Structured Review

PEQLAB dntp
Dntp, supplied by PEQLAB, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/PEQLAB
Average 93 stars, based on 26 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-04
93/100 stars

Images

Related Articles

Clone Assay:

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: Paragraph title: Cloning and sequencing of PHO1a cDNA alleles ... 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Amplification:

Article Title: Phosphoprotein Associated with Glycosphingolipid-Enriched Microdomains Differentially Modulates Src Kinase Activity in Brain Maturation
Article Snippet: For each gene, the linear amplification range was optimized. .. Reactions were performed on a PCR cycler (GeneAmp, PCR System 9700, PE Applied Biosystems) using cDNA (1.1 ng), oligonucleotide primer (10 pmol each), of each dNTP (200 µM each), SAWADY Taq-DNA-Polymerase (2 units, PEQLAB) and 1X reaction buffer S in a 50 µl volume.

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. Hybridization of biotinylated oligonucleotides and adapter-ligated genomic DNA, followed by the capturing of hybridized DNA on Dynabeads (Life Technologies, Darmstadt, Germany) and subsequent washing and resuspension, followed the protocol of .

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: In brief, 100 ng of the purified 544-bp PCR amplicon containing part of the EGFP gene (primers #76 5′-taaacggccacaagttcagcgt and #185 5′-gtgctcaggtagtggttgtcg) was melted and re-annealed to allow the formation of heteroduplex DNA, treated with 5 U of T7E1 (New England BioLabs) for 20 min at 37°C, and separated on a 2% agarose gel. .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles.

Article Title: Fourteen polymorphic microsatellite markers for the threatened Arnica montana (Asteraceae) 1
Article Snippet: A total of 60 microsatellite loci with at least five repeats, including six loci with hexanucleotide repeats, two loci with pentanucleotide repeats, three loci with tetranucleotide repeats, 35 loci with trinucleotide repeats, and 14 loci with dinucleotide repeats, were tested for proper PCR amplification using genomic DNA. .. For assessing optimal annealing temperatures, a gradient PCR with annealing temperatures varying between 53°C and 63°C was carried out for each primer pair in a 15.6-μL reaction volume containing 20–40 ng DNA, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (PeqLab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 units Hot Taq polymerase (PeqLab).

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: PHO1a cDNA was selectively amplified from ca. .. 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Article Title: Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3
Article Snippet: PCR was performed in a reaction volume of 25 µl containing 20–30 ng of genomic DNA, 1.25 U of GoTaq polymerase (Promega), 5 µl of 5 × GoTaq PCR Buffer (7.5 mM MgCl2 ), 4 µl of dNTP (1.25 mM each; PEQLAB) and 5 pmol of each of the primers. .. The thermal cycling profile was as follows: initial denaturation at 95 °C for 2 min and 35 rounds of amplification at 95 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min. A final extension step at 72 °C for 5 min was added.

Article Title: Regeneration of the immunoglobulin heavy-chain repertoire after transient B-cell depletion with an anti-CD20 antibody
Article Snippet: Paragraph title: Amplification of rearranged immunoglobulin V genes by PCR ... The final concentrations of the reagents were 200 μM each dNTP (Peqlab, Erlangen, Germany), 0.625 μM each primer, 2.5 mM MgCl2 , 10 × PCR buffer II and 2.5 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA).

Synthesized:

Article Title: Impact of polysialylated CD56 on natural killer cell cytotoxicity
Article Snippet: .. Reverse transcriptase PCR Total RNA of 1 × 106 CD56+ cells was extracted using the NucleoSpin RNA II Kit (Macherey & Nagel, Dueren, Germany) according to the manufacturer's instructions. cDNA was synthesized in a 30 μl reaction mixture containing 300 U SuperscriptII, 1× first strand buffer (0.3 μM, Invitrogen), dNTP (200 μM each, PEQLAB, Erlangen, Germany), Oligo(dT)18 (5 μg) and (N6) random hexamere (0.2 μg, both Metabion, Martinsried, Germany). .. Human normal adult brain cDNA (1 μl per PCR reaction) and human fetal brain cDNA (2 μl per PCR reaction) were purchased from Biochain Institute, Inc (Hayward, CA, USA).

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: First-strand cDNA was synthesized from 1 μg of total RNA using the Transcriptor First Strand cDNA Synthesis Kit (Roche Applied Science, Mannheim, Germany) according to the manufacturer’s protocol and anchored-oligo (dT)18 primers and one sequence specific primer, or two sequence-specific primers ( ). .. 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Electrophoresis:

Article Title: Phosphoprotein Associated with Glycosphingolipid-Enriched Microdomains Differentially Modulates Src Kinase Activity in Brain Maturation
Article Snippet: Reactions were performed on a PCR cycler (GeneAmp, PCR System 9700, PE Applied Biosystems) using cDNA (1.1 ng), oligonucleotide primer (10 pmol each), of each dNTP (200 µM each), SAWADY Taq-DNA-Polymerase (2 units, PEQLAB) and 1X reaction buffer S in a 50 µl volume. .. The PCR products were visualized by electrophoresis on 2% agarose gels in TBE buffer (89 mM Tris-base pH 7.6, 89 mM boric acid, 2 mM EDTA) with 10 µg/ml ethidium bromide and photographed using a UV light box.

Incubation:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: To prepare double-stranded adapters, forward (Eco RI: 5′-CTCGTAGACTGCGTACC, Mse I: 5′-GACGATGAGTCCTGAG) and reverse (Eco RI: 5′-AATTGGTACGCAGTCTACGAG, Mse I: 5′-TACTCAGGACTCATCGTC) adapters (Metabion, Martinsried, Germany) were mixed in equimolar amounts (10 μM), incubated at 95°C for 5 min, and allowed to slowly cool down to room temperature. .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs.

Article Title: The CD40-CD40L Pathway Contributes to the Proinflammatory Function of Intestinal Epithelial Cells in Inflammatory Bowel Disease
Article Snippet: HT29 cells were further incubated with supernatant obtained from IFN-γ-pulsed cells, sCD40L, LPS, and whole E. coli (see bacterial stimulation). .. Reverse transcription was performed using 100 U Superscript II, 0.01 M DTT, 1× reaction buffer (each obtained from Invitrogen), 250 ng of random hexamers (Promega, Mannheim, Germany), and 0.5 mmol/L dNTP (PeqLAB, Erlangen, Germany) in a total volume of 20 μl for 50 minutes at 42°C.

Expressing:

Article Title: The CD40-CD40L Pathway Contributes to the Proinflammatory Function of Intestinal Epithelial Cells in Inflammatory Bowel Disease
Article Snippet: Expression levels of IL-8 mRNA were additionally studied in these cells. .. Reverse transcription was performed using 100 U Superscript II, 0.01 M DTT, 1× reaction buffer (each obtained from Invitrogen), 250 ng of random hexamers (Promega, Mannheim, Germany), and 0.5 mmol/L dNTP (PeqLAB, Erlangen, Germany) in a total volume of 20 μl for 50 minutes at 42°C.

Modification:

Article Title: Development of microsatellite markers for Crepis mollis (Asteraceae) 1
Article Snippet: PCRs were performed in 15-μL total volume with the following components: 20 ng of DNA template, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (Peqlab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 unit Hot Taq polymerase (Peqlab). .. PCR temperature profiles were as follows: 95°C for 1 min; 30 cycles of 94°C for 1 min, 58°C for 1 min, and 72°C for 1 min; and a final extension of 72°C for 7 min. Two loci (Cremo34, Cremo55) were run with the same profile but with a touchdown modification: the annealing temperature started at 60°C and decreased 0.5°C at each of the first 12 cycles, while the last 20 cycles were run with a constant annealing temperature of 54°C.

Transformation Assay:

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies). .. Products of two to three independent PCRs per genotype and tissue (19 in total) were cloned in Escherichia coli plasmid vector TOPO XL (Invitrogen Life Technologies) and transformed into competent cells of strains DH5α or One Shot ccd B Survival (Invitrogen Life Technologies) according to the manufacturer’s instructions.

Hybridization:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. Hybridization of biotinylated oligonucleotides and adapter-ligated genomic DNA, followed by the capturing of hybridized DNA on Dynabeads (Life Technologies, Darmstadt, Germany) and subsequent washing and resuspension, followed the protocol of .

Ligation:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. Hybridization of biotinylated oligonucleotides and adapter-ligated genomic DNA, followed by the capturing of hybridized DNA on Dynabeads (Life Technologies, Darmstadt, Germany) and subsequent washing and resuspension, followed the protocol of .

Generated:

Article Title: Phosphoprotein Associated with Glycosphingolipid-Enriched Microdomains Differentially Modulates Src Kinase Activity in Brain Maturation
Article Snippet: RT-PCR Primer sequences were designed to span intron regions to insure that no false positive PCR fragments would be generated from pseudogenes in the contaminating genomic DNA. .. Reactions were performed on a PCR cycler (GeneAmp, PCR System 9700, PE Applied Biosystems) using cDNA (1.1 ng), oligonucleotide primer (10 pmol each), of each dNTP (200 µM each), SAWADY Taq-DNA-Polymerase (2 units, PEQLAB) and 1X reaction buffer S in a 50 µl volume.

Polymerase Chain Reaction:

Article Title: Phosphoprotein Associated with Glycosphingolipid-Enriched Microdomains Differentially Modulates Src Kinase Activity in Brain Maturation
Article Snippet: .. Reactions were performed on a PCR cycler (GeneAmp, PCR System 9700, PE Applied Biosystems) using cDNA (1.1 ng), oligonucleotide primer (10 pmol each), of each dNTP (200 µM each), SAWADY Taq-DNA-Polymerase (2 units, PEQLAB) and 1X reaction buffer S in a 50 µl volume. .. The PCR products were visualized by electrophoresis on 2% agarose gels in TBE buffer (89 mM Tris-base pH 7.6, 89 mM boric acid, 2 mM EDTA) with 10 µg/ml ethidium bromide and photographed using a UV light box.

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. Hybridization of biotinylated oligonucleotides and adapter-ligated genomic DNA, followed by the capturing of hybridized DNA on Dynabeads (Life Technologies, Darmstadt, Germany) and subsequent washing and resuspension, followed the protocol of .

Article Title: Impact of polysialylated CD56 on natural killer cell cytotoxicity
Article Snippet: .. Reverse transcriptase PCR Total RNA of 1 × 106 CD56+ cells was extracted using the NucleoSpin RNA II Kit (Macherey & Nagel, Dueren, Germany) according to the manufacturer's instructions. cDNA was synthesized in a 30 μl reaction mixture containing 300 U SuperscriptII, 1× first strand buffer (0.3 μM, Invitrogen), dNTP (200 μM each, PEQLAB, Erlangen, Germany), Oligo(dT)18 (5 μg) and (N6) random hexamere (0.2 μg, both Metabion, Martinsried, Germany). .. Human normal adult brain cDNA (1 μl per PCR reaction) and human fetal brain cDNA (2 μl per PCR reaction) were purchased from Biochain Institute, Inc (Hayward, CA, USA).

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles. .. PCR products were purified using QIAquick PCR Purification Kit (Qiagen) and 1 μL (out of 20 μL) was used as a template for a second amplification round with primers #361 5′-gaggagctgttcaccggg and #559 for 25 cycles.

Article Title: Development of microsatellite markers for Crepis mollis (Asteraceae) 1
Article Snippet: Sixty microsatellite loci were tested for PCR amplification on an initial set of three C. mollis DNA samples. .. PCRs were performed in 15-μL total volume with the following components: 20 ng of DNA template, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (Peqlab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 unit Hot Taq polymerase (Peqlab).

Article Title: Fourteen polymorphic microsatellite markers for the threatened Arnica montana (Asteraceae) 1
Article Snippet: .. For assessing optimal annealing temperatures, a gradient PCR with annealing temperatures varying between 53°C and 63°C was carried out for each primer pair in a 15.6-μL reaction volume containing 20–40 ng DNA, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (PeqLab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 units Hot Taq polymerase (PeqLab). .. For all primer pairs, the temperature profile of the PCR was as follows: 95°C for 1 min; 30 cycles of 94°C for 1 min, 58°C ± 5°C for 1 min, and 72°C for 1 min; plus a final extension of 72°C for 7 min. Amplification of PCR was evaluated by visual inspection of gel electrophoresis.

Article Title: Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene
Article Snippet: .. Cell lysate (1 µL) was subjected to PCR reaction mix (1× reaction buffer S, 12.5 mM MgCl2 , 5 pmol forward primer (GTGCTGGAGGGCATCCGCATCT), 5 pmol reverse primer (CTTCTCTGCTCCTTTCCTGCTGTCAA), 5 nmol each dNTP and 1 U Taq (PeqLab)) in a final volume of 25 µL. .. Subsequently, the target DNA was elongated at 72 °C for 2 min. PCR amplicons for RNA quantification spanned 3 exons to discriminate between mRNA and potential genomic DNA contamination.

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: .. 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies). .. Cycling conditions were as follows: initial denaturation for 2 min at 94°, 20 cycles of denaturation (30 sec at 94°), annealing (30 sec at Ta according to ) and extension (1 min/kb at 72°), and final extension for 5 min at 72°.

Article Title: Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3
Article Snippet: .. PCR was performed in a reaction volume of 25 µl containing 20–30 ng of genomic DNA, 1.25 U of GoTaq polymerase (Promega), 5 µl of 5 × GoTaq PCR Buffer (7.5 mM MgCl2 ), 4 µl of dNTP (1.25 mM each; PEQLAB) and 5 pmol of each of the primers. .. The thermal cycling profile was as follows: initial denaturation at 95 °C for 2 min and 35 rounds of amplification at 95 °C for 30 s, 58 °C for 30 s and 72 °C for 1 min. A final extension step at 72 °C for 5 min was added.

Article Title: Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene
Article Snippet: .. Screening for R723G-Genome Edited DNA Mutation specific restriction analysis was performed by PCR-amplification of the genome edited locus using 1× reaction buffer S, 6.25 mmol MgCl2, 2.5 pmol forward primer (GTGCTGGAGGGCATCCGCATCT), 2.5 pmol reverse primer (CTTCTCTGCTCCTTTCCTGCTGTCAA), 10 nmol of each dNTP, and 1 U Taq (PeqLab) in a final volume of 12.5 µL. ..

Article Title: Regeneration of the immunoglobulin heavy-chain repertoire after transient B-cell depletion with an anti-CD20 antibody
Article Snippet: .. The final concentrations of the reagents were 200 μM each dNTP (Peqlab, Erlangen, Germany), 0.625 μM each primer, 2.5 mM MgCl2 , 10 × PCR buffer II and 2.5 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA). .. During the external amplification round, 250 ng (5 μl) DNA were amplified in a 75 μl reaction containing primers specific for the leader peptide sequence and a mixture of external JH primers in a Gene Amp PCR System 2400 (Perkin Elmer, Applied Biosystems, Foster City, CA, USA).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Phosphoprotein Associated with Glycosphingolipid-Enriched Microdomains Differentially Modulates Src Kinase Activity in Brain Maturation
Article Snippet: Paragraph title: RT-PCR ... Reactions were performed on a PCR cycler (GeneAmp, PCR System 9700, PE Applied Biosystems) using cDNA (1.1 ng), oligonucleotide primer (10 pmol each), of each dNTP (200 µM each), SAWADY Taq-DNA-Polymerase (2 units, PEQLAB) and 1X reaction buffer S in a 50 µl volume.

Nucleic Acid Electrophoresis:

Article Title: Fourteen polymorphic microsatellite markers for the threatened Arnica montana (Asteraceae) 1
Article Snippet: For assessing optimal annealing temperatures, a gradient PCR with annealing temperatures varying between 53°C and 63°C was carried out for each primer pair in a 15.6-μL reaction volume containing 20–40 ng DNA, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (PeqLab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 units Hot Taq polymerase (PeqLab). .. For all primer pairs, the temperature profile of the PCR was as follows: 95°C for 1 min; 30 cycles of 94°C for 1 min, 58°C ± 5°C for 1 min, and 72°C for 1 min; plus a final extension of 72°C for 7 min. Amplification of PCR was evaluated by visual inspection of gel electrophoresis.

Mutagenesis:

Article Title: Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene
Article Snippet: .. Screening for R723G-Genome Edited DNA Mutation specific restriction analysis was performed by PCR-amplification of the genome edited locus using 1× reaction buffer S, 6.25 mmol MgCl2, 2.5 pmol forward primer (GTGCTGGAGGGCATCCGCATCT), 2.5 pmol reverse primer (CTTCTCTGCTCCTTTCCTGCTGTCAA), 10 nmol of each dNTP, and 1 U Taq (PeqLab) in a final volume of 12.5 µL. ..

Isolation:

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: Tuber RNA was isolated either with the PureLink Plant RNA Reagent (Invitrogen Life Technologies, Carlsbad, CA) or using the protocol described in . .. 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Article Title: Regeneration of the immunoglobulin heavy-chain repertoire after transient B-cell depletion with an anti-CD20 antibody
Article Snippet: Amplification of rearranged immunoglobulin V genes by PCR Genomic DNA was isolated from PBMCs using the QIAamp® DNA Blood Mini Kit (Qiagen, Hilden, Germany). .. The final concentrations of the reagents were 200 μM each dNTP (Peqlab, Erlangen, Germany), 0.625 μM each primer, 2.5 mM MgCl2 , 10 × PCR buffer II and 2.5 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA).

Size-exclusion Chromatography:

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies). .. Cycling conditions were as follows: initial denaturation for 2 min at 94°, 20 cycles of denaturation (30 sec at 94°), annealing (30 sec at Ta according to ) and extension (1 min/kb at 72°), and final extension for 5 min at 72°.

Labeling:

Article Title: Development of microsatellite markers for Crepis mollis (Asteraceae) 1
Article Snippet: PCRs were performed in 15-μL total volume with the following components: 20 ng of DNA template, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (Peqlab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 unit Hot Taq polymerase (Peqlab). .. Forward primers were labeled with fluorescent dyes , and the reverse primers were extended with seven bases (GTTTCTT) at the 5′ end to reduce stutter bands (“PIG-tailing”; ).

Article Title: Fourteen polymorphic microsatellite markers for the threatened Arnica montana (Asteraceae) 1
Article Snippet: For assessing optimal annealing temperatures, a gradient PCR with annealing temperatures varying between 53°C and 63°C was carried out for each primer pair in a 15.6-μL reaction volume containing 20–40 ng DNA, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (PeqLab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 units Hot Taq polymerase (PeqLab). .. PCR amplification was performed using forward primers labeled with fluorescent dyes (FAM, YakimaYellow, ATTO 565, and ATTO 550) and reverse primers (Armo01–Armo03) with a 7-bp (GTTTCTT) extension at the 5′-end to reduce stutter bands (“PIG-tailing”; ).

Purification:

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: In brief, 100 ng of the purified 544-bp PCR amplicon containing part of the EGFP gene (primers #76 5′-taaacggccacaagttcagcgt and #185 5′-gtgctcaggtagtggttgtcg) was melted and re-annealed to allow the formation of heteroduplex DNA, treated with 5 U of T7E1 (New England BioLabs) for 20 min at 37°C, and separated on a 2% agarose gel. .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles.

Article Title: Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene
Article Snippet: Cell lysate (1 µL) was subjected to PCR reaction mix (1× reaction buffer S, 12.5 mM MgCl2 , 5 pmol forward primer (GTGCTGGAGGGCATCCGCATCT), 5 pmol reverse primer (CTTCTCTGCTCCTTTCCTGCTGTCAA), 5 nmol each dNTP and 1 U Taq (PeqLab)) in a final volume of 25 µL. .. The PCR product was purified using the PCR-clean-up kit (Macherey-Nagel, Germany) according to the suppliers’ instructions.

Article Title: Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3
Article Snippet: PCR was performed in a reaction volume of 25 µl containing 20–30 ng of genomic DNA, 1.25 U of GoTaq polymerase (Promega), 5 µl of 5 × GoTaq PCR Buffer (7.5 mM MgCl2 ), 4 µl of dNTP (1.25 mM each; PEQLAB) and 5 pmol of each of the primers. .. PCR products were purified using ExoSAP-IT (Affymetrix) according to the manufacturer’s protocol.

Sequencing:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. The enrichment procedure was repeated and the second recovery PCR was carried out with an Eco RI oligonucleotide primer extended with a Roche 454 pyrosequencing adapter (5′-GCCTCCCTCGCGCCATCAG-3′) and a specimen-specific barcode sequence and an Mse I oligonucleotide primer extended with a Roche 454 B sequencing adapter (5′-GCCTTGCCAGCCCGCTCAG-3′; ).

Article Title: Efficient Knock-in of a Point Mutation in Porcine Fibroblasts Using the CRISPR/Cas9-GMNN Fusion Gene
Article Snippet: Paragraph title: 2.5. Sequence Analysis of R723G-Positive Cultures ... Cell lysate (1 µL) was subjected to PCR reaction mix (1× reaction buffer S, 12.5 mM MgCl2 , 5 pmol forward primer (GTGCTGGAGGGCATCCGCATCT), 5 pmol reverse primer (CTTCTCTGCTCCTTTCCTGCTGTCAA), 5 nmol each dNTP and 1 U Taq (PeqLab)) in a final volume of 25 µL.

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: Paragraph title: Cloning and sequencing of PHO1a cDNA alleles ... 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Article Title: Exome sequencing identifies recurrent somatic mutations in EIF1AX and SF3B1 in uveal melanoma with disomy 3
Article Snippet: Paragraph title: Sanger sequencing ... PCR was performed in a reaction volume of 25 µl containing 20–30 ng of genomic DNA, 1.25 U of GoTaq polymerase (Promega), 5 µl of 5 × GoTaq PCR Buffer (7.5 mM MgCl2 ), 4 µl of dNTP (1.25 mM each; PEQLAB) and 5 pmol of each of the primers.

Article Title: Regeneration of the immunoglobulin heavy-chain repertoire after transient B-cell depletion with an anti-CD20 antibody
Article Snippet: The final concentrations of the reagents were 200 μM each dNTP (Peqlab, Erlangen, Germany), 0.625 μM each primer, 2.5 mM MgCl2 , 10 × PCR buffer II and 2.5 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA). .. During the external amplification round, 250 ng (5 μl) DNA were amplified in a 75 μl reaction containing primers specific for the leader peptide sequence and a mixture of external JH primers in a Gene Amp PCR System 2400 (Perkin Elmer, Applied Biosystems, Foster City, CA, USA).

Nested PCR:

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: Correction of the EGFP target locus was verified using a nested PCR. .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles.

Article Title: Regeneration of the immunoglobulin heavy-chain repertoire after transient B-cell depletion with an anti-CD20 antibody
Article Snippet: Rearranged VH DJH gene rearrangements were amplified for all VH families using a nested PCR approach [ ]. .. The final concentrations of the reagents were 200 μM each dNTP (Peqlab, Erlangen, Germany), 0.625 μM each primer, 2.5 mM MgCl2 , 10 × PCR buffer II and 2.5 U AmpliTaq DNA polymerase (Applied Biosystems, Foster City, CA, USA).

Activated Clotting Time Assay:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs. .. Hybridization of biotinylated oligonucleotides and adapter-ligated genomic DNA, followed by the capturing of hybridized DNA on Dynabeads (Life Technologies, Darmstadt, Germany) and subsequent washing and resuspension, followed the protocol of .

Plasmid Preparation:

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: To detect AAV vector integration into the E502 site, primers recognizing the EGFP gene and the AAV-ZFN expression vector were used for the 5′-junction primers #76 and #1401 (5′-accatggcccaacttgttta; SV40 pA) and for the 3′-junction primers #185 and #14 (5′-aatggggcggagttgttacgac; CMV). .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles.

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies). .. Products of two to three independent PCRs per genotype and tissue (19 in total) were cloned in Escherichia coli plasmid vector TOPO XL (Invitrogen Life Technologies) and transformed into competent cells of strains DH5α or One Shot ccd B Survival (Invitrogen Life Technologies) according to the manufacturer’s instructions.

Software:

Article Title: Fourteen polymorphic microsatellite markers for the threatened Arnica montana (Asteraceae) 1
Article Snippet: Using a Primer3-based ( ; ) custom-made software (property of Ecogenics, Zurich, Switzerland), 361 reads were suitable for designing primers with a GC content of 20–80% and a T m ranging from 57°C to 63°C. .. For assessing optimal annealing temperatures, a gradient PCR with annealing temperatures varying between 53°C and 63°C was carried out for each primer pair in a 15.6-μL reaction volume containing 20–40 ng DNA, 0.16 μM of each forward and reverse primer (Eurofins MWG Operon, Ebersberg, Germany), 1× TaqBuffer S (PeqLab), 1.5 mM MgCl2 , 0.25 mM of each dNTP, and 0.03 units Hot Taq polymerase (PeqLab).

RNA Extraction:

Article Title: The CD40-CD40L Pathway Contributes to the Proinflammatory Function of Intestinal Epithelial Cells in Inflammatory Bowel Disease
Article Snippet: Paragraph title: RNA Extraction and Reverse Transcription ... Reverse transcription was performed using 100 U Superscript II, 0.01 M DTT, 1× reaction buffer (each obtained from Invitrogen), 250 ng of random hexamers (Promega, Mannheim, Germany), and 0.5 mmol/L dNTP (PeqLAB, Erlangen, Germany) in a total volume of 20 μl for 50 minutes at 42°C.

Agarose Gel Electrophoresis:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: Digested DNA was run on a 2% agarose gel, and 200–400-bp fragments were extracted using the Gel/PCR DNA Fragment Extraction Kit (Avegene, Zollikofen, Switzerland) following the manufacturer’s protocol. .. Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs.

Article Title: Versatile and Efficient Genome Editing in Human Cells by Combining Zinc-Finger Nucleases With Adeno-Associated Viral Vectors
Article Snippet: In brief, 100 ng of the purified 544-bp PCR amplicon containing part of the EGFP gene (primers #76 5′-taaacggccacaagttcagcgt and #185 5′-gtgctcaggtagtggttgtcg) was melted and re-annealed to allow the formation of heteroduplex DNA, treated with 5 U of T7E1 (New England BioLabs) for 20 min at 37°C, and separated on a 2% agarose gel. .. For the first PCR, 100 ng of genomic DNA was used as a template, along with 300 μM of each primer (#136 5′-caagggcgaggagctggt and #559 5′-ctcggcgcgggtcttgtag), 200 mM dNTP, 0.125 U of Taq polymerase (PEQLAB) in 1× reaction buffer for 13 cycles.

Spectrophotometry:

Article Title: SNPs in Genes Functional in Starch-Sugar Interconversion Associate with Natural Variation of Tuber Starch and Sugar Content of Potato (Solanum tuberosum L.)
Article Snippet: Total RNA was eluted in diethylpyrocarbonate-treated water and quantified with a Qubit fluorometer (Invitrogen Life Technologies) or a NanoDrop UV-Vis spectrophotometer (Thermo Scientific). .. 40 ng of cDNA template in 25 μL of PCR buffer (10 mM Tris-HCL pH 8.3; 50 mM KCl; 1.5 mM MgCl2 ; 0.1% Triton X-100) including 0.2 mM each dNTP, 1 μM each forward and reverse primers, and 1.5 U of Taq-Polymerase (KAPA2G Fast PCR Kit (PEQLAB Biotechnology, Erlangen, Germany) or FastStart High Fidelity PCR System (Roche) or AccuPrime Pfx DNA Polymerase (Invitrogen Life Technologies).

Marker:

Article Title: Development of nuclear microsatellites for the Arcto-Tertiary tree Zelkova carpinifolia (Ulmaceae) using 454 pyrosequencing 1
Article Snippet: Paragraph title: Microsatellite marker development ... Reactions were performed at 16°C for 12 h and successful ligation was tested by PCR amplification in 50-μL reactions containing 4 μL of the adapter-ligated DNA, 1× Taq DNA polymerase buffer, 1× PCR enhancer solution, 150 μM of each dNTP, 2 U Taq DNA polymerase (PeqLab, Erlangen, Germany), 35 ng/μL BSA, 0.5 μM Eco RI primer (5′-CTCGTAGACTGCGTACCAATTC), and 0.5 μM Mse I primer (5′-GACGATGAGTCCTGAGTAA) (Metabion) using the following temperature profile: 95°C for 2 min; 20 cycles of 95°C for 20 s, 60°C for 20 s, 72°C for 1.5 min; and 72°C for 10 min. Two mixtures of 3′-biotinylated oligonucleotides [1: (AG)12 , (TG)12 , (AAG)8 , (AAT)12 , (ACT)12 and 2: (ACAG)6 , (ACCT)6 , (ACTC)6 , (ACTG)6 ] were used to generate two separate libraries of adapter-ligated genomic DNA enriched for repetitive motifs.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 87
    PEQLAB deoxyribonucleotides dntps
    Analysis of <t>P/DNA/dNTP</t> interactions and enzymatic activity of Pol I(KF). A – C Association, dissociation, and elongation under different conditions: association in Mg 2+ -buffer, followed by dissociation in Ca 2+ -buffer (diss. 1), elongation in a 100 μ M dNTP-mix, and dissociation of the polymerase in Mg 2+ -buffer (diss. 2). In A and B, the dissociation phase 2 proceeds after the elongation from the end of the extended oligonucleotide primer in the absence and presence of competing DNA, respectively. C is a control where the polymerase dissociates in the absence of <t>dNTPs</t> but presence of competing DNA in solution. Lines are single exponential fits. D Dissociation rates from dissociation phase 2 as a function of dNTP concentration. The line is a Langmuir fit and yields the dissociation constant for the binding of dNTPs by a polymerase located at the end of dsDNA (without the influence of base-pairing). E : Elongation monitored in real-time by the fluorescence emitted from standing DNA ( F up ) for different dNTP concentrations. F : Elongation rates from E (linear slope) plotted as a function of the dNTP concentration. The line is a Michaelis-Menten fit with K M being the Michaelis constant.
    Deoxyribonucleotides Dntps, supplied by PEQLAB, used in various techniques. Bioz Stars score: 87/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxyribonucleotides dntps/product/PEQLAB
    Average 87 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deoxyribonucleotides dntps - by Bioz Stars, 2020-04
    87/100 stars
      Buy from Supplier

    dntp  (PEQLAB)
    93
    PEQLAB dntp
    Analysis of <t>P/DNA/dNTP</t> interactions and enzymatic activity of Pol I(KF). A – C Association, dissociation, and elongation under different conditions: association in Mg 2+ -buffer, followed by dissociation in Ca 2+ -buffer (diss. 1), elongation in a 100 μ M dNTP-mix, and dissociation of the polymerase in Mg 2+ -buffer (diss. 2). In A and B, the dissociation phase 2 proceeds after the elongation from the end of the extended oligonucleotide primer in the absence and presence of competing DNA, respectively. C is a control where the polymerase dissociates in the absence of <t>dNTPs</t> but presence of competing DNA in solution. Lines are single exponential fits. D Dissociation rates from dissociation phase 2 as a function of dNTP concentration. The line is a Langmuir fit and yields the dissociation constant for the binding of dNTPs by a polymerase located at the end of dsDNA (without the influence of base-pairing). E : Elongation monitored in real-time by the fluorescence emitted from standing DNA ( F up ) for different dNTP concentrations. F : Elongation rates from E (linear slope) plotted as a function of the dNTP concentration. The line is a Michaelis-Menten fit with K M being the Michaelis constant.
    Dntp, supplied by PEQLAB, used in various techniques. Bioz Stars score: 93/100, based on 26 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/PEQLAB
    Average 93 stars, based on 26 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-04
    93/100 stars
      Buy from Supplier

    Image Search Results


    Analysis of P/DNA/dNTP interactions and enzymatic activity of Pol I(KF). A – C Association, dissociation, and elongation under different conditions: association in Mg 2+ -buffer, followed by dissociation in Ca 2+ -buffer (diss. 1), elongation in a 100 μ M dNTP-mix, and dissociation of the polymerase in Mg 2+ -buffer (diss. 2). In A and B, the dissociation phase 2 proceeds after the elongation from the end of the extended oligonucleotide primer in the absence and presence of competing DNA, respectively. C is a control where the polymerase dissociates in the absence of dNTPs but presence of competing DNA in solution. Lines are single exponential fits. D Dissociation rates from dissociation phase 2 as a function of dNTP concentration. The line is a Langmuir fit and yields the dissociation constant for the binding of dNTPs by a polymerase located at the end of dsDNA (without the influence of base-pairing). E : Elongation monitored in real-time by the fluorescence emitted from standing DNA ( F up ) for different dNTP concentrations. F : Elongation rates from E (linear slope) plotted as a function of the dNTP concentration. The line is a Michaelis-Menten fit with K M being the Michaelis constant.

    Journal: Scientific Reports

    Article Title: Polymerase/DNA interactions and enzymatic activity: multi-parameter analysis with electro-switchable biosurfaces

    doi: 10.1038/srep12066

    Figure Lengend Snippet: Analysis of P/DNA/dNTP interactions and enzymatic activity of Pol I(KF). A – C Association, dissociation, and elongation under different conditions: association in Mg 2+ -buffer, followed by dissociation in Ca 2+ -buffer (diss. 1), elongation in a 100 μ M dNTP-mix, and dissociation of the polymerase in Mg 2+ -buffer (diss. 2). In A and B, the dissociation phase 2 proceeds after the elongation from the end of the extended oligonucleotide primer in the absence and presence of competing DNA, respectively. C is a control where the polymerase dissociates in the absence of dNTPs but presence of competing DNA in solution. Lines are single exponential fits. D Dissociation rates from dissociation phase 2 as a function of dNTP concentration. The line is a Langmuir fit and yields the dissociation constant for the binding of dNTPs by a polymerase located at the end of dsDNA (without the influence of base-pairing). E : Elongation monitored in real-time by the fluorescence emitted from standing DNA ( F up ) for different dNTP concentrations. F : Elongation rates from E (linear slope) plotted as a function of the dNTP concentration. The line is a Michaelis-Menten fit with K M being the Michaelis constant.

    Article Snippet: The Taq DNA polymerase and deoxyribonucleotides (dNTPs) were obtained from Peqlab (Erlangen, Germany).

    Techniques: Activity Assay, Concentration Assay, Binding Assay, Fluorescence