Structured Review

iNtRON Biotechnology dntp
Dntp, supplied by iNtRON Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 20 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/iNtRON Biotechnology
Average 93 stars, based on 20 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-04
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. Clones with > 400 bp inserts were selected for further sequencing.

Amplification:

Article Title: Polymorphisms of the Serotonin Transporter Gene and G-Protein β3 Subunit Gene in Korean Children with Irritable Bowel Syndrome and Functional Dyspepsia
Article Snippet: .. Briefly, the genomic DNA flanking the interested single-nucleotide polymorphism was amplified with polymerase chain reaction (PCR) with Forward and Reverse primer pairs and standard PCR reagents in 10 µL reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 µL 10x PCR buffer, 250 µM dNTP (2.5 mM each) and 0.25 unit i-StarTaq DNA Polymerase (5 unit/µL) (iNtRON Biotechnology, Seongnam, Korea). .. The PCR reactions were carried out as follows: 10 minutes at 95℃ for 1 cycle, and 35 cycles on 95℃ for 30 seconds, 60℃ for 1 minute, 72℃ for 1 minute followed by 1 cycle of 72℃ for 10 minutes.

Article Title: A Model for Prediction of Spontaneous Preterm Birth in Asymptomatic Women
Article Snippet: .. Briefly, the genomic DNA flanking the single nucleotide polymorphism (SNP) of interest was amplified using a PCR reaction with forward and reverse primer pairs and standard PCR reagents in a 10-μL reaction volume containing 10 ng genomic DNA, 0.5 pM each oligonucleotide primer, 1 μL 10X PCR buffer, 250 mM dNTP (2.5 mM each), and 0.25 units i-StarTaq DNA polymerase (5 units/μL) (iNtRON Biotechnology, Sungnam, Gyeonggi-Do, Korea). .. The PCR reactions were carried out as follows: 10 min at 95°C for 1 cycle, 35 cycles at 95°C for 30 s, 60°C for 1 min, 72°C for 1 min, and 1 cycle at 72°C for 10 min. After amplification, the PCR products were treated with 1 unit each of shrimp alkaline phosphatase (SAP) (Roche, Basle, Switzerland) and exonuclease I (USB Corporation, Cleveland, OH) at 37°C for 75 min and 72°C for 15 min to purify the amplified products.

Article Title: The Association Study of Calmodulin 1 Gene Polymorphisms with Susceptibility to Adolescent Idiopathic Scoliosis
Article Snippet: .. Briefly, genomic DNA flanking the SNPs of interest was amplified via polymerase chain reaction (PCR) with forward and reverse primer pairs ( ) and standard PCR reagents in a 10-microliter reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 microliter of 10X PCR buffer, 250 M dNTP (2.5 mM each), and 0.25 units of i-StarTaq DNA Polymerase (5 unit/μ L) (iNtRON Biotechnology, Seongnam, Korea). .. The PCR conditions were as follows: 10 min at 95°C for 1 cycle and 35 cycles at 95°C for 30 s, 60°C for 1 min, 72°C for 1 min, followed by 1 cycle of 72°C for 10 min. After amplification, the PCR products were treated with 1 unit each of shrimp alkaline phosphatase (SAP) (USB Corporation, Cleveland, OH, USA) and exonuclease I (USB Corporation, Cleveland, OH, USA) at 37°C for 75 minutes and 72°C for 15 minutes to purify the amplified products.

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: Amplification products were visualized using the gel system on a LI-COR 4300 sequencer according to the manufacturer’s protocol (LI-COR Biotech, Lincoln, USA). .. The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea).

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: Amplification conditions used an initial DNA Polymerase activation at 95 °C, 10 min, followed by 40 cycles of amplification with denaturing at 95 °C for 15 s, annealing and extension at 60 °C for 1 min using a 7500 Real Time PCR System (Applied Biosystems). .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: From each control individual, a 273-bp fragment containing the transition site was amplified by PCR. .. PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA.

Article Title: Identification of genes inducing resistance to ionizing radiation in human rectal cancer cell lines: re-sensitization of radio-resistant rectal cancer cells through down regulating NDRG1
Article Snippet: .. 1 μl of 100 ng/μl cDNA was amplified in 14 μl of a PCR mixture that contained 1.5 μl of 10 x PCR buffer (with MgCl2 ), 0.5 μl of dNTP, 0.25 μl of forward primer (10 pmol/ul), 0.25 μl reverse primer (10 pmol/ul), 11.42 μl of distilled water, and 0.08 μl of i-Taq DNA polymerase (500 units) (Intron biotechnology, Gyeonggi, Korea). ..

Synthesized:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: .. The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use. .. RT-PCR was performed by co-amplification of the genes with a reference gene by use of the cDNA template and corresponding gene-specific primer sets.

Article Title: Metformin increases chemo-sensitivity via gene downregulation encoding DNA replication proteins in 5-Fu resistant colorectal cancer cells
Article Snippet: Reverse transcriptase (RT) - PCR and real-time quantitative (q) RT-PCR cDNA was synthesized using easy-BLUETM kits (Intron biotechnology, Gyeonggi, Korea) and a Quantitect Reverse transcription kit (Qiagen, Hilden, Germany) according to manufacturer's instructions. .. The PCR mixture contained 1 μl of 100 ng/μl cDNA, 10 × buffer, 2.5 mM of dNTP, 0.1pM of primers and 1 unit of Taq DNA polymerase (Intron biotechnology).

Article Title: Identification of genes inducing resistance to ionizing radiation in human rectal cancer cell lines: re-sensitization of radio-resistant rectal cancer cells through down regulating NDRG1
Article Snippet: Reverse transcriptase-PCR (RT-PCR) Synthesized cDNA was diluted to 100 ng/μl using distilled water. .. 1 μl of 100 ng/μl cDNA was amplified in 14 μl of a PCR mixture that contained 1.5 μl of 10 x PCR buffer (with MgCl2 ), 0.5 μl of dNTP, 0.25 μl of forward primer (10 pmol/ul), 0.25 μl reverse primer (10 pmol/ul), 11.42 μl of distilled water, and 0.08 μl of i-Taq DNA polymerase (500 units) (Intron biotechnology, Gyeonggi, Korea).

Quantitative RT-PCR:

Article Title: Metformin increases chemo-sensitivity via gene downregulation encoding DNA replication proteins in 5-Fu resistant colorectal cancer cells
Article Snippet: The PCR mixture contained 1 μl of 100 ng/μl cDNA, 10 × buffer, 2.5 mM of dNTP, 0.1pM of primers and 1 unit of Taq DNA polymerase (Intron biotechnology). .. The qRT-PCR was performed using 2X SYBR on a 7300 instrument (Applied Biosystems).

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: For quantitative PCR experiments, DhMYB1 RNA was quantified by two-step reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) using the DhMYB1 specific primers (DhMYB F: TGCTGTCGGATAAAGCCAATG and DhMYB R: GGTGGCGGTGAATTTGGA) and β -actin gene primers (β -actin F: TGGGCACCTAAATCTCTCAGC and β -actin R: GTCAGGGACATCAAGGAGAAG) in a 20-μL PCR mixture containing 2 μL of cDNA, 0.5 mM of each primer and Power SYBR® Green PCR Master Mix kit (Applied Biosystems, USA). .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Real-time Polymerase Chain Reaction:

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: Amplification conditions used an initial DNA Polymerase activation at 95 °C, 10 min, followed by 40 cycles of amplification with denaturing at 95 °C for 15 s, annealing and extension at 60 °C for 1 min using a 7500 Real Time PCR System (Applied Biosystems). .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: The real time PCR mixture was composed of 2 × SYBR green premix (TaKaRa Bio.), ROX (TaKaRa Bio.) as a reference dye, and sense and antisense primers (Bioneer). .. To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer).

Primer Extension Assay:

Article Title: Polymorphisms of the Serotonin Transporter Gene and G-Protein β3 Subunit Gene in Korean Children with Irritable Bowel Syndrome and Functional Dyspepsia
Article Snippet: 2) Genotyping for GNβ3 C825T The genotyping was screened using single base primer extension assay using ABI PRISM SNaPShot Multiplex kit (ABI, Foster City, CA, USA) according to manufacturer's recommendation. .. Briefly, the genomic DNA flanking the interested single-nucleotide polymorphism was amplified with polymerase chain reaction (PCR) with Forward and Reverse primer pairs and standard PCR reagents in 10 µL reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 µL 10x PCR buffer, 250 µM dNTP (2.5 mM each) and 0.25 unit i-StarTaq DNA Polymerase (5 unit/µL) (iNtRON Biotechnology, Seongnam, Korea).

Article Title: A Model for Prediction of Spontaneous Preterm Birth in Asymptomatic Women
Article Snippet: The genotyping of the PON1 polymorphsim (rs662) was screened with a single base primer extension assay using an ABI PRISM SNaPShot Multiplex kit (ABI, Foster City, CA) according to the manufacturer's recommendation. .. Briefly, the genomic DNA flanking the single nucleotide polymorphism (SNP) of interest was amplified using a PCR reaction with forward and reverse primer pairs and standard PCR reagents in a 10-μL reaction volume containing 10 ng genomic DNA, 0.5 pM each oligonucleotide primer, 1 μL 10X PCR buffer, 250 mM dNTP (2.5 mM each), and 0.25 units i-StarTaq DNA polymerase (5 units/μL) (iNtRON Biotechnology, Sungnam, Gyeonggi-Do, Korea).

Article Title: The Association Study of Calmodulin 1 Gene Polymorphisms with Susceptibility to Adolescent Idiopathic Scoliosis
Article Snippet: Genotyping Method Genotypes were screened via single base primer extension assay using an ABI PRISM SNaPshot Multiplex kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's recommendations. .. Briefly, genomic DNA flanking the SNPs of interest was amplified via polymerase chain reaction (PCR) with forward and reverse primer pairs ( ) and standard PCR reagents in a 10-microliter reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 microliter of 10X PCR buffer, 250 M dNTP (2.5 mM each), and 0.25 units of i-StarTaq DNA Polymerase (5 unit/μ L) (iNtRON Biotechnology, Seongnam, Korea).

Incubation:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: .. The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use. .. RT-PCR was performed by co-amplification of the genes with a reference gene by use of the cDNA template and corresponding gene-specific primer sets.

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea). .. In both amplifications, samples were incubated in the MyCycler thermal cycler (Bio-Rad, Hercules, USA) under the following conditions: initial denaturing step at 95°C for 5 min, annealing at 58°C for 2 min and extension at 72°C for 2 min, followed by 24 cycles of denaturing for 1 min at 94°C, annealing for 2 min at 58°C and extension for 2 min at 72°C, followed by a final annealing at 58°C for 2 min and a final extension at 72°C for 5 min.

Expressing:

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: Paragraph title: Analysis of DhMYB1 gene expression ... Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Concentration Assay:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: .. The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use. .. RT-PCR was performed by co-amplification of the genes with a reference gene by use of the cDNA template and corresponding gene-specific primer sets.

Mutagenesis:

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: Paragraph title: Mutation analysis ... PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA.

Polymerase Chain Reaction:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use. .. PCR was conducted out in a total volume of 25 μl containing 5 μl of cDNA solution, 25 μM of sense primers, and 25 μM of antisense primers, 1X PCR buffer, 2.5 mM MgCl2 and 2.5 unit Taq DNA polymerase (Takara Korea, Seoul, Korea).

Article Title: Polymorphisms of the Serotonin Transporter Gene and G-Protein β3 Subunit Gene in Korean Children with Irritable Bowel Syndrome and Functional Dyspepsia
Article Snippet: .. Briefly, the genomic DNA flanking the interested single-nucleotide polymorphism was amplified with polymerase chain reaction (PCR) with Forward and Reverse primer pairs and standard PCR reagents in 10 µL reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 µL 10x PCR buffer, 250 µM dNTP (2.5 mM each) and 0.25 unit i-StarTaq DNA Polymerase (5 unit/µL) (iNtRON Biotechnology, Seongnam, Korea). .. The PCR reactions were carried out as follows: 10 minutes at 95℃ for 1 cycle, and 35 cycles on 95℃ for 30 seconds, 60℃ for 1 minute, 72℃ for 1 minute followed by 1 cycle of 72℃ for 10 minutes.

Article Title: Metformin increases chemo-sensitivity via gene downregulation encoding DNA replication proteins in 5-Fu resistant colorectal cancer cells
Article Snippet: .. The PCR mixture contained 1 μl of 100 ng/μl cDNA, 10 × buffer, 2.5 mM of dNTP, 0.1pM of primers and 1 unit of Taq DNA polymerase (Intron biotechnology). .. PCR was performed on a thermal cycler (PCR System 9700, Applied Biosystems; CA, USA).

Article Title: A Model for Prediction of Spontaneous Preterm Birth in Asymptomatic Women
Article Snippet: .. Briefly, the genomic DNA flanking the single nucleotide polymorphism (SNP) of interest was amplified using a PCR reaction with forward and reverse primer pairs and standard PCR reagents in a 10-μL reaction volume containing 10 ng genomic DNA, 0.5 pM each oligonucleotide primer, 1 μL 10X PCR buffer, 250 mM dNTP (2.5 mM each), and 0.25 units i-StarTaq DNA polymerase (5 units/μL) (iNtRON Biotechnology, Sungnam, Gyeonggi-Do, Korea). .. The PCR reactions were carried out as follows: 10 min at 95°C for 1 cycle, 35 cycles at 95°C for 30 s, 60°C for 1 min, 72°C for 1 min, and 1 cycle at 72°C for 10 min. After amplification, the PCR products were treated with 1 unit each of shrimp alkaline phosphatase (SAP) (Roche, Basle, Switzerland) and exonuclease I (USB Corporation, Cleveland, OH) at 37°C for 75 min and 72°C for 15 min to purify the amplified products.

Article Title: The Association Study of Calmodulin 1 Gene Polymorphisms with Susceptibility to Adolescent Idiopathic Scoliosis
Article Snippet: .. Briefly, genomic DNA flanking the SNPs of interest was amplified via polymerase chain reaction (PCR) with forward and reverse primer pairs ( ) and standard PCR reagents in a 10-microliter reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 microliter of 10X PCR buffer, 250 M dNTP (2.5 mM each), and 0.25 units of i-StarTaq DNA Polymerase (5 unit/μ L) (iNtRON Biotechnology, Seongnam, Korea). .. The PCR conditions were as follows: 10 min at 95°C for 1 cycle and 35 cycles at 95°C for 30 s, 60°C for 1 min, 72°C for 1 min, followed by 1 cycle of 72°C for 10 min. After amplification, the PCR products were treated with 1 unit each of shrimp alkaline phosphatase (SAP) (USB Corporation, Cleveland, OH, USA) and exonuclease I (USB Corporation, Cleveland, OH, USA) at 37°C for 75 minutes and 72°C for 15 minutes to purify the amplified products.

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: .. Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. PCR was carried out in a thermocycler consisting of predenaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 1 min and extension at 72°C for 3 min.

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: .. The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea). .. DNA was amplified using the following protocol: pre-denaturation at 95°C for 5 min; then 20 cycles of denaturation at 95°C for 30 s, then primer annealing at 56°C for 30 s, extension at 72°C for 1 min, and final extension at 72°C for 5 min to ensure complete extension of the PCR products.

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea). .. The amplified products were separated on 1.5 % (w/v) agarose gel, followed by image capture and band intensity analysis using AlphaImager HP (AlphaInnotech, USA) with AlphaInotech – Alphaview analysis software. β-actin was used as reference gene for relative quantification (using the primers as mentioned above).

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: .. PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA. .. The PCR products were electrophoresed on 1.8% agarose gel, and the amplified genomic DNA fragments were extracted from the gel and then purified using the method described by the manufacturer's recommended protocol (QIAquick® gel extraction kit; Quiagen, Hilden, Germany).

Article Title: Identification of genes inducing resistance to ionizing radiation in human rectal cancer cell lines: re-sensitization of radio-resistant rectal cancer cells through down regulating NDRG1
Article Snippet: .. 1 μl of 100 ng/μl cDNA was amplified in 14 μl of a PCR mixture that contained 1.5 μl of 10 x PCR buffer (with MgCl2 ), 0.5 μl of dNTP, 0.25 μl of forward primer (10 pmol/ul), 0.25 μl reverse primer (10 pmol/ul), 11.42 μl of distilled water, and 0.08 μl of i-Taq DNA polymerase (500 units) (Intron biotechnology, Gyeonggi, Korea). ..

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: .. To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer). .. The PCR program consisted of 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide (EtBr; Sigma-Aldrich Co.) and analyzed using Gel Doc 2000 (BioRad Laboratories Inc., Hercules, CA, USA).

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: .. Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea). .. Secondary PCR was performed in 25 µL reaction mixture containing 3 µL of DNA template and the same concentrations as the primary PCR.

Sequencing:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. Clones with > 400 bp inserts were selected for further sequencing.

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: SDS 1.3.1 (Sequence Detection Software) was used to create a relative quantification (ddCt) plate and the dissociation curves. β -actin was used as the endogenous reference for the normalization of the expression levels of the target CP gene [ ] and the non-treated control sample was used as the calibrator. .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Molecular Weight:

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: Fluorescently-labeled DNA (50–700 bp; 50–700 sizing standard LI-COR) served as molecular weight markers. .. The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea).

DNA Extraction:

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Paragraph title: DNA Extraction and Molecular Analysis ... Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea).

Nucleic Acid Electrophoresis:

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea). .. Amplicons were analyzed via gel electrophoresis with a 1.0% agarose gel.

In Vivo:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: The lambda library was converted to the pBluescript library by in vivo excision. .. Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology).

Multiple Displacement Amplification:

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: .. To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer). .. The PCR program consisted of 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide (EtBr; Sigma-Aldrich Co.) and analyzed using Gel Doc 2000 (BioRad Laboratories Inc., Hercules, CA, USA).

Isolation:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: Total RNA was isolated using Trizol reagent (iNtRON Biotechnology). .. The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use.

RNA Extraction:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: Paragraph title: RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR) ... The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use.

Purification:

Article Title: Polymorphisms of the Serotonin Transporter Gene and G-Protein β3 Subunit Gene in Korean Children with Irritable Bowel Syndrome and Functional Dyspepsia
Article Snippet: Briefly, the genomic DNA flanking the interested single-nucleotide polymorphism was amplified with polymerase chain reaction (PCR) with Forward and Reverse primer pairs and standard PCR reagents in 10 µL reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 µL 10x PCR buffer, 250 µM dNTP (2.5 mM each) and 0.25 unit i-StarTaq DNA Polymerase (5 unit/µL) (iNtRON Biotechnology, Seongnam, Korea). .. One microliter of the purified amplification products were added to a SNaPshot Multiplex Ready reaction mixture containing 0.15 pmols of genotyping primer for primer extension reaction.

Article Title: A Model for Prediction of Spontaneous Preterm Birth in Asymptomatic Women
Article Snippet: Briefly, the genomic DNA flanking the single nucleotide polymorphism (SNP) of interest was amplified using a PCR reaction with forward and reverse primer pairs and standard PCR reagents in a 10-μL reaction volume containing 10 ng genomic DNA, 0.5 pM each oligonucleotide primer, 1 μL 10X PCR buffer, 250 mM dNTP (2.5 mM each), and 0.25 units i-StarTaq DNA polymerase (5 units/μL) (iNtRON Biotechnology, Sungnam, Gyeonggi-Do, Korea). .. The purified amplification products (1μL) were added to a SNaPshot Multiplex Ready reaction mixture containing 0.15 pmol genotyping primer for the primer extension reaction.

Article Title: The Association Study of Calmodulin 1 Gene Polymorphisms with Susceptibility to Adolescent Idiopathic Scoliosis
Article Snippet: Briefly, genomic DNA flanking the SNPs of interest was amplified via polymerase chain reaction (PCR) with forward and reverse primer pairs ( ) and standard PCR reagents in a 10-microliter reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 microliter of 10X PCR buffer, 250 M dNTP (2.5 mM each), and 0.25 units of i-StarTaq DNA Polymerase (5 unit/μ L) (iNtRON Biotechnology, Seongnam, Korea). .. One microliter of the purified amplification products was added to a SNaPshot Multiplex Ready reaction mixture containing 0.15 pmols of genotyping primer for primer extension reaction.

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA. .. The PCR products were electrophoresed on 1.8% agarose gel, and the amplified genomic DNA fragments were extracted from the gel and then purified using the method described by the manufacturer's recommended protocol (QIAquick® gel extraction kit; Quiagen, Hilden, Germany).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Induction of caspase-dependent extrinsic apoptosis by apigenin through inhibition of signal transducer and activator of transcription 3 (STAT3) signalling in HER2-overexpressing BT-474 breast cancer cells
Article Snippet: Paragraph title: RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR) ... The RNA concentration was determined by measuring the absorbance at 260 nm using a nanodrop, and the ratio of absorbance at 260 and 280 nm was 1.8 or higher. cDNA was synthesized from 2 μg of total RNA as a template in 20 μl reaction mixture containing 5X first strand buffer, 0.1 M DTT, 10 mM dNTP and 200 unit M-MLV reverse transcriptase (iNtRON biotechnology). cDNA was incubated at 42°C for 1 h and inactivated at 95°C for 5 min. After inactivation, the cDNA was stored at -20°C until use.

Article Title: Metformin increases chemo-sensitivity via gene downregulation encoding DNA replication proteins in 5-Fu resistant colorectal cancer cells
Article Snippet: Paragraph title: Reverse transcriptase (RT) - PCR and real-time quantitative (q) RT-PCR ... The PCR mixture contained 1 μl of 100 ng/μl cDNA, 10 × buffer, 2.5 mM of dNTP, 0.1pM of primers and 1 unit of Taq DNA polymerase (Intron biotechnology).

Article Title: Identification of genes inducing resistance to ionizing radiation in human rectal cancer cell lines: re-sensitization of radio-resistant rectal cancer cells through down regulating NDRG1
Article Snippet: Paragraph title: Reverse transcriptase-PCR (RT-PCR) ... 1 μl of 100 ng/μl cDNA was amplified in 14 μl of a PCR mixture that contained 1.5 μl of 10 x PCR buffer (with MgCl2 ), 0.5 μl of dNTP, 0.25 μl of forward primer (10 pmol/ul), 0.25 μl reverse primer (10 pmol/ul), 11.42 μl of distilled water, and 0.08 μl of i-Taq DNA polymerase (500 units) (Intron biotechnology, Gyeonggi, Korea).

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: Paragraph title: Real-time and reverse transcription (RT)-PCR ... To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer).

Blocking Assay:

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Allelic families of Pfmsp1 (block 2) and Pfmsp2 (block 3) were analysed using nested PCR assays as published previously . .. Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea).

Staining:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. The colony PCR products were size-fractionated on 1.5% agarose gel and visualized after ethidium bromide staining.

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea). .. DNA fragments were visualized by ethidium bromide staining under UV light.

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea). .. The PCR products were subjected to electrophoresis in 2% agarose gels and stained with Syber green.

Nested PCR:

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Allelic families of Pfmsp1 (block 2) and Pfmsp2 (block 3) were analysed using nested PCR assays as published previously . .. Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea).

Chloramphenicol Acetyltransferase Assay:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: .. Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. PCR was carried out in a thermocycler consisting of predenaturation at 94°C for 5 min followed by 35 cycles of denaturation at 94°C for 30 s, annealing at 58°C for 1 min and extension at 72°C for 3 min.

Software:

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: SDS 1.3.1 (Sequence Detection Software) was used to create a relative quantification (ddCt) plate and the dissociation curves. β -actin was used as the endogenous reference for the normalization of the expression levels of the target CP gene [ ] and the non-treated control sample was used as the calibrator. .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

SYBR Green Assay:

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: For quantitative PCR experiments, DhMYB1 RNA was quantified by two-step reverse transcription-quantitative real-time polymerase chain reaction (RT-qPCR) using the DhMYB1 specific primers (DhMYB F: TGCTGTCGGATAAAGCCAATG and DhMYB R: GGTGGCGGTGAATTTGGA) and β -actin gene primers (β -actin F: TGGGCACCTAAATCTCTCAGC and β -actin R: GTCAGGGACATCAAGGAGAAG) in a 20-μL PCR mixture containing 2 μL of cDNA, 0.5 mM of each primer and Power SYBR® Green PCR Master Mix kit (Applied Biosystems, USA). .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: The real time PCR mixture was composed of 2 × SYBR green premix (TaKaRa Bio.), ROX (TaKaRa Bio.) as a reference dye, and sense and antisense primers (Bioneer). .. To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer).

Multiplex Assay:

Article Title: Polymorphisms of the Serotonin Transporter Gene and G-Protein β3 Subunit Gene in Korean Children with Irritable Bowel Syndrome and Functional Dyspepsia
Article Snippet: 2) Genotyping for GNβ3 C825T The genotyping was screened using single base primer extension assay using ABI PRISM SNaPShot Multiplex kit (ABI, Foster City, CA, USA) according to manufacturer's recommendation. .. Briefly, the genomic DNA flanking the interested single-nucleotide polymorphism was amplified with polymerase chain reaction (PCR) with Forward and Reverse primer pairs and standard PCR reagents in 10 µL reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 µL 10x PCR buffer, 250 µM dNTP (2.5 mM each) and 0.25 unit i-StarTaq DNA Polymerase (5 unit/µL) (iNtRON Biotechnology, Seongnam, Korea).

Article Title: A Model for Prediction of Spontaneous Preterm Birth in Asymptomatic Women
Article Snippet: The genotyping of the PON1 polymorphsim (rs662) was screened with a single base primer extension assay using an ABI PRISM SNaPShot Multiplex kit (ABI, Foster City, CA) according to the manufacturer's recommendation. .. Briefly, the genomic DNA flanking the single nucleotide polymorphism (SNP) of interest was amplified using a PCR reaction with forward and reverse primer pairs and standard PCR reagents in a 10-μL reaction volume containing 10 ng genomic DNA, 0.5 pM each oligonucleotide primer, 1 μL 10X PCR buffer, 250 mM dNTP (2.5 mM each), and 0.25 units i-StarTaq DNA polymerase (5 units/μL) (iNtRON Biotechnology, Sungnam, Gyeonggi-Do, Korea).

Article Title: The Association Study of Calmodulin 1 Gene Polymorphisms with Susceptibility to Adolescent Idiopathic Scoliosis
Article Snippet: Genotyping Method Genotypes were screened via single base primer extension assay using an ABI PRISM SNaPshot Multiplex kit (Applied Biosystems, Foster City, CA, USA) according to the manufacturer's recommendations. .. Briefly, genomic DNA flanking the SNPs of interest was amplified via polymerase chain reaction (PCR) with forward and reverse primer pairs ( ) and standard PCR reagents in a 10-microliter reaction volume, containing 10 ng of genomic DNA, 0.5 pM of each oligonucleotide primer, 1 microliter of 10X PCR buffer, 250 M dNTP (2.5 mM each), and 0.25 units of i-StarTaq DNA Polymerase (5 unit/μ L) (iNtRON Biotechnology, Seongnam, Korea).

Agarose Gel Electrophoresis:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology). .. The colony PCR products were size-fractionated on 1.5% agarose gel and visualized after ethidium bromide staining.

Article Title: Construction of genetic linkage map and identification of QTLs related to agronomic traits in maize using DNA transposon-based markers
Article Snippet: The PCR mixture (20 μl) contained 20 ng of template DNA, 10× PCR buffer, 0.2 mM of each dNTP, 0.5 μm of the forward and reverse primers, and 0.025 U of i-Star Taq DNA polymerase (Intron Biotechnology, Korea). .. Amplicons were analyzed via gel electrophoresis with a 1.0% agarose gel.

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea). .. The amplified products were separated on 1.5 % (w/v) agarose gel, followed by image capture and band intensity analysis using AlphaImager HP (AlphaInnotech, USA) with AlphaInotech – Alphaview analysis software. β-actin was used as reference gene for relative quantification (using the primers as mentioned above).

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA. .. The PCR products were electrophoresed on 1.8% agarose gel, and the amplified genomic DNA fragments were extracted from the gel and then purified using the method described by the manufacturer's recommended protocol (QIAquick® gel extraction kit; Quiagen, Hilden, Germany).

Article Title: Identification of genes inducing resistance to ionizing radiation in human rectal cancer cell lines: re-sensitization of radio-resistant rectal cancer cells through down regulating NDRG1
Article Snippet: 1 μl of 100 ng/μl cDNA was amplified in 14 μl of a PCR mixture that contained 1.5 μl of 10 x PCR buffer (with MgCl2 ), 0.5 μl of dNTP, 0.25 μl of forward primer (10 pmol/ul), 0.25 μl reverse primer (10 pmol/ul), 11.42 μl of distilled water, and 0.08 μl of i-Taq DNA polymerase (500 units) (Intron biotechnology, Gyeonggi, Korea). .. RT-PCR was performed using a programmable thermal cycler (PCR System 9700, Applied Biosystems; Foster City, CA, USA) and the RT-PCR products were fractionated on a 1.5% agarose gel containing ethidium bromide (EtBr).

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer). .. The PCR program consisted of 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide (EtBr; Sigma-Aldrich Co.) and analyzed using Gel Doc 2000 (BioRad Laboratories Inc., Hercules, CA, USA).

Electrophoresis:

Article Title: Synergistic effect of therapeutic stem cells expressing cytosine deaminase and interferon-beta via apoptotic pathway in the metastatic mouse model of breast cancer
Article Snippet: To analyze the mRNA levels of VEGFR2 or BAX/Bcl-2 genes in the MDA-BD-231 cells following KRN633 or 5-FU (Sigma-Aldrich Co.) treatment, PCR was performed using cDNA template, Taq polymerase (iNtRON Biotechnology), dNTP, 10 × PCR buffer (iNtRON Biotechnology), and specific primer sets (Bioneer). .. The PCR program consisted of 30 cycles of denaturation at 95°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s. PCR products were separated by electrophoresis on 1.5% agarose gel containing ethidium bromide (EtBr; Sigma-Aldrich Co.) and analyzed using Gel Doc 2000 (BioRad Laboratories Inc., Hercules, CA, USA).

Article Title: The Suitability of P. falciparum Merozoite Surface Proteins 1 and 2 as Genetic Markers for In Vivo Drug Trials in Yemen
Article Snippet: Primary PCR was performed in 50 µL reaction mixture containing 5 µL of DNA template, 1X i-Taq™ buffer free of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 1 mM of MgCl2 (iNtRON BIOTECHNOLOGY, Seoul, Korea), 125 µM dNTP (iNtRON BIOTECHNOLOGY, Seoul, Korea), 0.25 µM of each primer and 1.25 U of i-Taq™ DNA polymerase (iNtRON BIOTECHNOLOGY, Seoul, Korea). .. The PCR products were subjected to electrophoresis in 2% agarose gels and stained with Syber green.

Activation Assay:

Article Title: dsRNA silencing of an R2R3-MYB transcription factor affects flower cell shape in a Dendrobium hybrid
Article Snippet: Amplification conditions used an initial DNA Polymerase activation at 95 °C, 10 min, followed by 40 cycles of amplification with denaturing at 95 °C for 15 s, annealing and extension at 60 °C for 1 min using a 7500 Real Time PCR System (Applied Biosystems). .. Semi-quantitative PCR was performed using a 20 μL PCR mixture containing 2 μL of cDNA, 5 pmoles of each primer, 1X PCR buffer, 0.25 mM of each dNTP and 1U of i-Taq DNA polymerase (iNtRON Biotechnology, Inc., Korea).

Construct:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: EST Libraries The testis cDNA library of P. monodon was previously constructed as described in [ ]. .. Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology).

cDNA Library Assay:

Article Title: Identification of testis-relevant genes using in silico analysis from testis ESTs and cDNA microarray in the black tiger shrimp (Penaeus monodon)
Article Snippet: EST Libraries The testis cDNA library of P. monodon was previously constructed as described in [ ]. .. Colony PCR was performed in a 25 μl reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, Enhancer solution, 200 mM of each dNTP, 2 mM MgCl2 , 0.2 μM each of M13-F (5'-ACG TTG TAA AAC GAC GGC CAG-3') and M13-R (5'-ACA GGA AAC AGC TAT GAC CAT G-3'), and 1.25 unit of i-Taq ™DNA Polymerase (iNtRON Biotechnology).

Gel Extraction:

Article Title: The Genotype and Clinical Phenotype of Korean Patients with Familial Hypokalemic Periodic Paralysis
Article Snippet: PCR was performed on 50 µL of standard PCR buffer containing 2 mM MgCl2 , 250 µM of each dNTP, 10 pmole of each primer, 1 unit of i-MAX II Taq polymerase (Intron biotechnology, Seoul, Korea), and 100 ng genomic DNA. .. The PCR products were electrophoresed on 1.8% agarose gel, and the amplified genomic DNA fragments were extracted from the gel and then purified using the method described by the manufacturer's recommended protocol (QIAquick® gel extraction kit; Quiagen, Hilden, Germany).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    iNtRON Biotechnology dntp
    Dntp, supplied by iNtRON Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 51 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/iNtRON Biotechnology
    Average 93 stars, based on 51 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results