dntpack kit  (Roche)


Bioz Verified Symbol Roche is a verified supplier
Bioz Manufacturer Symbol Roche manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Roche dntpack kit
    Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dntpack kit - by Bioz Stars, 2021-07
    86/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region
    Article Snippet: cDNA synthesis and amplification by PCR for ultra-deep sequencing To perform ultra-deep sequencing of the MGB probe region in HCV NS5B, we used the HPLC-purified specific primers shown in . cDNA was synthesized with R56_1 (antisense) for 1 cycle at 55°C for 30 min and 85°C for 5 min using a Transcript high-fidelity cDNA synthesis kit (Roche, Tokyo, Japan). .. Then amplification was performed with Pr1 (sense) and R56_1 (antisense) for 35 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 60 sec using a FastStart high-fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with two inner primer sets using the FastStart high-fidelity PCR system, dNTPack kit (Roche).

    Article Title: Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5 '-Untranslated Region among Cases of the Same Outbreak from a Single Source
    Article Snippet: For the detection of HAV RNA, two sets of amplification primers were made at the position of 5'UTR based on HAV HM175 (M59810) sequences. .. Complementary DNA was synthesized with primer 1 (5'-AGTACCTCAGAGGCAAACAC-3') for 1 cycle at 55o C for 30 min and at 85o C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Indianapolis, IN, USA), then amplified with primer 1 and primer 2 (5'-TCTTGGAAGTCCATGGTGAG-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec using a FastStart high fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with primers 3 (5'-CCACATAAGGCCCCAAAGAA-3') and 4 (5'- GGGACTTGATACCTCACCGC-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec. Amplified products were separated by agarose gel electrophoresis and purified using a High pure PCR clean-up micro kit (Roche).

    Article Title: Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region
    Article Snippet: Then amplification was performed with Pr1 (sense) and R56_1 (antisense) for 35 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 60 sec using a FastStart high-fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with two inner primer sets using the FastStart high-fidelity PCR system, dNTPack kit (Roche). ..

    Article Title: Phosphorylation Regulates FOXC2-Mediated Transcription in Lymphatic Endothelial Cells
    Article Snippet: Reverse transcriptase reaction was performed using the Transcriptor first-strand cDNA synthesis kit (Roche Diagnostics) with random hexamer primers. .. The resulting cDNA was amplified by PCR using a FastStart Taq DNA polymerase and dNTPack kit (Roche Diagnostics). .. The primer sequences are available upon request.

    Article Title: Beside P53 and PTEN: Identification of molecular alterations of the RAS/MAPK and PI3K/AKT signaling pathways in high-grade serous ovarian carcinomas to determine potential novel therapeutic targets
    Article Snippet: NGS was performed using ultra-deep biparallel pyrosequencing (GS Junior; Roche Diagnostics) to confirm and identify the somatic alterations detected by HRM-PCR and to further investigate PIK3CA , exon 5, and MET , exons 14, 16, 17, 18 and 19. .. Firstly, for the library preparation, sequences of interest were amplified by TAG-PCR and MID-PCR using FastStart High Fidelity PCR System, dNTPack kit (Roche Diagnostics). .. The procedure was performed using Nexus Mastercycler® (Eppendorf AG, Hamburg, Germany).

    Size-exclusion Chromatography:

    Article Title: Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region
    Article Snippet: cDNA synthesis and amplification by PCR for ultra-deep sequencing To perform ultra-deep sequencing of the MGB probe region in HCV NS5B, we used the HPLC-purified specific primers shown in . cDNA was synthesized with R56_1 (antisense) for 1 cycle at 55°C for 30 min and 85°C for 5 min using a Transcript high-fidelity cDNA synthesis kit (Roche, Tokyo, Japan). .. Then amplification was performed with Pr1 (sense) and R56_1 (antisense) for 35 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 60 sec using a FastStart high-fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with two inner primer sets using the FastStart high-fidelity PCR system, dNTPack kit (Roche).

    Article Title: Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5 '-Untranslated Region among Cases of the Same Outbreak from a Single Source
    Article Snippet: For the detection of HAV RNA, two sets of amplification primers were made at the position of 5'UTR based on HAV HM175 (M59810) sequences. .. Complementary DNA was synthesized with primer 1 (5'-AGTACCTCAGAGGCAAACAC-3') for 1 cycle at 55o C for 30 min and at 85o C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Indianapolis, IN, USA), then amplified with primer 1 and primer 2 (5'-TCTTGGAAGTCCATGGTGAG-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec using a FastStart high fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with primers 3 (5'-CCACATAAGGCCCCAAAGAA-3') and 4 (5'- GGGACTTGATACCTCACCGC-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec. Amplified products were separated by agarose gel electrophoresis and purified using a High pure PCR clean-up micro kit (Roche).

    Polymerase Chain Reaction:

    Article Title: Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region
    Article Snippet: cDNA synthesis and amplification by PCR for ultra-deep sequencing To perform ultra-deep sequencing of the MGB probe region in HCV NS5B, we used the HPLC-purified specific primers shown in . cDNA was synthesized with R56_1 (antisense) for 1 cycle at 55°C for 30 min and 85°C for 5 min using a Transcript high-fidelity cDNA synthesis kit (Roche, Tokyo, Japan). .. Then amplification was performed with Pr1 (sense) and R56_1 (antisense) for 35 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 60 sec using a FastStart high-fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with two inner primer sets using the FastStart high-fidelity PCR system, dNTPack kit (Roche).

    Article Title: Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5 '-Untranslated Region among Cases of the Same Outbreak from a Single Source
    Article Snippet: For the detection of HAV RNA, two sets of amplification primers were made at the position of 5'UTR based on HAV HM175 (M59810) sequences. .. Complementary DNA was synthesized with primer 1 (5'-AGTACCTCAGAGGCAAACAC-3') for 1 cycle at 55o C for 30 min and at 85o C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Indianapolis, IN, USA), then amplified with primer 1 and primer 2 (5'-TCTTGGAAGTCCATGGTGAG-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec using a FastStart high fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with primers 3 (5'-CCACATAAGGCCCCAAAGAA-3') and 4 (5'- GGGACTTGATACCTCACCGC-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec. Amplified products were separated by agarose gel electrophoresis and purified using a High pure PCR clean-up micro kit (Roche).

    Article Title: Prevalence of Hepatitis C Virus Subgenotypes 1a and 1b in Japanese Patients: Ultra-Deep Sequencing Analysis of HCV NS5B Genotype-Specific Region
    Article Snippet: Then amplification was performed with Pr1 (sense) and R56_1 (antisense) for 35 cycles at 95°C for 30 sec, 55°C for 30 sec, and 72°C for 60 sec using a FastStart high-fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with two inner primer sets using the FastStart high-fidelity PCR system, dNTPack kit (Roche). ..

    Article Title: Phosphorylation Regulates FOXC2-Mediated Transcription in Lymphatic Endothelial Cells
    Article Snippet: Reverse transcriptase reaction was performed using the Transcriptor first-strand cDNA synthesis kit (Roche Diagnostics) with random hexamer primers. .. The resulting cDNA was amplified by PCR using a FastStart Taq DNA polymerase and dNTPack kit (Roche Diagnostics). .. The primer sequences are available upon request.

    Article Title: Beside P53 and PTEN: Identification of molecular alterations of the RAS/MAPK and PI3K/AKT signaling pathways in high-grade serous ovarian carcinomas to determine potential novel therapeutic targets
    Article Snippet: NGS was performed using ultra-deep biparallel pyrosequencing (GS Junior; Roche Diagnostics) to confirm and identify the somatic alterations detected by HRM-PCR and to further investigate PIK3CA , exon 5, and MET , exons 14, 16, 17, 18 and 19. .. Firstly, for the library preparation, sequences of interest were amplified by TAG-PCR and MID-PCR using FastStart High Fidelity PCR System, dNTPack kit (Roche Diagnostics). .. The procedure was performed using Nexus Mastercycler® (Eppendorf AG, Hamburg, Germany).

    Synthesized:

    Article Title: Ultra-Deep Sequencing Analysis of the Hepatitis A Virus 5 '-Untranslated Region among Cases of the Same Outbreak from a Single Source
    Article Snippet: For the detection of HAV RNA, two sets of amplification primers were made at the position of 5'UTR based on HAV HM175 (M59810) sequences. .. Complementary DNA was synthesized with primer 1 (5'-AGTACCTCAGAGGCAAACAC-3') for 1 cycle at 55o C for 30 min and at 85o C for 5 min using a Transcriptor High Fidelity cDNA Synthesis Kit (Roche, Indianapolis, IN, USA), then amplified with primer 1 and primer 2 (5'-TCTTGGAAGTCCATGGTGAG-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec using a FastStart high fidelity PCR system, dNTPack kit (Roche). .. Then, the first PCR product was further amplified with primers 3 (5'-CCACATAAGGCCCCAAAGAA-3') and 4 (5'- GGGACTTGATACCTCACCGC-3') for 35 cycles at 95o C for 30 sec, 55o C for 30 sec, and 72o C for 60 sec. Amplified products were separated by agarose gel electrophoresis and purified using a High pure PCR clean-up micro kit (Roche).

    Article Title: Multiple Sodium Channel Variants in the Mosquito Culex quinquefasciatus
    Article Snippet: Messenger RNAs (mRNAs) were isolated using Oligotex-dT suspension (QIAGEN). .. The full length cDNA of the Cx. quinquefasciatus sodium channel gene was subsequently isolated from each of the mosquitoes populations by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16 (TGTTGGCCATATAGACAATGACCGA) /KDR AS09 (GCTTCTGAATCTGAATCAGAGGGAG), synthesized based on the respective 5' and 3' end sequences of the putative sodium channel cDNAs , accession numbers: JN695777, JN695778, and JN695779]. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 8 min, with a final extension of 68°C for 10 min. All PCR products were cloned into PCRTM 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Article Title: Evolutionary Adaptation of the Amino Acid and Codon Usage of the Mosquito Sodium Channel following Insecticide Selection in the Field Mosquitoes
    Article Snippet: The PCR reaction was heated to 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, and 68°C for 4 min with a final extension step at 72°C for 10 min. .. The full length of the Cx. quinquefasciatus sodium channel cDNA was subsequently isolated for each of mosquito strains by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16/KDR AS09 , synthesized based on the respective 5' and 3' end sequences of the putative sodium channel genes. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min and 20 s, with a final extension of 68°C for 10 min. All PCR products were cloned into PCR™ 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Isolation:

    Article Title: Multiple Sodium Channel Variants in the Mosquito Culex quinquefasciatus
    Article Snippet: Messenger RNAs (mRNAs) were isolated using Oligotex-dT suspension (QIAGEN). .. The full length cDNA of the Cx. quinquefasciatus sodium channel gene was subsequently isolated from each of the mosquitoes populations by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16 (TGTTGGCCATATAGACAATGACCGA) /KDR AS09 (GCTTCTGAATCTGAATCAGAGGGAG), synthesized based on the respective 5' and 3' end sequences of the putative sodium channel cDNAs , accession numbers: JN695777, JN695778, and JN695779]. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 8 min, with a final extension of 68°C for 10 min. All PCR products were cloned into PCRTM 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Article Title: Evolutionary Adaptation of the Amino Acid and Codon Usage of the Mosquito Sodium Channel following Insecticide Selection in the Field Mosquitoes
    Article Snippet: The PCR reaction was heated to 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, and 68°C for 4 min with a final extension step at 72°C for 10 min. .. The full length of the Cx. quinquefasciatus sodium channel cDNA was subsequently isolated for each of mosquito strains by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16/KDR AS09 , synthesized based on the respective 5' and 3' end sequences of the putative sodium channel genes. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min and 20 s, with a final extension of 68°C for 10 min. All PCR products were cloned into PCR™ 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Multiple Sodium Channel Variants in the Mosquito Culex quinquefasciatus
    Article Snippet: Messenger RNAs (mRNAs) were isolated using Oligotex-dT suspension (QIAGEN). .. The full length cDNA of the Cx. quinquefasciatus sodium channel gene was subsequently isolated from each of the mosquitoes populations by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16 (TGTTGGCCATATAGACAATGACCGA) /KDR AS09 (GCTTCTGAATCTGAATCAGAGGGAG), synthesized based on the respective 5' and 3' end sequences of the putative sodium channel cDNAs , accession numbers: JN695777, JN695778, and JN695779]. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 8 min, with a final extension of 68°C for 10 min. All PCR products were cloned into PCRTM 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Article Title: Evolutionary Adaptation of the Amino Acid and Codon Usage of the Mosquito Sodium Channel following Insecticide Selection in the Field Mosquitoes
    Article Snippet: The PCR reaction was heated to 95°C for 5 min followed by 35 cycles of 94°C for 1 min, 58°C for 1 min, and 68°C for 4 min with a final extension step at 72°C for 10 min. .. The full length of the Cx. quinquefasciatus sodium channel cDNA was subsequently isolated for each of mosquito strains by RT-PCR using the Expand Long Range, dNTPack kit (Roche) with a specific primer pair, KDR S16/KDR AS09 , synthesized based on the respective 5' and 3' end sequences of the putative sodium channel genes. .. The PCR reaction was conducted following a PCR cycle of 92°C for 2 min, 10 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min, and 35 cycles of 92°C for 10 s, 55°C for 15 s, and 68°C for 6 min and 20 s, with a final extension of 68°C for 10 min. All PCR products were cloned into PCR™ 2.1 Original TA cloning vector (Invitrogen) and sequenced.

    Touchdown PCR:

    Article Title: The Genomic Aftermath of Hybridization in the Opportunistic Pathogen Candida metapsilosis
    Article Snippet: .. Thus, four touchdown PCR reactions (FWD_1+REV_1, FWD_1+REV_2, FWD_2+REV_1 and FWD_2+REV_2) were carried out using Expand Long Range, dNTPack kit (Roche) according to manufacturer’s instructions. .. Briefly, each reaction included primer concentration of 0.3 μM, 10 μl of 5X Buffer with MgCl2 (final MgCl2 concentration of 2.5mM), 2.5 μl of PCR Nucleotide Mix, 3% (v/v) of DMSO, 100 ng of DNA and 3.5 U of Enzyme Mix in a final volume of 50 μl.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Roche expand long range dntpack kit
    Expand Long Range Dntpack Kit, supplied by Roche, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/expand long range dntpack kit/product/Roche
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    expand long range dntpack kit - by Bioz Stars, 2021-07
    86/100 stars
      Buy from Supplier

    Image Search Results