dntps solution takara  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Name:
    dNTP Mixture
    Description:
    Our dNTPs for PCR are 98 pure and are tested for quality control in a variety of applications Individual dNTPs are supplied at a concentration of 100 mM and can be diluted with water or buffer as needed The dNTP Set Cat 4025 provides one of each of the four deoxynucleotide triphosphates
    Catalog Number:
    4030
    Price:
    None
    Size:
    3 2 µmol Each 1 25 mL
    Category:
    dNTPs dNTPs Other PCR related products PCR
    Buy from Supplier


    Structured Review

    TaKaRa dntps solution takara
    Our dNTPs for PCR are 98 pure and are tested for quality control in a variety of applications Individual dNTPs are supplied at a concentration of 100 mM and can be diluted with water or buffer as needed The dNTP Set Cat 4025 provides one of each of the four deoxynucleotide triphosphates
    https://www.bioz.com/result/dntps solution takara/product/TaKaRa
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    dntps solution takara - by Bioz Stars, 2020-01
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan). .. Amplified DNA fragments were then ligated into the cloning site of the pEGFP-C3 vector (EGFP) and transformed into Escherichia coli DH5α competent cells, which were obtained from Life Technologies (Carlsbad, California, USA).

    Amplification:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: .. Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% TAE (Tris-Acetate EDTA) run at 80 V for 12 hours.

    Article Title: Validation of doubled haploid plants by enzymatic mismatch cleavage
    Article Snippet: Heteroduplex mismatch cleavage screening PCR reactions for enzymatic cleavage were carried out in 25 μL volumes under the following conditions (per reaction): 1x Ex Taq™ Reaction Buffer (TaKaRa, Shiga, Japan), 0.2 mM TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq™ Polymerase, 0.12 μM of forward and reverse primer and 25 ng genomic DNA. .. Design of new primers and PCR amplification was carried out as previously described [ ], except that annealing temperatures were adjusted according to the melting temperature of the primer.

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: .. For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer. .. Denaturation was carried out at 94°C for 105 sec, and amplification was carried out for 25 cycles at 94°C for 30 sec and at 68°C for 90 sec in an automated DNA Thermal Cycler (GeneAmp PCR System 2400, Perkin-Elmer, Norwalk, CT).

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: Paragraph title: 2.2. DNA Extraction, PCR Amplification, and Sequencing ... PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA.

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: Amplification of EGFR and K-ras was performed using the primers listed in . .. PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras.

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer. .. Amplified products from all 12 annealing temperatures were pooled, gel-purified and processed for PhyloChip analysis as previously reported , except that 250 ng of each amplicon was hybridized.

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: Full-length 3CLpro versions (wild type and mutant, C145A) and CMV promoter were amplified by PCR using primers containing suitable restriction sites for subcloning into the pEGFP-C3 vector (3CLpro primers: 5' ATATGGTACCAgTGGTTTTAGGAAAATGGCATTC 3'/Kpn I, 5' GAGATGAGTTTCTGCTCTTGGAAGGTAACACCAGAGCATT 3', and ATATGGATCCCAGATCCTCTTCTGAGATGAGTTTCTGCTCTTGGAA 3'/BamH I; CMV promoter primers: 5' ATATCTCGAGTAGTTATTAATAGTAATCAATTAC 3'/XhoI and 5' ATATAAGCTTTAGCGCTAGCGGATCTGA 3'/Hind III). .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan).

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

    Article Title: Lactobacillus casei Abundance Is Associated with Profound Shifts in the Infant Gut Microbiome
    Article Snippet: PCR reactions contained 0.02 U/µl Takara Ex Taq DNA Polymerase (Takara Bio Inc., Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg/ml bovine serum albumin (BSA) and 1.0 µM of each primer. .. Amplified products from all 12 annealing temperatures were pooled, gel purified and processed for PhyloChip analysis as previously described , except that 500 ng of each amplicon was hybridized.

    Expressing:

    Article Title: Suppression of Matrix Metalloproteinase Production in Nasal Fibroblasts by Tranilast, an Antiallergic Agent, In Vitro
    Article Snippet: Paragraph title: Assay for mRNA expression ... The polymerase chain reaction (PCR) mixture consisted of 1.0 μ L of sample cDNA solution, 3.3 μ L of 10 × PCR buffer (Takara Shuzo Co Ltd, Shiga, Japan), 2.6 μ L of dNTP mixture (Takara Shuzo), 1.0 μ L of both sense and antisense primers, 0.2 μ L of Taq DNA polymerase (Takara Shuzo), and distilled water to produce a final volume of 30 μ L. The primers used for RT-PCR were 5′−AGATCTTCTTCTTCAAGGACCGGTT-3′ (sense) and 5′−GGCTGGTCAGTGGCTTGGGGTA-3′ (antisense) for MMP-2, 5′−CCCACATTTGACGTCCAGAGAAGAA-3′ (sense) and 5′−GTTTTTGATGCTATTGGCTGAGATCCA-3′ (antisense) for MMP-9, 5′−CTCGCTGGACGTTGGAGGAAAGAA-3′ (sense) and 5′−AGCCCATCTGGTACCTGTGGTTCA-3′ (antisense) for TIMP-2, and 5′−CGGAACCGCTCATTGCC-3′ and 5′−ACCCACACTGTGCCCATCTA-3′ for β −actin [ ].

    Synthesized:

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    Real-time Polymerase Chain Reaction:

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA. .. Amplification was done by quantitative Real Time PCR on Rotor Gene™ 6000 (Corbett Life Science, Cambridge, UK) equipped with Rotor Gene 6000 Series Software 1.7 Build 87.

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: Paragraph title: RNA extraction and reverse transcription quantitative polymerase chain reaction assay ... Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI).

    Incubation:

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: .. Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

    Mass Spectrometry:

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: Paragraph title: Validation of MS-MLPA results ... Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA.

    Modification:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: DNA was extracted from colonies grown on tryptic soy agar using a modification of the manufacturer's protocol for Instagene chelex resin (Biorad, Hercules, CA, USA). .. Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template.

    Transformation Assay:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan). .. Amplified DNA fragments were then ligated into the cloning site of the pEGFP-C3 vector (EGFP) and transformed into Escherichia coli DH5α competent cells, which were obtained from Life Technologies (Carlsbad, California, USA).

    Activated Clotting Time Assay:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: Rep-PCR was performed as in previously described protocols using primers ERIC1R ( 5′-ATG TAA GCT CCT GGG GAT TCA-3′ ) and ERIC2 ( 5′-AAG TAA GTG ACT GGG GTG AGC G-3′ ), targeting enterobacterial repetitive intergenic consensus (ERIC) repetitive motifs – . .. Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template.

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

    Immunohistochemistry:

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: ATM and MLH1 were confirmed by pyrosequencing CpG analysis, while FHIT was validated by immunohistochemistry (IHC) staining. .. Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA.

    Sequencing:

    Article Title: The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods. The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods
    Article Snippet: Long PCRs were performed in a volume of 25 μl containing 12.75 μl of sterilized ultrapure water, 2.5 μl of 10× Takara LA PCR buffer (including MgCl2 ), 4 μl of Takara dNTP mixture (2.5 mmol/L each), 0.25 μl of Takara LA Taq polymerase (5 units/μl), 1 μl of primer mixture (10 mmol/L each), and 4 μl of DNA template (100 ng/μl). .. Considering the lack of data regarding genome arrangement for this species and to obtain precise genomic sequences, five gene‐specific primer pairs were designed to cover any gaps and inaccurate sequencing.

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: Paragraph title: 2.2. DNA Extraction, PCR Amplification, and Sequencing ... PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA.

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: The mutation status of EGFR (exons 18–21) and K-ras (exons 12 and 13) were analyzed by polymerase chain reaction (PCR) amplification of genomic DNA and direct sequencing. .. PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras.

    Genomic Sequencing:

    Article Title: The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods. The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods
    Article Snippet: Long PCRs were performed in a volume of 25 μl containing 12.75 μl of sterilized ultrapure water, 2.5 μl of 10× Takara LA PCR buffer (including MgCl2 ), 4 μl of Takara dNTP mixture (2.5 mmol/L each), 0.25 μl of Takara LA Taq polymerase (5 units/μl), 1 μl of primer mixture (10 mmol/L each), and 4 μl of DNA template (100 ng/μl). .. Considering the lack of data regarding genome arrangement for this species and to obtain precise genomic sequences, five gene‐specific primer pairs were designed to cover any gaps and inaccurate sequencing.

    Generated:

    Article Title: The Role of Nuclear Receptor NHR-64 in Fat Storage Regulation in Caenorhabditis elegans
    Article Snippet: RT-PCR of nhr-64 Total RNA was prepared and cDNA was generated as previously described. .. Each 25 microliter PCR reaction mix contained 1× Ex Taq buffer, 1 mM total concentration of TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq , and 1.0 µM of each primer, 100 ng cDNA as template.

    DNA Sequencing:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan). .. Restriction enzyme digestion, PCR and DNA sequencing analysis (Mission Biotech, Taipei, Taiwan) were used to verify the plasmids.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: RT-PCR was performed using an RNA PCR Kit Version 2 (Takara Shuzo, Ohtsu, Japan) according to the manufacturer’s protocol. .. For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer.

    Article Title: The Role of Nuclear Receptor NHR-64 in Fat Storage Regulation in Caenorhabditis elegans
    Article Snippet: Paragraph title: RT-PCR of nhr-64 ... Each 25 microliter PCR reaction mix contained 1× Ex Taq buffer, 1 mM total concentration of TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq , and 1.0 µM of each primer, 100 ng cDNA as template.

    Article Title: Suppression of Matrix Metalloproteinase Production in Nasal Fibroblasts by Tranilast, an Antiallergic Agent, In Vitro
    Article Snippet: .. The polymerase chain reaction (PCR) mixture consisted of 1.0 μ L of sample cDNA solution, 3.3 μ L of 10 × PCR buffer (Takara Shuzo Co Ltd, Shiga, Japan), 2.6 μ L of dNTP mixture (Takara Shuzo), 1.0 μ L of both sense and antisense primers, 0.2 μ L of Taq DNA polymerase (Takara Shuzo), and distilled water to produce a final volume of 30 μ L. The primers used for RT-PCR were 5′−AGATCTTCTTCTTCAAGGACCGGTT-3′ (sense) and 5′−GGCTGGTCAGTGGCTTGGGGTA-3′ (antisense) for MMP-2, 5′−CCCACATTTGACGTCCAGAGAAGAA-3′ (sense) and 5′−GTTTTTGATGCTATTGGCTGAGATCCA-3′ (antisense) for MMP-9, 5′−CTCGCTGGACGTTGGAGGAAAGAA-3′ (sense) and 5′−AGCCCATCTGGTACCTGTGGTTCA-3′ (antisense) for TIMP-2, and 5′−CGGAACCGCTCATTGCC-3′ and 5′−ACCCACACTGTGCCCATCTA-3′ for β −actin [ ]. .. The PCR conditions were as follows: 4 minutes at 94° C, followed by 30 cycles of 30 seconds at 94° C, 30 seconds at 58° C, and 30 seconds at 72° C. After cycling, there was a DNA extension period of 4 minutes at 72° C [ ].

    Recombinant:

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: .. Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI). .. After first-strand synthesis, quantitative PCR (qPCR) was performed by a 7900 HT Fast RealTime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

    Molecular Weight:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. Three lanes of a 1 kb plus DNA ladder (Novartis, Carlsbad, CA) were included to allow for standardization of molecular weight assignments to DNA fragments, with one lane at each end of the gel and one located in the approximate middle to allow for correction of irregular gel runs.

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

    DNA Extraction:

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: Paragraph title: 2.2. DNA Extraction, PCR Amplification, and Sequencing ... PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA.

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: Genomic DNA was extracted from the H1975 and H1299 cell lines using a DNA extraction kit (catalog no. #D0063; Beyotime Institute of Biotechnology, Hangzhou, China), according to the manufacturer's protocol. .. PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras.

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: Adult samples were centrifuged for 10 minutes at 12,000 g and RNALater removed prior to total genomic DNA extraction from 300 µl of sputum (containing sputum plugs) using the Wizard Genomic DNA extraction kit according to the manufacturer's instructions (Promega, CA). .. PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer.

    Fluorescence:

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA. .. The cycling programme for ATM and MLH1 consisted of one hold cycle at 95°C for 5 min, the second hold cycle at 72°C for 5 min, one pre-melting cycle at 65°C for 90 s and then one melting cycle from 65°C to 95°C with an increase of 1°C every 5 s, with fluorescence acquisition.

    Mutagenesis:

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: The mutation status of EGFR (exons 18–21) and K-ras (exons 12 and 13) were analyzed by polymerase chain reaction (PCR) amplification of genomic DNA and direct sequencing. .. PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras.

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: Full-length 3CLpro versions (wild type and mutant, C145A) and CMV promoter were amplified by PCR using primers containing suitable restriction sites for subcloning into the pEGFP-C3 vector (3CLpro primers: 5' ATATGGTACCAgTGGTTTTAGGAAAATGGCATTC 3'/Kpn I, 5' GAGATGAGTTTCTGCTCTTGGAAGGTAACACCAGAGCATT 3', and ATATGGATCCCAGATCCTCTTCTGAGATGAGTTTCTGCTCTTGGAA 3'/BamH I; CMV promoter primers: 5' ATATCTCGAGTAGTTATTAATAGTAATCAATTAC 3'/XhoI and 5' ATATAAGCTTTAGCGCTAGCGGATCTGA 3'/Hind III). .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan).

    Isolation:

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: Total cytoplasmic RNA was isolated by the acid guanidine thiocyanate-phenol-chloroform method ( ) using Isogen (Nippon Gene, Toyama, Japan). .. For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer.

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: 2.3 RNA extraction and reverse transcription quantitative polymerase chain reaction assay Total RNA from all the 147 cases of glioma tissues and 23 cases of normal control brain tissues specimens was purified as recommended by the manufacturer using RecoverAll Total Nucleic Acid Isolation kit (Thermo Fisher Scientific, Inc., Waltham, MA). .. Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI).

    Article Title: Suppression of Matrix Metalloproteinase Production in Nasal Fibroblasts by Tranilast, an Antiallergic Agent, In Vitro
    Article Snippet: Assay for mRNA expression mRNA was extracted from NF using μ MACS mRNA isolation kits (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), according to the manufacturer's instructions. .. The polymerase chain reaction (PCR) mixture consisted of 1.0 μ L of sample cDNA solution, 3.3 μ L of 10 × PCR buffer (Takara Shuzo Co Ltd, Shiga, Japan), 2.6 μ L of dNTP mixture (Takara Shuzo), 1.0 μ L of both sense and antisense primers, 0.2 μ L of Taq DNA polymerase (Takara Shuzo), and distilled water to produce a final volume of 30 μ L. The primers used for RT-PCR were 5′−AGATCTTCTTCTTCAAGGACCGGTT-3′ (sense) and 5′−GGCTGGTCAGTGGCTTGGGGTA-3′ (antisense) for MMP-2, 5′−CCCACATTTGACGTCCAGAGAAGAA-3′ (sense) and 5′−GTTTTTGATGCTATTGGCTGAGATCCA-3′ (antisense) for MMP-9, 5′−CTCGCTGGACGTTGGAGGAAAGAA-3′ (sense) and 5′−AGCCCATCTGGTACCTGTGGTTCA-3′ (antisense) for TIMP-2, and 5′−CGGAACCGCTCATTGCC-3′ and 5′−ACCCACACTGTGCCCATCTA-3′ for β −actin [ ].

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: Escherichia coli isolates were re-streaked for isolation from the refrigerated stocks onto nutrient agar and incubated at 37 °C for 24 h. A single isolated colony was added to 100 μl of sterile deionized water to make a template for PCR amplification using primers ERIC1R (5′-ATG TAA GCT CCT GGG GAT TCA-3′) and ERIC2 (5′-AAG TAA GTG ACT GGG GTG AGC G-3′) targeting enterobacterial repetitive intergenic consensus repetitive motifs. .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

    Subcloning:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: Full-length 3CLpro versions (wild type and mutant, C145A) and CMV promoter were amplified by PCR using primers containing suitable restriction sites for subcloning into the pEGFP-C3 vector (3CLpro primers: 5' ATATGGTACCAgTGGTTTTAGGAAAATGGCATTC 3'/Kpn I, 5' GAGATGAGTTTCTGCTCTTGGAAGGTAACACCAGAGCATT 3', and ATATGGATCCCAGATCCTCTTCTGAGATGAGTTTCTGCTCTTGGAA 3'/BamH I; CMV promoter primers: 5' ATATCTCGAGTAGTTATTAATAGTAATCAATTAC 3'/XhoI and 5' ATATAAGCTTTAGCGCTAGCGGATCTGA 3'/Hind III). .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan).

    Size-exclusion Chromatography:

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer. .. Denaturation was carried out at 94°C for 105 sec, and amplification was carried out for 25 cycles at 94°C for 30 sec and at 68°C for 90 sec in an automated DNA Thermal Cycler (GeneAmp PCR System 2400, Perkin-Elmer, Norwalk, CT).

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras. .. Initial denaturation was conducted at 95°C for 2 min, followed by 30 cycles of PCR program, which consisted of denaturation at 94°C for 30 sec, specific annealing temperature (50–61°C) for 30 sec, and extension at 72°C for 1 min. A final extension step was performed at 72°C for 10 min.

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: Deep-throat swabs were added to lysis buffer from the AllPrep DNA/RNA extraction kit (Qiagen, CA) in a lysing matrix B tube (Qbiogene, CA) and lysed by bead-beating using a FastPrep system (Qbiogene, CA) for 30 seconds at 5.5 m sec−1 . .. PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer.

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. For the PCR, a thermal cycler (Takara Bio) was programmed as follows: (1) 94 °C for 2 min; (2) 94 °C for 20 sec; (3) 65 °C for 15 sec, decrease by 0.5 °C per cycle; (4) 68 °C for 10 sec; (5) repeat steps 2–4 for 10 cycles; (6) 94 °C for 15 sec; (7) 60 °C for 15 sec; (8) 72 °C for 10 sec; (9) repeat steps 6–8 for 28 cycles; (10) 72 °C for 2 min; (11) 10 °C hold.

    Purification:

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: 2.3 RNA extraction and reverse transcription quantitative polymerase chain reaction assay Total RNA from all the 147 cases of glioma tissues and 23 cases of normal control brain tissues specimens was purified as recommended by the manufacturer using RecoverAll Total Nucleic Acid Isolation kit (Thermo Fisher Scientific, Inc., Waltham, MA). .. Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI).

    Article Title: Lactobacillus casei Abundance Is Associated with Profound Shifts in the Infant Gut Microbiome
    Article Snippet: PCR reactions contained 0.02 U/µl Takara Ex Taq DNA Polymerase (Takara Bio Inc., Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg/ml bovine serum albumin (BSA) and 1.0 µM of each primer. .. Amplified products from all 12 annealing temperatures were pooled, gel purified and processed for PhyloChip analysis as previously described , except that 500 ng of each amplicon was hybridized.

    Polymerase Chain Reaction:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: .. Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% TAE (Tris-Acetate EDTA) run at 80 V for 12 hours.

    Article Title: Validation of doubled haploid plants by enzymatic mismatch cleavage
    Article Snippet: .. Heteroduplex mismatch cleavage screening PCR reactions for enzymatic cleavage were carried out in 25 μL volumes under the following conditions (per reaction): 1x Ex Taq™ Reaction Buffer (TaKaRa, Shiga, Japan), 0.2 mM TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq™ Polymerase, 0.12 μM of forward and reverse primer and 25 ng genomic DNA. ..

    Article Title: The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods. The first complete mitogenome of the South China deep‐sea giant isopod Bathynomus sp. (Crustacea: Isopoda: Cirolanidae) allows insights into the early mitogenomic evolution of isopods
    Article Snippet: .. Long PCRs were performed in a volume of 25 μl containing 12.75 μl of sterilized ultrapure water, 2.5 μl of 10× Takara LA PCR buffer (including MgCl2 ), 4 μl of Takara dNTP mixture (2.5 mmol/L each), 0.25 μl of Takara LA Taq polymerase (5 units/μl), 1 μl of primer mixture (10 mmol/L each), and 4 μl of DNA template (100 ng/μl). ..

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: .. For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer. .. Denaturation was carried out at 94°C for 105 sec, and amplification was carried out for 25 cycles at 94°C for 30 sec and at 68°C for 90 sec in an automated DNA Thermal Cycler (GeneAmp PCR System 2400, Perkin-Elmer, Norwalk, CT).

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: .. Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA. .. Amplification was done by quantitative Real Time PCR on Rotor Gene™ 6000 (Corbett Life Science, Cambridge, UK) equipped with Rotor Gene 6000 Series Software 1.7 Build 87.

    Article Title: The Role of Nuclear Receptor NHR-64 in Fat Storage Regulation in Caenorhabditis elegans
    Article Snippet: .. Each 25 microliter PCR reaction mix contained 1× Ex Taq buffer, 1 mM total concentration of TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq , and 1.0 µM of each primer, 100 ng cDNA as template. ..

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: .. PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA. .. PCR thermocycling was performed in a T100™ Thermal Cycler (Bio-Rad, CA, USA).

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI). .. After first-strand synthesis, quantitative PCR (qPCR) was performed by a 7900 HT Fast RealTime PCR system (Applied Biosystems; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.

    Article Title: HER2 overexpression reverses the relative resistance of EGFR-mutant H1975 cell line to gefitinib
    Article Snippet: .. PCR was performed in a total volume of 50 µl, in a mixture containing 5 µl Takara 10X Ex Taq buffer (Mg2+ Plus), 4 µl Takara dNTP mixture (2.5 mM each), 0.25 µl Takara Ex Taq DNA polymerase (1.25 U), 0.5 µg DNA, and 1 µl of each primer pair for EGFR and K-ras. .. Initial denaturation was conducted at 95°C for 2 min, followed by 30 cycles of PCR program, which consisted of denaturation at 94°C for 30 sec, specific annealing temperature (50–61°C) for 30 sec, and extension at 72°C for 1 min. A final extension step was performed at 72°C for 10 min.

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: .. PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer. .. PCR conditions were 1 cycle of 3 min at 95°C followed by 25 cycles of 95°C for 30 s, the gradient annealing temperature for 30 s, 72°C for 2 min and a final extension at 72°C for 10 min. A total of 100 ng of extracted DNA from adult sputum or pediatric deep-throat swab samples was used per PCR reaction.

    Article Title: Suppression of Matrix Metalloproteinase Production in Nasal Fibroblasts by Tranilast, an Antiallergic Agent, In Vitro
    Article Snippet: .. The polymerase chain reaction (PCR) mixture consisted of 1.0 μ L of sample cDNA solution, 3.3 μ L of 10 × PCR buffer (Takara Shuzo Co Ltd, Shiga, Japan), 2.6 μ L of dNTP mixture (Takara Shuzo), 1.0 μ L of both sense and antisense primers, 0.2 μ L of Taq DNA polymerase (Takara Shuzo), and distilled water to produce a final volume of 30 μ L. The primers used for RT-PCR were 5′−AGATCTTCTTCTTCAAGGACCGGTT-3′ (sense) and 5′−GGCTGGTCAGTGGCTTGGGGTA-3′ (antisense) for MMP-2, 5′−CCCACATTTGACGTCCAGAGAAGAA-3′ (sense) and 5′−GTTTTTGATGCTATTGGCTGAGATCCA-3′ (antisense) for MMP-9, 5′−CTCGCTGGACGTTGGAGGAAAGAA-3′ (sense) and 5′−AGCCCATCTGGTACCTGTGGTTCA-3′ (antisense) for TIMP-2, and 5′−CGGAACCGCTCATTGCC-3′ and 5′−ACCCACACTGTGCCCATCTA-3′ for β −actin [ ]. .. The PCR conditions were as follows: 4 minutes at 94° C, followed by 30 cycles of 30 seconds at 94° C, 30 seconds at 58° C, and 30 seconds at 72° C. After cycling, there was a DNA extension period of 4 minutes at 72° C [ ].

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan). .. Amplified DNA fragments were then ligated into the cloning site of the pEGFP-C3 vector (EGFP) and transformed into Escherichia coli DH5α competent cells, which were obtained from Life Technologies (Carlsbad, California, USA).

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: .. Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    Article Title: Lactobacillus casei Abundance Is Associated with Profound Shifts in the Infant Gut Microbiome
    Article Snippet: .. PCR reactions contained 0.02 U/µl Takara Ex Taq DNA Polymerase (Takara Bio Inc., Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg/ml bovine serum albumin (BSA) and 1.0 µM of each primer. .. PCR conditions were 1 cycle of 3 min at 95°C followed by 25 cycles of 95°C for 30 s, the gradient annealing temperature for 30 s, 72°C for 2 min and a final extension at 72°C for 10 min. A total of 100 ng of extracted DNA from the stool samples was used per PCR reaction.

    Staining:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. Gels were stained with ethidium bromide and digitally photographed using an AlphaImager ™ 2200 (Alpha Innotec Co., San Leandro, CA, USA).

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer. .. After amplification, the RT-PCR reaction mixture (10 μl) was electrophoresed on a 2% agarose gel which was visualized by ethidium bromide staining with an ultraviolet transilluminator (FAS II, Toyobo, Osaka, Japan).

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: ATM and MLH1 were confirmed by pyrosequencing CpG analysis, while FHIT was validated by immunohistochemistry (IHC) staining. .. Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA.

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. Gels were stained with ethidium bromide and digitally photographed using an AlphaImager ™ 2200 (Alpha Innotec Co., San Leandro, CA, USA).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    Mouse Assay:

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: .. Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    RNA Extraction:

    Article Title: Prediction of relapse and prognosis by expression levels of long noncoding RNA PEG10 in glioma patients
    Article Snippet: Paragraph title: RNA extraction and reverse transcription quantitative polymerase chain reaction assay ... Synthesis of cDNA was performed using 2 μg of total RNA, lncRNA PEG10 reverse transcription primer (Invitrogen; Thermo Fisher Scientific, Inc.), 5X first-strand buffer (Thermo Fisher Scientific, Inc.), 0.1 mol/L DTT (Thermo Fisher Scientific, Inc.), a dNTP mixture (Takara, Bio, Inc., Otsu, Japan), Moloney Murine Leukemia Virus reverse transcriptase (Thermo Fisher Scientific, Inc.) and recombinant RNasin RNase inhibitor (Promega Corporation, Madison, WI).

    Plasmid Preparation:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: Full-length 3CLpro versions (wild type and mutant, C145A) and CMV promoter were amplified by PCR using primers containing suitable restriction sites for subcloning into the pEGFP-C3 vector (3CLpro primers: 5' ATATGGTACCAgTGGTTTTAGGAAAATGGCATTC 3'/Kpn I, 5' GAGATGAGTTTCTGCTCTTGGAAGGTAACACCAGAGCATT 3', and ATATGGATCCCAGATCCTCTTCTGAGATGAGTTTCTGCTCTTGGAA 3'/BamH I; CMV promoter primers: 5' ATATCTCGAGTAGTTATTAATAGTAATCAATTAC 3'/XhoI and 5' ATATAAGCTTTAGCGCTAGCGGATCTGA 3'/Hind III). .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan).

    Software:

    Article Title: Promoter methylation of tumor suppressor genes in pre-neoplastic lesions; potential marker of disease recurrence
    Article Snippet: Each PCR reaction was performed in a final volume of 50 μl containing 2 μl of each primer (5 μM), 1 μl of Takara dNTP mixture (10 mM of each dNTP) (Takara Bio Inc., Otsu, Japan), 1 μl of Takara 50 mM Mg++ solution (Takara Bio Inc.), 2.5 μl of EvaGreen™ Dye (20X), 10 μl of Takara 5X R-PCR Buffer (Mg++ free) (Takara Bio Inc.), 0.5 μl of Takara Ex Taq™ HS (5 U/μl) (Takara Bio Inc.), 26 μl of water and 5 μl of bisulphite-treated DNA. .. Amplification was done by quantitative Real Time PCR on Rotor Gene™ 6000 (Corbett Life Science, Cambridge, UK) equipped with Rotor Gene 6000 Series Software 1.7 Build 87.

    Negative Control:

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer. .. As a negative control, nucleic acid was extracted from sterile swabs and assayed for 16S rRNA product as described above.

    Agarose Gel Electrophoresis:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% TAE (Tris-Acetate EDTA) run at 80 V for 12 hours.

    Article Title: Prostaglandin D Synthase (β-Trace) in Human Arachnoid and Meningioma Cells: Roles as a Cell Marker or in Cerebrospinal Fluid Absorption, Tumorigenesis, and Calcification Process
    Article Snippet: For PCR, the template (2 μl) was subjected to amplification in a 50 μl PCR reaction mixture containing 40 μ m dNTP mixture, 2 p m of each PCR-primer for PGDS or GAPDH, and 0.1 U Taq polymerase (Takara Shuzo) in RNA PCR buffer. .. After amplification, the RT-PCR reaction mixture (10 μl) was electrophoresed on a 2% agarose gel which was visualized by ethidium bromide staining with an ultraviolet transilluminator (FAS II, Toyobo, Osaka, Japan).

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

    Spectrophotometry:

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: DNA concentration and quality were assessed by spectrophotometry (NanoDrop 2000 spectrophotometer, ThermoScientific, Wilmington, DE, USA). .. PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA.

    Sampling:

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: Escherichia coli genotyping To explore the degree of isolate pool overlap among locations given the proximity of the sampling sites, Escherichia coli were genotyped by repetitive element palindromic PCR, which detects the distribution of repetitive DNA sequences as genomic fingerprints ( ; ). .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template.

    Concentration Assay:

    Article Title: Salmonella Strains Isolated from Gal?pagos Iguanas Show Spatial Structuring of Serovar and Genomic Diversity
    Article Snippet: .. Polymerase chain reaction amplification mixtures (25 µl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Japan), 1× Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2 , 2.0 mM Takara dNTP mixture (0.5 mM each), 1 µM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% TAE (Tris-Acetate EDTA) run at 80 V for 12 hours.

    Article Title: The Role of Nuclear Receptor NHR-64 in Fat Storage Regulation in Caenorhabditis elegans
    Article Snippet: .. Each 25 microliter PCR reaction mix contained 1× Ex Taq buffer, 1 mM total concentration of TaKaRa dNTP mixture, 0.5 U TaKaRa Ex Taq , and 1.0 µM of each primer, 100 ng cDNA as template. ..

    Article Title: Unraveling the Genetic Structure of the Coconut Scale Insect Pest (Aspidiotus rigidus Reyne) Outbreak Populations in the Philippines
    Article Snippet: DNA concentration and quality were assessed by spectrophotometry (NanoDrop 2000 spectrophotometer, ThermoScientific, Wilmington, DE, USA). .. PCR reactions were performed in a 25 μL reaction mixture containing 10× Buffer, 2.5 mM dNTP mixture, 25 mM MgCl2 , 10 pmol of each primer, 1 U of Taq DNA polymerase (TaKaRa Bio Inc., Japan), and 2 to 50 ng of template DNA.

    Article Title: Considerations for studying transmission of antimicrobial resistant enteric bacteria between wild birds and the environment on intensive dairy and beef cattle operations
    Article Snippet: .. The PCR program was as follows: denaturation at 95 °C for 2 min followed by 30 cycles each of 94 °C for 3 s, 92 °C for 30 s, and 50 °C for 1 min and a final extension at 65 °C for 8 min. Polymerase chain reaction amplification mixtures (25 μl) included 1.75 U of Takara Taq polymerase (Takara Bio Inc., Kusatsu, Japan), 1X Takara PCR Buffer with 2.5 mM (final concentration) of MgCl2, 2.0 mM Takara dNTP mixture (0.5 mM each), 1 μM each of the forward and reverse primers, and approximately 50 ng of template. .. PCR products were separated on a 2% Agarose gel in 0.75% Tris-Acetate EDTA run at 80 V for 12 h. Three lanes of a one kb DNA ladder (Genlantis, San Diego, CA, USA) were included to allow for standardization of molecular weight assignments to DNA fragments.

    Magnetic Cell Separation:

    Article Title: Suppression of Matrix Metalloproteinase Production in Nasal Fibroblasts by Tranilast, an Antiallergic Agent, In Vitro
    Article Snippet: Assay for mRNA expression mRNA was extracted from NF using μ MACS mRNA isolation kits (Miltenyi Biotec GmbH, Bergisch Gladbach, Germany), according to the manufacturer's instructions. .. The polymerase chain reaction (PCR) mixture consisted of 1.0 μ L of sample cDNA solution, 3.3 μ L of 10 × PCR buffer (Takara Shuzo Co Ltd, Shiga, Japan), 2.6 μ L of dNTP mixture (Takara Shuzo), 1.0 μ L of both sense and antisense primers, 0.2 μ L of Taq DNA polymerase (Takara Shuzo), and distilled water to produce a final volume of 30 μ L. The primers used for RT-PCR were 5′−AGATCTTCTTCTTCAAGGACCGGTT-3′ (sense) and 5′−GGCTGGTCAGTGGCTTGGGGTA-3′ (antisense) for MMP-2, 5′−CCCACATTTGACGTCCAGAGAAGAA-3′ (sense) and 5′−GTTTTTGATGCTATTGGCTGAGATCCA-3′ (antisense) for MMP-9, 5′−CTCGCTGGACGTTGGAGGAAAGAA-3′ (sense) and 5′−AGCCCATCTGGTACCTGTGGTTCA-3′ (antisense) for TIMP-2, and 5′−CGGAACCGCTCATTGCC-3′ and 5′−ACCCACACTGTGCCCATCTA-3′ for β −actin [ ].

    CTG Assay:

    Article Title: Caspase-3 knockout inhibits intervertebral disc degeneration related to injury but accelerates degeneration related to aging
    Article Snippet: Mouse genotyping For genotyping, the tip of the tail was cut and incubated in 50 µl Tris-acetate-ethylenediamine-tetraacetic acid buffer (Kanto Chemical Company Incorporated, Tokyo, Japan) at 95 °C for 5 min, then incubated in 1.5 µl Proteinase K from Tritirachium (Sigma-Aldrich, St. Louis, MO, USA) at 60 °C for 60 min and 100 °C for 5–10 min. Casp-3 KO mice were genotyped by standard polymerase chain reaction (PCR) using 1 µl tail lysate, Takara Ex Taq (Takara Bio, Shiga, Japan), 10X Ex Taq Buffer (Takara Bio), and dNTP Mixture (Takara Bio), according to the manufacturer’s instructions. .. Primers for Casp-3 KO mice (sequences: 5′-GCG AGT GAG AAT GTG CAT AAA TTC-3′, 5′-GGG AAA CCA ACA GTA GTC AGT CCT-3′, and 5′-TGC TAA AGC GCA TGC TCC AGA CTG-3′) were synthesized by Takara Bio and diluted in MilliQ water to 0.2 µM.

    Lysis:

    Article Title: Airway Microbiota and Pathogen Abundance in Age-Stratified Cystic Fibrosis Patients
    Article Snippet: Deep-throat swabs were added to lysis buffer from the AllPrep DNA/RNA extraction kit (Qiagen, CA) in a lysing matrix B tube (Qbiogene, CA) and lysed by bead-beating using a FastPrep system (Qbiogene, CA) for 30 seconds at 5.5 m sec−1 . .. PCR reactions contained 0.02 Uµl−1 Takara Ex Taq DNA Polymerase (Takara Bio Inc Japan), 1× Takara buffer, 0.8 mM Takara dNTP mixture, 0.4 mg ml−1 bovine serum albumin (BSA) and 1.0 µM of each primer.

    Variant Assay:

    Article Title: Down-regulation of granulocyte-macrophage colony-stimulating factor by 3C-like proteinase in transfected A549 human lung carcinoma cells
    Article Snippet: This plasmid contains the EGFP variant and neomycin resistant genes under the control of the cytomegalovirus early gene promoter and the SV40 early gene promoter, respectively. .. The PCR was performed with reagents containing a 0.2 μM primers mixture, 1.25 μM dNTP mixture, 1.5 μM MgCl2 , 10 ng templates, and 2.5 U DNA polymerase (Takara, Tokyo, Japan).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa dntp mixture
    Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 1627 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp mixture/product/TaKaRa
    Average 90 stars, based on 1627 article reviews
    Price from $9.99 to $1999.99
    dntp mixture - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    Image Search Results