dntp  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Qiagen dntp
    Dntp, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 41 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Qiagen
    Average 96 stars, based on 41 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-02
    96/100 stars

    Images

    Related Articles

    Centrifugation:

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: The total RNA fraction was then separated by centrifugation at 12,000 x g for 15 min after adding chloroform. .. One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA).

    Amplification:

    Article Title: Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST]
    Article Snippet: .. Briefly, 50 ng of bisulfite converted DNA was amplified in a 25 µL volume, with 2.5units HotStarTaq DNA Polymerase, 1X Buffer, 200 µM each dNTP (Qiagen GmbH, Crawley, West Sussex, UK), 0.4 µM each methylated primer and 0.8 µM each unmethylated primer. .. PCR products were run on 2.5% agarose gels and post-stained with GelStar Nucleic Acid Stain (Lonza, Muenchensteinerstrasse, Basel, Switzerland).

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Sequence analysis The HIT family protein coding gene of the MS1 strain was amplified by conventional PCR using the primers MS-HL1 ( 5’–ACT GTA AAT GAC GCC TTT TCT AC– 3’ ) and MS-HL2 ( 5’–ACC GCT TAT GCA AGT AAA TTA TT– 3’ ), designed in the present study. .. The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Paragraph title: Development of mismatch amplification mutation assays ... Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: .. The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH). .. PCR was performed with the β-globin-specific primers 5'-ACA CAA CTG TGT TCA CTA GC-3' and 5'-TGG TCT CCT TAA ACC TGT CTT G-3' using a thermal cycler (TaKaRa Biomedicals, Ohtsu, Shiga, Japan) programmed at 95°C for 15 minutes to activate HotStarTaq DNA polymerase followed by 30 cycles at 94°C for 1 minute for denaturation, at 55°C for 2 minutes for annealing, at 72°C for 1 minute for extension, and at 68°C for 7 minutes for final extension [ ].

    Article Title: Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing
    Article Snippet: Qiagen One Step RT-PCR was set up in 10μl reactions containing 0.6μl water, 1.6μl buffer (Qiagen), 1.6μl Q solution (Qiagen), 0.3μl dNTP (Qiagen), 0.3μl enzyme (Qiagen), 0.4μl RNaseOut (Invitrogen), 2.2μl undiluted RNA, and 3μl primers (1.6μM, forward and reverse mixed). .. Amplification was done in 96-well format on an MJ Research DNA Engine Tetrad 2 thermal cycler with the following cycling conditions: 1 cycle of 50°C (30 min); 1 cycle of 95°C (5 min); 35 cycles of 94°C (30 sec), 55°C (30 sec), and 72°C (1 min); 1 cycle of 72°C (10 min); hold at 4°C.

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: PCR amplification cycles were: initial denaturation at 93°C for 3 minutes, thirty-three cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, and hold at 15°C until bead clean up. .. The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up.

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Next, the PCR amplification of Htr2c was performed, with primers designed by PyroMark Assay Design 2.0 and synthesized by the Hua Da Gene Company as shown in Table . .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: Paragraph title: DNA Extraction, Amplification, and Sequencing ... All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega).

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA). .. PCR analyses were conducted using a Light Cycler 1.5 (Roche Applied Science) under the following reaction conditions: initial denaturation at 95ºC for 10 min, then amplification by 40 cycles of: 95ºC for 15 s; 60ºC for 7 s for DcR3 or 58ºC for 7 s for GAPDH; 72ºC for 13 s. GAPDH was used as a reference gene.

    Article Title: Isolation and characterization of native probiotics for fish farming
    Article Snippet: .. Therefore, bacterial DNA was extracted from liquid cultures with peqGOLD Bacterial DNA Mini Kit (PeqLab, Erlangen, Germany) followed by PCR amplification with universal eubacteria primers EUB 1F: 5’-AATTGAAGAGTTTGATCATGGCTCA-3′ and EUB 907R: 5’-CCGTCAATTCCTTTRAGTTT-3′ [ ] in a final volume of 25 μL [1 × Taq buffer, 1 × TaqMaster PCR enhancer, 1.5 U Taq DNA polymerase (all 5 Prime, Hamburg, Germany), 200 μM of each dNTP (Qiagen, Hilden, Germany), 0.17 μM of each primer (TIB Molbiol, Berlin, Germany), 10–20 ng DNA template] in a Eppendorf Mastercycler Ep Gradient cycler [initial denaturation 4 min at 94 °C, followed by 40 cycles denaturation at 94 °C for 1 min, annealing at 59 °C for 1 min, elongation at 72 °C for 1 min and final extension at 68 °C for 7 min]. .. To avoid co-amplification of bacterial DNA contamination in the recombinant Taq polymerase, a DNAse I digestion was carried out prior utilization.

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template. .. The secondary PCR was carried out in a 50-μl volume reaction using 5 μl of the primary PCR product as the template DNA.

    Synthesized:

    Article Title: Cooperative effects in differentiation and proliferation between PDGF-BB and matrix derived synthetic peptides in human osteoblasts
    Article Snippet: .. Starting from 1 μg RNA, 20-μl cDNA was synthesized using Omniscript reverse transcriptase and oligo-dT primer in presence of dNTP (Qiagen, Hilden, Germany). .. Quantitative RT-PCR Quantitative reverse transcriptase polymerase chain reactions (RT-PCR) were performed and monitored using an ABI Prism 7700 Sequence Detection System (Applied Biosystems, Rotkreuz, Switzerland).

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Next, the PCR amplification of Htr2c was performed, with primers designed by PyroMark Assay Design 2.0 and synthesized by the Hua Da Gene Company as shown in Table . .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Mouse Assay:

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Total RNA was extracted from homogenized amygdala of the mice brain using the TRIzol method (Invitrogen, America). .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Construct:

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: The seminested PCR for the SSU rRNA gene was constructed using an internal primer set (forward primer R11, 5′-CATCCGGTCGATCCTGCC-3′; reverse primer R4, 5′-GTCGAACCCTGATTCTCCGCCAGG-3′) and a developed external reverse primer (GiardiaM1R, 5′-TTGGATGTGCGGGCCGTCTCGCA-3′). .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    Electrophoresis:

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. The final elongation step was performed at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group Ltd., Basel, Switzerland) and a 20-bp DNA ladder (O'RangeRuler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Thermocycling parameters for the agarose-MAMA were 94°C for 5 min, followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec with a final elongation step at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group) and a 20-bp DNA ladder (O'Range Ruler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Nested PCR:

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH). .. The amplicon of first PCR (2 μl) was used for second nested PCR with the nested EBNA-1-specific primers ( 5'-CCC GCA GAT GAC CCA GGA GA-3' and 5'-GGG TCC AGG GGC CAT TCC AAA-3' ) with the same PCR program as first PCR.

    Incubation:

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Formalin-fixed Paraffin-Embedded:

    Article Title: Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST]
    Article Snippet: Methylation Specific PCR for 14q32 Bisulfite conversion of 1 µg of genomic DNA (where available) was performed with the EpiTect Bisulfite Kit (Qiagen GmbH, Crawley, West Sussex, UK) following the protocol for formalin-fixed paraffin-embedded samples. .. Briefly, 50 ng of bisulfite converted DNA was amplified in a 25 µL volume, with 2.5units HotStarTaq DNA Polymerase, 1X Buffer, 200 µM each dNTP (Qiagen GmbH, Crawley, West Sussex, UK), 0.4 µM each methylated primer and 0.8 µM each unmethylated primer.

    Mass Spectrometry:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Sequence analysis The HIT family protein coding gene of the MS1 strain was amplified by conventional PCR using the primers MS-HL1 ( 5’–ACT GTA AAT GAC GCC TTT TCT AC– 3’ ) and MS-HL2 ( 5’–ACC GCT TAT GCA AGT AAA TTA TT– 3’ ), designed in the present study. .. The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The MAMAs were designed to be used concurrently with the previously described MS-H1 and MS-H2 melt- and agarose-MAMAs [ ]. .. Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: The Step 1 oligonucleotide primer pair (PCR 1) comprising the forward and reverse HTT CAG target sequences and Illumina Adaptor sequence (in italicized text) was: ms_hd_f TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGAAGGCCTTCGAGTCCC ms_hd_r GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GGCTGAGGAAGCTGAGGA The Step 1 PCR reaction conditions in a total reaction volume of 20 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.25 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 20 ng of genomic DNA. .. The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up.

    Modification:

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: The coding regions of MC1R and ASIP genes were amplified using published primers designed for alpaca ( ; ; see ), whilst for exon 4 the forward primer sequence was modified according to the Arabian Camelus dromedarius reference genome assembly (GenBank accession number GCA_000767585.1) ( ; see ). .. All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega).

    Real-time Polymerase Chain Reaction:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The difference between the Tm and the product size is detectable by fluorescent dye on a real-time PCR platform (melt-MAMA) or by 3% agarose gel electrophoresis (agarose-MAMA), respectively. .. Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Melt-MAMAs were performed on an Applied Biosystems Step-One Plus real-time PCR system with StepOne Softwarev2.2.2. .. Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Melt-MAMAs were carried out on an Applied Biosystems Step-One Plus real-time PCR system with StepOne SoftwareTM v2.2.2 and on Qiagen Rotor-Gene Q real-time PCR system, software version 2.3.1. .. Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Cell Culture:

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: Control fibroblasts were cultured in wells of a 24-well plate pre-coated with collagen in 200 Ml of serum free DMEM for 48 h. The culture media was then collected and soluble DcR-3 levels were measured using the DcR3 ELISA kit (Biolegend). .. One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA).

    Inhibition:

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: An additional replicate (sixth) was included for every sample and seeded with C. muris 18S rRNA plasmid DNA to determine possible sample inhibition. .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    Gel Extraction:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl. .. The amplicons were extracted from the gel using the QIAquick Gel Extraction kit (Qiagen) and submitted for Sanger sequencing on an ABI 3700 DNA Analyzer (Applied Biosystems, Foster City, CA).

    DNA Sequencing:

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: Paragraph title: PCR amplification and DNA sequencing ... The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH).

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: Paragraph title: HTT MiSeq DNA Sequencing ... The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up.

    Sequencing:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Paragraph title: Sequence analysis ... The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl.

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: The Step 1 oligonucleotide primer pair (PCR 1) comprising the forward and reverse HTT CAG target sequences and Illumina Adaptor sequence (in italicized text) was: ms_hd_f TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGATGAAGGCCTTCGAGTCCC ms_hd_r GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG GGCTGAGGAAGCTGAGGA The Step 1 PCR reaction conditions in a total reaction volume of 20 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.25 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 20 ng of genomic DNA. .. The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up.

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: Paragraph title: DNA Extraction, Amplification, and Sequencing ... All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega).

    Article Title: Isolation and characterization of native probiotics for fish farming
    Article Snippet: Identification of bacteria Bacterial isolates were identified by direct sequencing of the partial 16S rRNA gene and BLAST analysis. .. Therefore, bacterial DNA was extracted from liquid cultures with peqGOLD Bacterial DNA Mini Kit (PeqLab, Erlangen, Germany) followed by PCR amplification with universal eubacteria primers EUB 1F: 5’-AATTGAAGAGTTTGATCATGGCTCA-3′ and EUB 907R: 5’-CCGTCAATTCCTTTRAGTTT-3′ [ ] in a final volume of 25 μL [1 × Taq buffer, 1 × TaqMaster PCR enhancer, 1.5 U Taq DNA polymerase (all 5 Prime, Hamburg, Germany), 200 μM of each dNTP (Qiagen, Hilden, Germany), 0.17 μM of each primer (TIB Molbiol, Berlin, Germany), 10–20 ng DNA template] in a Eppendorf Mastercycler Ep Gradient cycler [initial denaturation 4 min at 94 °C, followed by 40 cycles denaturation at 94 °C for 1 min, annealing at 59 °C for 1 min, elongation at 72 °C for 1 min and final extension at 68 °C for 7 min].

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template. .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen) and sequenced using an ABI dye terminator cycle sequencing kit (Applied Biosystems, Canada) according to the manufacturer's instructions.

    Recombinant:

    Article Title: Isolation and characterization of native probiotics for fish farming
    Article Snippet: Therefore, bacterial DNA was extracted from liquid cultures with peqGOLD Bacterial DNA Mini Kit (PeqLab, Erlangen, Germany) followed by PCR amplification with universal eubacteria primers EUB 1F: 5’-AATTGAAGAGTTTGATCATGGCTCA-3′ and EUB 907R: 5’-CCGTCAATTCCTTTRAGTTT-3′ [ ] in a final volume of 25 μL [1 × Taq buffer, 1 × TaqMaster PCR enhancer, 1.5 U Taq DNA polymerase (all 5 Prime, Hamburg, Germany), 200 μM of each dNTP (Qiagen, Hilden, Germany), 0.17 μM of each primer (TIB Molbiol, Berlin, Germany), 10–20 ng DNA template] in a Eppendorf Mastercycler Ep Gradient cycler [initial denaturation 4 min at 94 °C, followed by 40 cycles denaturation at 94 °C for 1 min, annealing at 59 °C for 1 min, elongation at 72 °C for 1 min and final extension at 68 °C for 7 min]. .. To avoid co-amplification of bacterial DNA contamination in the recombinant Taq polymerase, a DNAse I digestion was carried out prior utilization.

    Cellular Antioxidant Activity Assay:

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH). .. PCR was performed with the β-globin-specific primers 5'-ACA CAA CTG TGT TCA CTA GC-3' and 5'-TGG TCT CCT TAA ACC TGT CTT G-3' using a thermal cycler (TaKaRa Biomedicals, Ohtsu, Shiga, Japan) programmed at 95°C for 15 minutes to activate HotStarTaq DNA polymerase followed by 30 cycles at 94°C for 1 minute for denaturation, at 55°C for 2 minutes for annealing, at 72°C for 1 minute for extension, and at 68°C for 7 minutes for final extension [ ].

    Molecular Weight:

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. The final elongation step was performed at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group Ltd., Basel, Switzerland) and a 20-bp DNA ladder (O'RangeRuler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Thermocycling parameters for the agarose-MAMA were 94°C for 5 min, followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec with a final elongation step at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group) and a 20-bp DNA ladder (O'Range Ruler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    DNA Extraction:

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: Paragraph title: DNA Extraction, Amplification, and Sequencing ... All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega).

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: Any slide that was positive by fluorescent antibody staining for Cryptosporidium oocysts or Giardia cysts was processed for molecular analysis. (Oo)cyst removal, (oo)cyst lysis, and DNA extraction were carried out as previously described ( ). .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    Methylation:

    Article Title: Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST]
    Article Snippet: .. Briefly, 50 ng of bisulfite converted DNA was amplified in a 25 µL volume, with 2.5units HotStarTaq DNA Polymerase, 1X Buffer, 200 µM each dNTP (Qiagen GmbH, Crawley, West Sussex, UK), 0.4 µM each methylated primer and 0.8 µM each unmethylated primer. .. PCR products were run on 2.5% agarose gels and post-stained with GelStar Nucleic Acid Stain (Lonza, Muenchensteinerstrasse, Basel, Switzerland).

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Then, the prepared cDNA samples (n = 5 cDNA samples/group) were methylated by bisulfite treatment using the Bisul‐Methylation Universal Kit (Qiagen, Germany). .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Mutagenesis:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Paragraph title: Development of mismatch amplification mutation assays ... Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Isolation:

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: .. One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA). .. PCR analyses were conducted using a Light Cycler 1.5 (Roche Applied Science) under the following reaction conditions: initial denaturation at 95ºC for 10 min, then amplification by 40 cycles of: 95ºC for 15 s; 60ºC for 7 s for DcR3 or 58ºC for 7 s for GAPDH; 72ºC for 13 s. GAPDH was used as a reference gene.

    Polymerase Chain Reaction:

    Article Title: Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST]
    Article Snippet: Paragraph title: Methylation Specific PCR for 14q32 ... Briefly, 50 ng of bisulfite converted DNA was amplified in a 25 µL volume, with 2.5units HotStarTaq DNA Polymerase, 1X Buffer, 200 µM each dNTP (Qiagen GmbH, Crawley, West Sussex, UK), 0.4 µM each methylated primer and 0.8 µM each unmethylated primer.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Sequence analysis The HIT family protein coding gene of the MS1 strain was amplified by conventional PCR using the primers MS-HL1 ( 5’–ACT GTA AAT GAC GCC TTT TCT AC– 3’ ) and MS-HL2 ( 5’–ACC GCT TAT GCA AGT AAA TTA TT– 3’ ), designed in the present study. .. The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: .. Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Melt-MAMAs were carried out on an Applied Biosystems Step-One Plus real-time PCR system with StepOne SoftwareTM v2.2.2 and on Qiagen Rotor-Gene Q real-time PCR system, software version 2.3.1.

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: Paragraph title: PCR amplification and DNA sequencing ... The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH).

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Thermocycling parameters were 95°C for 10 min, followed by 39 cycles of 95°C for 15 sec and 58°C for 1 min. Endpoint PCR products were subjected to melt analysis using a dissociation protocol comprising 95°C for 15 sec, followed by incremental temperature ramping (0.2°C) from 58°C to 95°C. .. Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing
    Article Snippet: RT-PCR For both the standard and the high GC protocols, reverse transcription PCR (RT-PCR) was performed using Qiagen One Step RT-PCR Kit (cat# 210212). .. Qiagen One Step RT-PCR was set up in 10μl reactions containing 0.6μl water, 1.6μl buffer (Qiagen), 1.6μl Q solution (Qiagen), 0.3μl dNTP (Qiagen), 0.3μl enzyme (Qiagen), 0.4μl RNaseOut (Invitrogen), 2.2μl undiluted RNA, and 3μl primers (1.6μM, forward and reverse mixed).

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: .. The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up. .. The Step 2 PCR amplification products were cleaned up using a 1X bead to PCR product ratio.

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Next, the PCR amplification of Htr2c was performed, with primers designed by PyroMark Assay Design 2.0 and synthesized by the Hua Da Gene Company as shown in Table . .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: .. All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega). .. PCR cycles included an initial denaturation step at 95 °C for 2 min, followed by 35 cycles, each consisting of denaturation at 95 °C for 40 s, annealing at various temperatures depending on the primers (see ) for 45 s and extension at 72 °C for 35 s, and a final extension step of 5 min at 72 °C.

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA). .. PCR analyses were conducted using a Light Cycler 1.5 (Roche Applied Science) under the following reaction conditions: initial denaturation at 95ºC for 10 min, then amplification by 40 cycles of: 95ºC for 15 s; 60ºC for 7 s for DcR3 or 58ºC for 7 s for GAPDH; 72ºC for 13 s. GAPDH was used as a reference gene.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: .. Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Agarose-MAMAs were performed in a C1000™ Touch Thermal Cycler (Bio-Rad Laboratories, Inc., Berkeley, CA, USA).

    Article Title: Isolation and characterization of native probiotics for fish farming
    Article Snippet: .. Therefore, bacterial DNA was extracted from liquid cultures with peqGOLD Bacterial DNA Mini Kit (PeqLab, Erlangen, Germany) followed by PCR amplification with universal eubacteria primers EUB 1F: 5’-AATTGAAGAGTTTGATCATGGCTCA-3′ and EUB 907R: 5’-CCGTCAATTCCTTTRAGTTT-3′ [ ] in a final volume of 25 μL [1 × Taq buffer, 1 × TaqMaster PCR enhancer, 1.5 U Taq DNA polymerase (all 5 Prime, Hamburg, Germany), 200 μM of each dNTP (Qiagen, Hilden, Germany), 0.17 μM of each primer (TIB Molbiol, Berlin, Germany), 10–20 ng DNA template] in a Eppendorf Mastercycler Ep Gradient cycler [initial denaturation 4 min at 94 °C, followed by 40 cycles denaturation at 94 °C for 1 min, annealing at 59 °C for 1 min, elongation at 72 °C for 1 min and final extension at 68 °C for 7 min]. .. To avoid co-amplification of bacterial DNA contamination in the recombinant Taq polymerase, a DNAse I digestion was carried out prior utilization.

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template. .. The secondary PCR was carried out in a 50-μl volume reaction using 5 μl of the primary PCR product as the template DNA.

    Size-exclusion Chromatography:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl. .. Thermocycling parameters consisted of 95°C for 2 min, then 40 cycles of 95°C for 30sec, 55°C for 30 sec and 72°C for 1 min and a final elongation step at 72°C for 5 min.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Thermocycling parameters were 95°C for 10 min, followed by 39 cycles of 95°C for 15 sec and 58°C for 1 min and a dissociation protocol comprising 95°C for 15 sec, followed by incremental temperature ramping (0.2°C) from 58°C to 95°C.

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Thermocycling parameters were 95°C for 10 min, followed by 39 cycles of 95°C for 15 sec and 58°C for 1 min. Endpoint PCR products were subjected to melt analysis using a dissociation protocol comprising 95°C for 15 sec, followed by incremental temperature ramping (0.2°C) from 58°C to 95°C. .. Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing
    Article Snippet: Qiagen One Step RT-PCR was set up in 10μl reactions containing 0.6μl water, 1.6μl buffer (Qiagen), 1.6μl Q solution (Qiagen), 0.3μl dNTP (Qiagen), 0.3μl enzyme (Qiagen), 0.4μl RNaseOut (Invitrogen), 2.2μl undiluted RNA, and 3μl primers (1.6μM, forward and reverse mixed). .. Amplification was done in 96-well format on an MJ Research DNA Engine Tetrad 2 thermal cycler with the following cycling conditions: 1 cycle of 50°C (30 min); 1 cycle of 95°C (5 min); 35 cycles of 94°C (30 sec), 55°C (30 sec), and 72°C (1 min); 1 cycle of 72°C (10 min); hold at 4°C.

    Purification:

    Article Title: Polymorphisms in MC1R and ASIP Genes are Associated with Coat Color Variation in the Arabian Camel
    Article Snippet: All PCR reactions were carried out in a total volume of 25 µL containing 5–20 ng genomic DNA, 0.5 µM of each primer, 1 unit of GoTaq® polymerase (Promega, UK), 0.2 mM of each dNTP (Qiagen), 10X GoTaq Flexi Buffer, and 1 mM MgCl2 (Promega). .. PCR products were purified using the QIAquick® PCR Purification Kit (Qiagen) following the manufacturer’s instructions; they were sequenced at Macrogen ( http://www.macrogen.com/ ) using the original PCR forward and reverse primers.

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template. .. The PCR products were purified using a QIAquick PCR purification kit (Qiagen) and sequenced using an ABI dye terminator cycle sequencing kit (Applied Biosystems, Canada) according to the manufacturer's instructions.

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Automated degenerate PCR primer design for high-throughput sequencing improves efficiency of viral sequencing
    Article Snippet: .. Qiagen One Step RT-PCR was set up in 10μl reactions containing 0.6μl water, 1.6μl buffer (Qiagen), 1.6μl Q solution (Qiagen), 0.3μl dNTP (Qiagen), 0.3μl enzyme (Qiagen), 0.4μl RNaseOut (Invitrogen), 2.2μl undiluted RNA, and 3μl primers (1.6μM, forward and reverse mixed). ..

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: Paragraph title: ELISA and Reverse Transcription (RT)-PCR ... One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA).

    Lysis:

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: Any slide that was positive by fluorescent antibody staining for Cryptosporidium oocysts or Giardia cysts was processed for molecular analysis. (Oo)cyst removal, (oo)cyst lysis, and DNA extraction were carried out as previously described ( ). .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    IA:

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. In order to test the sensitivity of the assays, 10 fold dilutions of gBlocks (Integrated DNA Technologies Inc., Coralville, IA) containing 200 ng of a 330 bp long fragment of the obg gene (from nt342 to nt672) were used ( ).

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH). .. The amplicon of first PCR (2 μl) was used for second nested PCR with the nested EBNA-1-specific primers ( 5'-CCC GCA GAT GAC CCA GGA GA-3' and 5'-GGG TCC AGG GGC CAT TCC AAA-3' ) with the same PCR program as first PCR.

    Titration:

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer. .. To determine the saturation phase of RT–PCR amplification, we started with a cycle titration for survivin and GAPDH.

    Plasmid Preparation:

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: An additional replicate (sixth) was included for every sample and seeded with C. muris 18S rRNA plasmid DNA to determine possible sample inhibition. .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    Software:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Melt-MAMAs were carried out on an Applied Biosystems Step-One Plus real-time PCR system with StepOne SoftwareTM v2.2.2 and on Qiagen Rotor-Gene Q real-time PCR system, software version 2.3.1.

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system. .. Finally, a pyrosequencing detector (PyroMark Q96 ID; Qiagen) and Pyro Q‐CpG software were used to measure the respective frequencies for A, B, D, and C/E editing sites.

    Enzyme-linked Immunosorbent Assay:

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: Paragraph title: ELISA and Reverse Transcription (RT)-PCR ... One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA).

    RNA Extraction:

    Article Title: Cooperative effects in differentiation and proliferation between PDGF-BB and matrix derived synthetic peptides in human osteoblasts
    Article Snippet: Paragraph title: Total RNA extraction and cDNA synthesis ... Starting from 1 μg RNA, 20-μl cDNA was synthesized using Omniscript reverse transcriptase and oligo-dT primer in presence of dNTP (Qiagen, Hilden, Germany).

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Both RNA extraction and cDNA synthesis were performed using the PrimeScript Hi‐Fide RT‐RCR Kit (TAKARA Biotechnology Dalian CO., Ltd.). .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Agarose Gel Electrophoresis:

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The reaction mixture contained 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM, Promega), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), 1 μl of each primer (10 pmol/μl), 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega) and 2 μl of target DNA in a total volume of 25 μl. .. The amplicons were visualised in 1% agarose gel (Seakem Agarose, Lonza Group Ltd., Basel, Switzerland) under UV light.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: The difference between the Tm and the product size is detectable by fluorescent dye on a real-time PCR platform (melt-MAMA) or by 3% agarose gel electrophoresis (agarose-MAMA), respectively. .. Melt-MAMA PCR reactions were performed in 10 μl total volume, containing 1μl target DNA diluted in 2 μl 5X Color-less GoTaq Flexi Buffer (Promega), 1 μl MgCl2 (25mM), 0.3 μl dNTP (10 mM, Qiagen), 0.5 μl EvaGreen (Biotium Inc., Hayward, CA), primers (10 pmol/μl) according to and 0.08 μl GoTaq DNA polymerase (5 U/μl; Promega).

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. The final elongation step was performed at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group Ltd., Basel, Switzerland) and a 20-bp DNA ladder (O'RangeRuler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Thermocycling parameters for the agarose-MAMA were 94°C for 5 min, followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec with a final elongation step at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group) and a 20-bp DNA ladder (O'Range Ruler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Electron Paramagnetic Resonance:

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: Because survivin mRNA has to be distinguished from effector cell protease receptor-1 (EPR-1) mRNA, a naturally occurring antisense-mRNA of survivin which might bias survivin amplification , we used the primer 5′-AGG AAC CTG CAG CTC AGA-3′, corresponding to nucleotides 914–931 of the survivin antisense strand (accession no NM_001168). .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer.

    Pyromark Assay:

    Article Title: 5‐ HT2CR antagonist/5‐ HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing, et al. 5‐HT2CR antagonist/5‐HT2CR inverse agonist recovered the increased isolation‐induced aggressive behavior of BALB/c mice mediated by ADAR1 (p110) expression and Htr2c RNA editing
    Article Snippet: Next, the PCR amplification of Htr2c was performed, with primers designed by PyroMark Assay Design 2.0 and synthesized by the Hua Da Gene Company as shown in Table . .. Subsequently, serial pyrosequencing was performed with the substrate mixture, enzyme mixture, and four types of dNTP (Qiagen) in the reaction system.

    Concentration Assay:

    Article Title: CAG Repeat Not Polyglutamine Length Determines Timing of Huntington’s Disease Onset
    Article Snippet: The Step 2 PCR reaction conditions, in a total reaction volume of 50 ul, comprise 1X Buffer LongRange (QIAGEN), 1X Q-Solution (QIAGEN), 500 uM dNTP (QIAGEN), 0.8 uM each forward and reverse primer, 2 units of LongRange Enzyme (QIAGEN), and 5 ul of Step 1 PCR product, with the following cycle parameters: initial denaturation at 93°C for 3 minutes, eight cycles of denaturation at 93°C for 30 s, annealing at 60°C for 30 s, and extension at 68°C for 90 s, hold at 15°C until bead clean up. .. The libraries were pooled in sets of 24, 96, or 192 and run on the MiSeq at concentrations 8 - 15 pM with 10% PhiX spike-in of the same concentration for a 2x300 bp read.

    CTG Assay:

    Article Title: Epstein-Barr virus infection and variants of Epstein-Barr nuclear antigen-1 in synovial tissues of rheumatoid arthritis
    Article Snippet: The extracted genomic DNA (100 μg) was amplified using 0.5 μl of each 50 mM primers in 50 μl volume containing 25 mM MgCl2 , 1.25 units of HotStarTaq DNA polymerase (Qiagen, GmbH), and 10 mM of each dNTP (Qiagen, GmbH). .. PCR was performed with the β-globin-specific primers 5'-ACA CAA CTG TGT TCA CTA GC-3' and 5'-TGG TCT CCT TAA ACC TGT CTT G-3' using a thermal cycler (TaKaRa Biomedicals, Ohtsu, Shiga, Japan) programmed at 95°C for 15 minutes to activate HotStarTaq DNA polymerase followed by 30 cycles at 94°C for 1 minute for denaturation, at 55°C for 2 minutes for annealing, at 72°C for 1 minute for extension, and at 68°C for 7 minutes for final extension [ ].

    Article Title: Expression of different survivin variants in gastric carcinomas: first clues to a role of survivin-2B in tumour progression
    Article Snippet: For GAPDH-specific cDNA synthesis, the antisense primer 5′-CTC CTG GAA GAT GGT GAT GG-3′, corresponding to nucleotides 251–270 of the GAPDH antisense strand (accession no J04038) was used. .. The specific RT reaction mixtures were incubated at 50°C for 1 h. PCR amplification was performed in a final volume of 50 μl containing 3 μl first strand cDNA solution, 2.5 U of Taq polymerase, 1×PCR-buffer, 10 μl Q-solution (except GAPDH amplification), 25 μM of each dNTP (all Qiagen) and 25 pmol of each 3′ and 5′ sequence specific oligonucleotide primer.

    Article Title: Idiopathic pulmonary fibrosis fibroblasts become resistant to Fas ligand-dependent apoptosis via the alteration of decoy receptor 3
    Article Snippet: One microgram of isolated total RNA was subjected to complementary DNA (cDNA) synthesis using Oligo d(T) (Roche Applied Science, Indianapolis, IN, USA), dNTP (QIAGEN, Valencia, CA, USA) and reverse transcriptase (Sigma-Aldrich, St. Louis, MO, USA). .. Sequences of primers for DcR3 ( TNFRSF6B ) and GAPDH were described as follows: DcR3 (Forward: 5’-CAG AAA CAC CCA CCT ACC C-3’; Reverse:5’-GTA GTT CCA GAA CTG CGT GT -3’), or GAPDH (Forward: 5’-TTC ATT GAC CTC AAC TAC ATG GT-3’; Reverse:5’-CCT TCT CCA TGG TGG TGA AGA-3’).

    Marker:

    Article Title: Rapid, Simple and Cost-Effective Molecular Method to Differentiate the Temperature Sensitive (ts+) MS-H Vaccine Strain and Wild-Type Mycoplasma synoviae Isolates
    Article Snippet: Agarose-MAMAs were performed in Biometra–T Personal thermal cycler (Biometra Inc., Göttingen, Germany) in 25 μl total volume, containing 1 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega Inc., Madison, WI), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen Inc., Valencia, CA), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. The final elongation step was performed at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group Ltd., Basel, Switzerland) and a 20-bp DNA ladder (O'RangeRuler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Article Title: Development of mismatch amplification mutation assays for the differentiation of MS1 vaccine strain from wild-type Mycoplasma synoviae and MS-H vaccine strains
    Article Snippet: Agarose-MAMA PCR reaction mixtures contained 2 μl target DNA diluted in 5 μl 5X Green GoTaq Flexi Buffer (Promega), 2.5 μl MgCl2 (25mM), 0.5 μl dNTP (10 mM, Qiagen), primers (10 pmol/μl) according to and 0.25 μl GoTaq DNA polymerase (5 U/μl; Promega). .. Thermocycling parameters for the agarose-MAMA were 94°C for 5 min, followed by 40 cycles at 94°C for 30 sec, 58°C for 30 sec and 72°C for 30 sec with a final elongation step at 72°C for 5 min. Electrophoresis was performed in 3% agarose gel (MetaPhor Agarose, Lonza Group) and a 20-bp DNA ladder (O'Range Ruler 20 bp, Thermo Fisher Scientific Inc.) was used as molecular weight marker.

    Staining:

    Article Title: Post-Transcriptional Dysregulation by miRNAs Is Implicated in the Pathogenesis of Gastrointestinal Stromal Tumor [GIST]
    Article Snippet: Briefly, 50 ng of bisulfite converted DNA was amplified in a 25 µL volume, with 2.5units HotStarTaq DNA Polymerase, 1X Buffer, 200 µM each dNTP (Qiagen GmbH, Crawley, West Sussex, UK), 0.4 µM each methylated primer and 0.8 µM each unmethylated primer. .. PCR products were run on 2.5% agarose gels and post-stained with GelStar Nucleic Acid Stain (Lonza, Muenchensteinerstrasse, Basel, Switzerland).

    Article Title: Occurrence of Waterborne Pathogens and Escherichia coli at Offshore Drinking Water Intakes in Lake Ontario
    Article Snippet: Any slide that was positive by fluorescent antibody staining for Cryptosporidium oocysts or Giardia cysts was processed for molecular analysis. (Oo)cyst removal, (oo)cyst lysis, and DNA extraction were carried out as previously described ( ). .. The primary PCR product was amplified in a 50-μl volume with the following reaction components: 1× Taq buffer, 2 mM MgCl2 , 0.8 mM dNTP, 1× Q-solution (Qiagen), 0.8 μM concentrations of primers, 0.04 U of native Taq (Invitrogen Canada, Inc., Burlington, Ontario, Canada)/μl, and 5 μl of DNA template.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96
    Qiagen dntps
    Determination of marker gene copy number by Southern blot hybridization . Southern-blot analysis of digested ( PstI ) genomic <t>DNA</t> from 9 randomly isolated paromomycin resistant mutants. A fragment of the AphVIII gene labeled with 32 <t>P-dNTPs</t> was used as probe. As shown, most transformants have a single copy of the integrated marker gene. Only the transformant represented in lane 4 may have two insertions (indicated by the two hybridizing bands). p.s., parental strain used to obtain the transformants.
    Dntps, supplied by Qiagen, used in various techniques. Bioz Stars score: 96/100, based on 867 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntps/product/Qiagen
    Average 96 stars, based on 867 article reviews
    Price from $9.99 to $1999.99
    dntps - by Bioz Stars, 2020-02
    96/100 stars
      Buy from Supplier

    79
    Qiagen residual dntps
    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of <t>dNTPs.</t> Samples were subjected to CE before and after a conventional <t>PCR</t> purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.
    Residual Dntps, supplied by Qiagen, used in various techniques. Bioz Stars score: 79/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/residual dntps/product/Qiagen
    Average 79 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    residual dntps - by Bioz Stars, 2020-02
    79/100 stars
      Buy from Supplier

    Image Search Results


    Determination of marker gene copy number by Southern blot hybridization . Southern-blot analysis of digested ( PstI ) genomic DNA from 9 randomly isolated paromomycin resistant mutants. A fragment of the AphVIII gene labeled with 32 P-dNTPs was used as probe. As shown, most transformants have a single copy of the integrated marker gene. Only the transformant represented in lane 4 may have two insertions (indicated by the two hybridizing bands). p.s., parental strain used to obtain the transformants.

    Journal: Plant Methods

    Article Title: Reverse genetics in Chlamydomonas: a platform for isolating insertional mutants

    doi: 10.1186/1746-4811-7-24

    Figure Lengend Snippet: Determination of marker gene copy number by Southern blot hybridization . Southern-blot analysis of digested ( PstI ) genomic DNA from 9 randomly isolated paromomycin resistant mutants. A fragment of the AphVIII gene labeled with 32 P-dNTPs was used as probe. As shown, most transformants have a single copy of the integrated marker gene. Only the transformant represented in lane 4 may have two insertions (indicated by the two hybridizing bands). p.s., parental strain used to obtain the transformants.

    Article Snippet: PCR reactions using DNA from "superpools" as template were performed in a final volume of 25 μL and contained 0.4 pmoles of each primer, 0.2 mM of each of the dNTPs, 0.2 U of Taq DNA polymerase (Qiagen, Valencia, CA), 2.5 μL of 10 × Qiagen Taq DNA polymerase buffer, 5 μL Q solution (Qiagen, Valencia, CA), 100 ng of DNA template, and distilled water to make up the remainder of the 25 μL volume.

    Techniques: Marker, Southern Blot, Hybridization, Isolation, Labeling

    5FU incorporated into DNA is preferentially paired with adenine, followed by guanine. (A) Flowchart of procedure of in vitro analysis of binding partner of 5FU within DNA. (B-E) Frequencies of paired base with 5FU incorporated into DNA. One microgram of 5FdU:C containing dsDNA template PCR were utilized for both pH 8.2 or pH5.7 as a model of intracellular pH (pH i ) of tumor cells or normal cells in acidic tumor microenvironment with dNTP (B), only dCTP and dGTP (C), only dCTP, dGTP, and dATP (D), or only dCTP, dGTP, and dTTP (E). After TA cloning and total colony PCR, paired bases were analyzed by direct sequencing. The frequency of paired bases was calculated as the number of each base where 5FdU was inserted by total number of colonies ( N ≥ 24) with an informative sequence at the 5FdU site. 5FU within DNA is predominantly paired with adenine when both dGTP and dATP are available (B, D), whereas guanine is preferentially paired with 5FU when dATP is absent (C, E).

    Journal: Mutation research

    Article Title: Acidic tumor microenvironment downregulates hMLH1 but does not diminish 5-fluorouracil chemosensitivity

    doi: 10.1016/j.mrfmmm.2013.04.006

    Figure Lengend Snippet: 5FU incorporated into DNA is preferentially paired with adenine, followed by guanine. (A) Flowchart of procedure of in vitro analysis of binding partner of 5FU within DNA. (B-E) Frequencies of paired base with 5FU incorporated into DNA. One microgram of 5FdU:C containing dsDNA template PCR were utilized for both pH 8.2 or pH5.7 as a model of intracellular pH (pH i ) of tumor cells or normal cells in acidic tumor microenvironment with dNTP (B), only dCTP and dGTP (C), only dCTP, dGTP, and dATP (D), or only dCTP, dGTP, and dTTP (E). After TA cloning and total colony PCR, paired bases were analyzed by direct sequencing. The frequency of paired bases was calculated as the number of each base where 5FdU was inserted by total number of colonies ( N ≥ 24) with an informative sequence at the 5FdU site. 5FU within DNA is predominantly paired with adenine when both dGTP and dATP are available (B, D), whereas guanine is preferentially paired with 5FU when dATP is absent (C, E).

    Article Snippet: Purified genomic DNA was used for a PCR reaction mixture with 10 mM Tris–HCl [pH 8.4], 50 mM KCl, 1.5 mM MgCl2 , 200 μM dNTP, 5U of HotStarTaq DNA polymerase (QIAGEN), 0.25 μM forward primer (5′-AGAACCCACTGCTTACTGGC-3′) and reverse primer (5′-ATGGCTGGCAACTAGAAGGC-3/ ) whose sequence is identical with each end of 5FdU:G, T:G, or C:G matched dsDNA.

    Techniques: In Vitro, Binding Assay, Polymerase Chain Reaction, TA Cloning, Sequencing

    Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.

    Journal: Nucleic Acids Research

    Article Title: Rapid quantification of DNA methylation through dNMP analysis following bisulfite-PCR

    doi: 10.1093/nar/gkl257

    Figure Lengend Snippet: Confirmation of cleanup and enzymatic hydrolysis. ( A ) Removal of dNTPs. Samples were subjected to CE before and after a conventional PCR purification process. No peak was detected even in the 2-fold concentrated sample after purification. ( B ) Removal of primers. dNMP peaks resulting from residual primers were not detected in the 4-fold concentrated sample after purification. ( C ) CE profile of hydrolysis of a PCR product during a time course of phosphodiesterase treatment. dIMP was spiked as an internal standard for comparison. ( D ) Normalized dNMP peak intensities during a time course of phosphodiesterase treatment.

    Article Snippet: PCR products were cleaned up to remove residual dNTPs and primers using a conventional PCR purification kit (Qiagen, Hilden, Germany).

    Techniques: Polymerase Chain Reaction, Purification