Table ), eight microsatellite loci were additionally amplified: Gam 2, Gam 14 [ ], Gamfos 10, Gamfos 13, Gamfos 18, Gamfos 22, Gamfos 27, and Gamfos 28 [ ]. .. The amplification of Gam 2, Gam 14, Gamfos 13, Gamfos 27, and Gamfos 28 was performed using the following protocol: 1× PCR buffer, 0.2 mM dNTPs, 0.2 μM sequence-specific untailed primer, 0.05 μM sequence-specific tailed primer, 0.2 μM fluorescently labelled universal M13 primer, 5 % dimethyl sulfoxide (DMSO), 0.5–1 μl of DNA template, 0.025 U/μl HotMaster Taq (5 PRIME GmbH, Hamburg, Germany), filled to 15 μl with sterile H2 O.

Concentration Assay:

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.). .. The same PCR conditions as before were used, except that the annealing time at 55°C was increased to 1 to 2 min for robust amplification (due to low concentration of forward primer).

Marker:

Article Title: A Multidisciplinary Approach Providing New Insight into Fruit Flesh Browning Physiology in Apple (Malus x domestica Borkh.)
Article Snippet: Paragraph title: Marker development ... The PCR conditions were as follow: 5 ng of DNA, 10 X Buffer, 0.25mM dNTPs, 0.075 µM of forward labelled and reverse primers and 1000 U of 5Prime® Taq polymerase.

Staining:

Article Title: Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community
Article Snippet: PCR amplifications were performed in 50 μl reaction volumes containing ultrapure H2 O, 2.5 × 5 PRIME MasterMix including 1.5 mM Magnesium, 200 μM dNTPs, 1.25 U Taq polymerase (5 PRIME, Hamburg, Germany), 0.2 μM of primers and 5–10 ng of template DNA. .. Amplification was checked by electrophoresis in 2% agarose gels stained with SYBR® Safe DNA Gel Stain (Invitrogen™, Carlsbad, USA) and bands were visualized using UV light in a Gel Doc™ EZ Imager (BIO-RAD, Hercules, USA).

Article Title: High-throughput microsatellite marker development for the distylous herb Primula mistassinica (Primulaceae) 1
Article Snippet: PCRs were performed in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.2 μM of each primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc., Gaithersburg, Maryland, USA) under the following conditions: 94°C for 2 min, then 35 cycles of 94°C for 20 s, 55°C for 30 s, and 65°C for 30 s. Primer pairs that successfully amplified a microsatellite region, as determined by the presence of one or two distinct bands on a 1% agarose gel stained with ethidium bromide, were then used for three-primer PCR. .. These reactions were also carried out in 10-μL volume containing 1× buffer, 200 μM dNTPs, 0.15 μM fluorescent primer, 0.05 μM long-tail-tagged (forward) primer, 0.2 μM reverse primer, 1 μL template, and 0.05 μL HotMaster Taq polymerase (5 Prime Inc.).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    5 PRIME dntp
    Dntp, supplied by 5 PRIME, used in various techniques. Bioz Stars score: 99/100, based on 83 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/5 PRIME
    Average 99 stars, based on 83 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results