Structured Review

Kaneka Corp dntp
Dntp, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 98/100, based on 66 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Kaneka Corp
Average 98 stars, based on 66 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-03
98/100 stars

Images

Related Articles

Diagnostic Assay:

Article Title: Wind-dispersed pollen mediates postglacial gene flow among refugia
Article Snippet: We used the obtained sequences to design internal diagnostic primers to remove noninformative border regions and to reduce homoplasic effects. .. The PCR mixture (25 μl) contained 1× PCR buffer, 1.6 mM MgCl2 , 0.2 μM each primer, 0.1 mM each dNTP, 0.5 unit of Taq DNA polymerase (Eurogentec, Cologne, Germany), and 20 ng of template DNA.

Clone Assay:

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: Paragraph title: DNA extraction, amplification, cloning and sequencing ... Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer.

Amplification:

Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
Article Snippet: To amplify the wild-type APQ2 locus, a 20 µl reaction volume contained 1× Coral Load Buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.8 µM of AQP2/3_F 5′-AAGAAGGCTGAAACTCCACTTG-3′ and AQP2_R 5′-CTTCGGGAGAAACAAAACCTC -3′ primers (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µL target DNA. .. Amplification conditions were: initial denaturation at 95°C for 5 min, 24 cycles of 1 min at 95°C followed by 1 min at 60°C and 2 min at 72°C, final extension at 72°C for 10 min.

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: .. Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. The amplifications were performed in a PTC-200 MJ Research Thermal Cycler, programmed for one step at 94 °C for 3 min, followed by 30 cycles (30 s at 94 °C, 30 s at the annealing temperature determined for each primer pair, and 45 s at 72 °C), and a final extension at 72 °C for 3 min. All primers were synthesized by Eurogentec (Maastricht, The Netherlands) (Table S1).

Article Title: Recurrent Domestication by Lepidoptera of Genes from Their Parasites Mediated by Bracoviruses
Article Snippet: To compensate for partial degradation of DNA from old samples, primers were designed for amplification of short fragments. .. A 35-cycle PCR (94°C for 60 s; 50°C for 60 s; 72°C for 60 s) was performed with 10 pmol of each primer, 0.2 mM dNTP (MP Biochemicals), 1.5 mM MgCl2 , 0.5 unit Goldstar (Eurogentec) and 20 ng of genomic DNA.

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: .. Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer. ..

Article Title: Unambiguous Detection of Multiple TP53 Gene Mutations in AAN-Associated Urothelial Cancer in Belgium Using Laser Capture Microdissection
Article Snippet: Nested-PCR Exons 5 to 8, corresponding to the p53 DNA binding domain, a so-called “hot spot” for TP53 gene mutations , were amplified by nested-PCR. .. For the first PCR round, 3 µl of DNA extracted from each microdissected sample was added to a final 50 µL PCR mix including 2.25 mM MgCl2 , 0.2 U/μL Taq Gold polymerase (Ampli Taq Gold, Applied Biosystems, Roche), 0.2 mM dNTP and 0.2 pm/μL primers (Eurogentec, Liège, Belgium) ( ).

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: .. Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The optimized PCR conditions used for the database construction were 94°C for 3 min. followed by 30 cycles of 94°C for 30 s, at the calculated annealing temperature for 30 s, 72°C for 60 s and a final extension at 72°C for 3 min. Unlabeled primers were obtained from Isogen (Maarssen, The Netherlands), fluorescently labelled (HEX, NED, 6-FAM) primers from Applied Biosystems (Warrington, United Kingdom).

Article Title: Wind-dispersed pollen mediates postglacial gene flow among refugia
Article Snippet: The fragment amplified by this new primer pair was named nad 5-4. .. The PCR mixture (25 μl) contained 1× PCR buffer, 1.6 mM MgCl2 , 0.2 μM each primer, 0.1 mM each dNTP, 0.5 unit of Taq DNA polymerase (Eurogentec, Cologne, Germany), and 20 ng of template DNA.

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Nucleic acids from equal amounts of purified VLPs were denatured, reverse transcribed, and amplified by two rounds of PCR amplification. .. Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec).

Article Title: Immunome differences between porcine ileal and jejunal Peyer’s patches revealed by global transcriptome sequencing of gut-associated lymphoid tissues
Article Snippet: Residual genomic DNA was removed using DNase digestion with RNase-free DNase I Amplification Grade (Invitrogen, Cergy Pontoise, France) following the recommended protocol. .. One µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 μl 5X MuMLV buffer (Eurogentec, Liège, Belgium).

Filtration:

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. Fluorescent amplification products were combined (see Table ) and purified using Multiscreen 96-well Sephadex G50 filtration plates (Millipore).

Positive Control:

Article Title: Application of kDNA Minicircle PCR-RFLP to Characterize Leishmania donovani Clinical Isolates Obtained from Post-Kala-Azar Dermal Leishmaniasis in Eastern Nepal
Article Snippet: The PCR were done in 25 µ l containing 1X PCR buffer, 2.5 mM MgCl2 , 200 µ M of each dNTP (Eurogentec), 0.1 mg/ml of bovine serum albumin (Promega), 0.8 µ M of each primer (Sigma-Aldrich), and 0.5 unit of HotStar Taq DNA polymerase (Qiagen, cat. no. 203605). .. In addition, L. donovani isolate DNA (BPK282/0 cl4) as a positive control and two no-template controls were included in each experiment.

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme). .. A positive control in which N.meningitidis genomic DNA was used as a template for PCR was included.

Synthesized:

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. The amplifications were performed in a PTC-200 MJ Research Thermal Cycler, programmed for one step at 94 °C for 3 min, followed by 30 cycles (30 s at 94 °C, 30 s at the annealing temperature determined for each primer pair, and 45 s at 72 °C), and a final extension at 72 °C for 3 min. All primers were synthesized by Eurogentec (Maastricht, The Netherlands) (Table S1).

Electrophoresis:

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. After electrophoresis, the products were visualized through silver staining as described by , and the patterns analyzed for the presence of polymorphism and the quality of the banding pattern, according to .

Acrylamide Gel Assay:

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The amplification products were separated on a 6% acrylamide gel and visualized with silver staining according to Promega Silver sequence DNA sequencing system (Promega, Leiden, The Netherlands) as described [ ].

Incubation:

Article Title: Ostreid herpesvirus 1 detection and relationship with Crassostrea gigas spat mortality in France between 1998 and 2006
Article Snippet: Spat homogenates were incubated in boiling water bath for 10 min, then mixed and centrifuged at 9000 g for 5 min. .. Samples were analysed using the primer pair C2 (CTCTTTACCATGAAGATACCCACC) and C6 (GTGCACGGCTTACCATTTTT) and each 50 μL PCR reaction contained the appropriate reaction buffer (10 mM Tris, pH 8.3; 50 mM KCl), 0.05 mM of each dNTP, 100 ng of each primer, 2.5 mM MgCl2 , 2.5 U of DNA polymerase Goldstar (Eurogentec, Brussels, Belgium) and 1 μL of template DNA.

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme). .. This mixture was incubated at 42°C for 50 min and the enzyme was inactivated by heating to 70°C for 15 min. A control reaction containing the same components but no reverse transcriptase was included to check for DNA contamination.

Modification:

Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
Article Snippet: Locus specific PCR for aquaglyceroporin genes The protocols to amplify either the AQP2 locus or the combined AQP2 and AQP3 locus, including the AQP2/3 chimera were slightly modified from Graf et al. . .. To amplify the wild-type APQ2 locus, a 20 µl reaction volume contained 1× Coral Load Buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.8 µM of AQP2/3_F 5′-AAGAAGGCTGAAACTCCACTTG-3′ and AQP2_R 5′-CTTCGGGAGAAACAAAACCTC -3′ primers (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µL target DNA.

Derivative Assay:

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec). .. A first PCR round was performed with a primer complementary to the tRNAi Met -derived part of the reverse transcription product (oligodeoxynucleotide 65-IMT4 with the same sequence as that of nucleotides 1 to 24 of tRNAi Met [5′AGCGCCGTGGCGCAGTGGAAGCGC3′]) and with primer 1.

Infection:

Article Title: High Complexity of Plasmodium vivax Infections in Symptomatic Patients from a Rural Community in Central Vietnam Detected by Microsatellite Genotyping
Article Snippet: Microsatellite genotyping was conducted only on samples with P. vivax infection confirmed by species-specific PCR. .. The final reactions contained 1× buffer 1.5 mM MgCl2 (Qiagen), 50 µM of each dNTP (Eurogentec, Liege, Belgium), 0.1 µg/µL acetylated bovine serum albumin (Promega, Madison, WI), 0.2 µM of each primer , and one unit of HotstarTaq Plus DNA polymerase (Qiagen).

Generated:

Article Title: Immunome differences between porcine ileal and jejunal Peyer’s patches revealed by global transcriptome sequencing of gut-associated lymphoid tissues
Article Snippet: One µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 μl 5X MuMLV buffer (Eurogentec, Liège, Belgium). .. After heat-inactivation at 93 °C for 5 min, generated cDNA was stored at −80 °C until use.

Polymerase Chain Reaction:

Article Title: Ostreid herpesvirus 1 detection and relationship with Crassostrea gigas spat mortality in France between 1998 and 2006
Article Snippet: .. Samples were analysed using the primer pair C2 (CTCTTTACCATGAAGATACCCACC) and C6 (GTGCACGGCTTACCATTTTT) and each 50 μL PCR reaction contained the appropriate reaction buffer (10 mM Tris, pH 8.3; 50 mM KCl), 0.05 mM of each dNTP, 100 ng of each primer, 2.5 mM MgCl2 , 2.5 U of DNA polymerase Goldstar (Eurogentec, Brussels, Belgium) and 1 μL of template DNA. .. Amplifications were performed with an initial denaturation step at 94°C followed by 35 cycles at 94°C for 1 min, 50°C for 1 min and 72°C for 1 min with a final elongation at 72°C for 5 min. PCR products were separated on 1% agarose gel containing ethidium bromide (0.1 μg/mL) and visualised using a UV transilluminator.

Article Title: High Complexity of Plasmodium vivax Infections in Symptomatic Patients from a Rural Community in Central Vietnam Detected by Microsatellite Genotyping
Article Snippet: Microsatellite genotyping was conducted only on samples with P. vivax infection confirmed by species-specific PCR. .. The final reactions contained 1× buffer 1.5 mM MgCl2 (Qiagen), 50 µM of each dNTP (Eurogentec, Liege, Belgium), 0.1 µg/µL acetylated bovine serum albumin (Promega, Madison, WI), 0.2 µM of each primer , and one unit of HotstarTaq Plus DNA polymerase (Qiagen).

Article Title: Application of kDNA Minicircle PCR-RFLP to Characterize Leishmania donovani Clinical Isolates Obtained from Post-Kala-Azar Dermal Leishmaniasis in Eastern Nepal
Article Snippet: .. The PCR were done in 25 µ l containing 1X PCR buffer, 2.5 mM MgCl2 , 200 µ M of each dNTP (Eurogentec), 0.1 mg/ml of bovine serum albumin (Promega), 0.8 µ M of each primer (Sigma-Aldrich), and 0.5 unit of HotStar Taq DNA polymerase (Qiagen, cat. no. 203605). ..

Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
Article Snippet: Paragraph title: Locus specific PCR for aquaglyceroporin genes ... To amplify the wild-type APQ2 locus, a 20 µl reaction volume contained 1× Coral Load Buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.8 µM of AQP2/3_F 5′-AAGAAGGCTGAAACTCCACTTG-3′ and AQP2_R 5′-CTTCGGGAGAAACAAAACCTC -3′ primers (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µL target DNA.

Article Title: Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic
Article Snippet: .. The PCR mixture contained 2.5 μl 10× buffer (Eurogentec, USA), 1.5 MgCl2 , 1 mM dNTP (Eurogentec, USA), 1 μl of 1/10 of each primer, 0.1 μl of Diamond Taq DNA polymerase (Eurogentec, USA) and 4 μl of 1/50 diluted total DNA in a total volume of 25 μl. .. DNA was amplified in a GeneAmp 9600 thermal cycler (PerkinElmer, USA) under the following conditions: 94 °C for 3 min, followed by 40 cycles of 30 s at 94 °C, 45 s at the annealing temperature 64 °C, 45 s at 72 °C and 10 min at 72 °C.

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: .. Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. The amplifications were performed in a PTC-200 MJ Research Thermal Cycler, programmed for one step at 94 °C for 3 min, followed by 30 cycles (30 s at 94 °C, 30 s at the annealing temperature determined for each primer pair, and 45 s at 72 °C), and a final extension at 72 °C for 3 min. All primers were synthesized by Eurogentec (Maastricht, The Netherlands) (Table S1).

Article Title: Recurrent Domestication by Lepidoptera of Genes from Their Parasites Mediated by Bracoviruses
Article Snippet: .. A 35-cycle PCR (94°C for 60 s; 50°C for 60 s; 72°C for 60 s) was performed with 10 pmol of each primer, 0.2 mM dNTP (MP Biochemicals), 1.5 mM MgCl2 , 0.5 unit Goldstar (Eurogentec) and 20 ng of genomic DNA. .. PCR products (8 μl) were run on 1.5% agarose gels.

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: .. Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer. ..

Article Title: Unambiguous Detection of Multiple TP53 Gene Mutations in AAN-Associated Urothelial Cancer in Belgium Using Laser Capture Microdissection
Article Snippet: .. For the first PCR round, 3 µl of DNA extracted from each microdissected sample was added to a final 50 µL PCR mix including 2.25 mM MgCl2 , 0.2 U/μL Taq Gold polymerase (Ampli Taq Gold, Applied Biosystems, Roche), 0.2 mM dNTP and 0.2 pm/μL primers (Eurogentec, Liège, Belgium) ( ). ..

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The optimized PCR conditions used for the database construction were 94°C for 3 min. followed by 30 cycles of 94°C for 30 s, at the calculated annealing temperature for 30 s, 72°C for 60 s and a final extension at 72°C for 3 min. Unlabeled primers were obtained from Isogen (Maarssen, The Netherlands), fluorescently labelled (HEX, NED, 6-FAM) primers from Applied Biosystems (Warrington, United Kingdom).

Article Title: Wind-dispersed pollen mediates postglacial gene flow among refugia
Article Snippet: .. The PCR mixture (25 μl) contained 1× PCR buffer, 1.6 mM MgCl2 , 0.2 μM each primer, 0.1 mM each dNTP, 0.5 unit of Taq DNA polymerase (Eurogentec, Cologne, Germany), and 20 ng of template DNA. .. The initial denaturation for 3 min at 94°C was followed by 30 cycles of denaturation (1 min at 92°C), annealing (1 min at 52.5°C), and extension (1 min 20 sec at 72°C), and a final extension step of 8 min at 72°C.

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Nucleic acids from equal amounts of purified VLPs were denatured, reverse transcribed, and amplified by two rounds of PCR amplification. .. Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec).

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme). .. The cDNA products (2 µl) were then used in a PCR performed in a final volume of 50 µl containing 1 U of Biotools DNA polymerase (B & M Labs SA), 1 mM dNTP, manufacturer’s buffer (provided with the enzyme) and 10 pmol of each primer.

Article Title: The activation-dependent induction of APN-(CD13) in T-cells is controlled at different levels of gene expression.
Article Snippet: .. Competitive PCR An aliquot of the cDNA mixture was used directly for enzymatic amplifications which were performed in a 40 (xl reaction volume containing 0.5 U 'Gold-Star' polymerase (Eurogentec), 0.25 mM dNTP, 2.5 mM MgCl 2 , 0.2 pmol of primers (forward: 5'-gccgtgtgcacaatcatcgcact; reverse: 5'-caccagggagcccttgaggtg) and IX reaction buffer (Eurogentec) in the thermocycler Autogene II (CLF, Emmersacker, Germany). ..

DNA Sequencing:

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The amplification products were separated on a 6% acrylamide gel and visualized with silver staining according to Promega Silver sequence DNA sequencing system (Promega, Leiden, The Netherlands) as described [ ].

Sequencing:

Article Title: Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic
Article Snippet: The sodium channel gene was examined by PCR and direct sequencing of fragment encoding to verify the presence of mutations at I1011M or I1011V , V1016G or V1016I and F1534C in Ae. aegypti and F1534C in Ae. albopictus . .. The PCR mixture contained 2.5 μl 10× buffer (Eurogentec, USA), 1.5 MgCl2 , 1 mM dNTP (Eurogentec, USA), 1 μl of 1/10 of each primer, 0.1 μl of Diamond Taq DNA polymerase (Eurogentec, USA) and 4 μl of 1/50 diluted total DNA in a total volume of 25 μl.

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. The PCR products were separated on 6% polyacrylamide gels, by using a Sequi-Gen Sequencing Cell (Bio-Rad) apparatus at 110W for 1-3 h in 1x TBE buffer.

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: Paragraph title: DNA extraction, amplification, cloning and sequencing ... Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer.

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The amplification products were separated on a 6% acrylamide gel and visualized with silver staining according to Promega Silver sequence DNA sequencing system (Promega, Leiden, The Netherlands) as described [ ].

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec). .. A first PCR round was performed with a primer complementary to the tRNAi Met -derived part of the reverse transcription product (oligodeoxynucleotide 65-IMT4 with the same sequence as that of nucleotides 1 to 24 of tRNAi Met [5′AGCGCCGTGGCGCAGTGGAAGCGC3′]) and with primer 1.

Article Title: Immunome differences between porcine ileal and jejunal Peyer’s patches revealed by global transcriptome sequencing of gut-associated lymphoid tissues
Article Snippet: Paragraph title: RNA extraction and sequencing ... One µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 μl 5X MuMLV buffer (Eurogentec, Liège, Belgium).

Binding Assay:

Article Title: Unambiguous Detection of Multiple TP53 Gene Mutations in AAN-Associated Urothelial Cancer in Belgium Using Laser Capture Microdissection
Article Snippet: Nested-PCR Exons 5 to 8, corresponding to the p53 DNA binding domain, a so-called “hot spot” for TP53 gene mutations , were amplified by nested-PCR. .. For the first PCR round, 3 µl of DNA extracted from each microdissected sample was added to a final 50 µL PCR mix including 2.25 mM MgCl2 , 0.2 U/μL Taq Gold polymerase (Ampli Taq Gold, Applied Biosystems, Roche), 0.2 mM dNTP and 0.2 pm/μL primers (Eurogentec, Liège, Belgium) ( ).

DNA Extraction:

Article Title: Application of kDNA Minicircle PCR-RFLP to Characterize Leishmania donovani Clinical Isolates Obtained from Post-Kala-Azar Dermal Leishmaniasis in Eastern Nepal
Article Snippet: Paragraph title: 2.2. Parasite DNA Extraction and Species Identification ... The PCR were done in 25 µ l containing 1X PCR buffer, 2.5 mM MgCl2 , 200 µ M of each dNTP (Eurogentec), 0.1 mg/ml of bovine serum albumin (Promega), 0.8 µ M of each primer (Sigma-Aldrich), and 0.5 unit of HotStar Taq DNA polymerase (Qiagen, cat. no. 203605).

Article Title: Recurrent Domestication by Lepidoptera of Genes from Their Parasites Mediated by Bracoviruses
Article Snippet: Paragraph title: DNA extraction and PCR analyses of insertions in Danaina subtribe ... A 35-cycle PCR (94°C for 60 s; 50°C for 60 s; 72°C for 60 s) was performed with 10 pmol of each primer, 0.2 mM dNTP (MP Biochemicals), 1.5 mM MgCl2 , 0.5 unit Goldstar (Eurogentec) and 20 ng of genomic DNA.

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: Paragraph title: DNA extraction, amplification, cloning and sequencing ... Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer.

Mutagenesis:

Article Title: Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic
Article Snippet: Paragraph title: Screening of kdr mutation in Aedes aegypti and Aedes albopictus ... The PCR mixture contained 2.5 μl 10× buffer (Eurogentec, USA), 1.5 MgCl2 , 1 mM dNTP (Eurogentec, USA), 1 μl of 1/10 of each primer, 0.1 μl of Diamond Taq DNA polymerase (Eurogentec, USA) and 4 μl of 1/50 diluted total DNA in a total volume of 25 μl.

Isolation:

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: Paragraph title: RNA isolation and RT–PCR assays ... Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme).

Negative Control:

Article Title: Unambiguous Detection of Multiple TP53 Gene Mutations in AAN-Associated Urothelial Cancer in Belgium Using Laser Capture Microdissection
Article Snippet: For the first PCR round, 3 µl of DNA extracted from each microdissected sample was added to a final 50 µL PCR mix including 2.25 mM MgCl2 , 0.2 U/μL Taq Gold polymerase (Ampli Taq Gold, Applied Biosystems, Roche), 0.2 mM dNTP and 0.2 pm/μL primers (Eurogentec, Liège, Belgium) ( ). .. Ultrapure water was used as negative control whereas DNA extracted from unrelated blood samples was used as control for TP53 amplification.

Size-exclusion Chromatography:

Article Title: Wind-dispersed pollen mediates postglacial gene flow among refugia
Article Snippet: The PCR mixture (25 μl) contained 1× PCR buffer, 1.6 mM MgCl2 , 0.2 μM each primer, 0.1 mM each dNTP, 0.5 unit of Taq DNA polymerase (Eurogentec, Cologne, Germany), and 20 ng of template DNA. .. The initial denaturation for 3 min at 94°C was followed by 30 cycles of denaturation (1 min at 92°C), annealing (1 min at 52.5°C), and extension (1 min 20 sec at 72°C), and a final extension step of 8 min at 72°C.

Purification:

Article Title: Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic
Article Snippet: The PCR mixture contained 2.5 μl 10× buffer (Eurogentec, USA), 1.5 MgCl2 , 1 mM dNTP (Eurogentec, USA), 1 μl of 1/10 of each primer, 0.1 μl of Diamond Taq DNA polymerase (Eurogentec, USA) and 4 μl of 1/50 diluted total DNA in a total volume of 25 μl. .. PCR products (10 μl) were migrated on 1.5% agarose gel in TAE buffer, purified with AMPure® Agencourt® (Beckman Coulter, Danvers MA, USA) when they contained amplified fragments of the expected size and then sequenced with a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA).

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. Fluorescent amplification products were combined (see Table ) and purified using Multiscreen 96-well Sephadex G50 filtration plates (Millipore).

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Nucleic acids from equal amounts of purified VLPs were denatured, reverse transcribed, and amplified by two rounds of PCR amplification. .. Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec).

Article Title: Immunome differences between porcine ileal and jejunal Peyer’s patches revealed by global transcriptome sequencing of gut-associated lymphoid tissues
Article Snippet: For blood samples, no globin depletion procedure was applied, and RNA purification was performed as reported in Maroilley et al . .. One µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 μl 5X MuMLV buffer (Eurogentec, Liège, Belgium).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: Paragraph title: Analysis of minus-strand strong-stop DNA by RT-PCR. ... Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec).

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: Paragraph title: RNA isolation and RT–PCR assays ... Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme).

Nested PCR:

Article Title: Unambiguous Detection of Multiple TP53 Gene Mutations in AAN-Associated Urothelial Cancer in Belgium Using Laser Capture Microdissection
Article Snippet: Paragraph title: Nested-PCR ... For the first PCR round, 3 µl of DNA extracted from each microdissected sample was added to a final 50 µL PCR mix including 2.25 mM MgCl2 , 0.2 U/μL Taq Gold polymerase (Ampli Taq Gold, Applied Biosystems, Roche), 0.2 mM dNTP and 0.2 pm/μL primers (Eurogentec, Liège, Belgium) ( ).

Agarose Gel Electrophoresis:

Article Title: Ostreid herpesvirus 1 detection and relationship with Crassostrea gigas spat mortality in France between 1998 and 2006
Article Snippet: Samples were analysed using the primer pair C2 (CTCTTTACCATGAAGATACCCACC) and C6 (GTGCACGGCTTACCATTTTT) and each 50 μL PCR reaction contained the appropriate reaction buffer (10 mM Tris, pH 8.3; 50 mM KCl), 0.05 mM of each dNTP, 100 ng of each primer, 2.5 mM MgCl2 , 2.5 U of DNA polymerase Goldstar (Eurogentec, Brussels, Belgium) and 1 μL of template DNA. .. Amplifications were performed with an initial denaturation step at 94°C followed by 35 cycles at 94°C for 1 min, 50°C for 1 min and 72°C for 1 min with a final elongation at 72°C for 5 min. PCR products were separated on 1% agarose gel containing ethidium bromide (0.1 μg/mL) and visualised using a UV transilluminator.

Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
Article Snippet: To amplify the wild-type APQ2 locus, a 20 µl reaction volume contained 1× Coral Load Buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.8 µM of AQP2/3_F 5′-AAGAAGGCTGAAACTCCACTTG-3′ and AQP2_R 5′-CTTCGGGAGAAACAAAACCTC -3′ primers (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µL target DNA. .. Ten µl of the PCR product were electrophorised in a 2% agarose gel for 30 min at 135 V and stained with ethidium bromide for detection of the amplicons.

Article Title: Susceptibility profile and metabolic mechanisms involved in Aedes aegypti and Aedes albopictus resistant to DDT and deltamethrin in the Central African Republic
Article Snippet: The PCR mixture contained 2.5 μl 10× buffer (Eurogentec, USA), 1.5 MgCl2 , 1 mM dNTP (Eurogentec, USA), 1 μl of 1/10 of each primer, 0.1 μl of Diamond Taq DNA polymerase (Eurogentec, USA) and 4 μl of 1/50 diluted total DNA in a total volume of 25 μl. .. PCR products (10 μl) were migrated on 1.5% agarose gel in TAE buffer, purified with AMPure® Agencourt® (Beckman Coulter, Danvers MA, USA) when they contained amplified fragments of the expected size and then sequenced with a BigDye Terminator v3.1 Cycle sequencing kit (Applied Biosystems, USA).

Article Title: The activation-dependent induction of APN-(CD13) in T-cells is controlled at different levels of gene expression.
Article Snippet: Competitive PCR An aliquot of the cDNA mixture was used directly for enzymatic amplifications which were performed in a 40 (xl reaction volume containing 0.5 U 'Gold-Star' polymerase (Eurogentec), 0.25 mM dNTP, 2.5 mM MgCl 2 , 0.2 pmol of primers (forward: 5'-gccgtgtgcacaatcatcgcact; reverse: 5'-caccagggagcccttgaggtg) and IX reaction buffer (Eurogentec) in the thermocycler Autogene II (CLF, Emmersacker, Germany). .. The final extension step was 72°C for 10 min. An aliquot of the PCR reaction was electrophoretically separated in a 1.6% agarose gel (Biozym, Germany), documented by a video image system (GelPrint 2000i, MWG Biotech, Germany) and densitometrically analysed using RFLP 3.0 software (Scanalytics, USA).

Silver Staining:

Article Title: Development of microsatellite markers for identifying Brazilian Coffea arabica varieties
Article Snippet: Microsatellite analysis Microsatellites were amplified by PCR in a 20 μL reaction volume, containing 10 mM of Tris-HCl pH 9.0, 20 mM of (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 , 0.1 mM of each dNTP, 4 pmol of each primer, 0.2 units of Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands), and 16 ng of genomic DNA. .. After electrophoresis, the products were visualized through silver staining as described by , and the patterns analyzed for the presence of polymorphism and the quality of the banding pattern, according to .

Article Title: Characterisation of sugar beet (Beta vulgaris L. ssp. vulgaris) varieties using microsatellite markers
Article Snippet: Microsatellite amplification and detection Microsatellites were amplified in a 20 μl reaction volume containing 20 ng of genomic DNA, 2-10 pmol of each primer, 100 μM of each dNTP, 10 mM Tris-HCL pH 9.0, 20 mM (NH4 )2 SO4 , 0.01% Tween 20, 1.5 mM MgCl2 and 0.3 Units Goldstar Taq DNA polymerase (Eurogentec, Maastricht, The Netherlands). .. The amplification products were separated on a 6% acrylamide gel and visualized with silver staining according to Promega Silver sequence DNA sequencing system (Promega, Leiden, The Netherlands) as described [ ].

Plasmid Preparation:

Article Title: Viral cystatin evolution and three-dimensional structure modelling: A case of directional selection acting on a viral protein involved in a host-parasitoid interaction
Article Snippet: Polymerase chain reaction (PCR) amplification was performed in a 50 μl volume containing 1× Taq buffer, 3 mM of MgCl2 , 2.5 mM of dNTP, 0.3 μl Taq polymerase (Goldstar, Eurogentec) and 50 pmol of each primer. .. PCR products were cloned into the pDrive-cloning vector (Qiagen cloning kit).

Software:

Article Title: The activation-dependent induction of APN-(CD13) in T-cells is controlled at different levels of gene expression.
Article Snippet: Competitive PCR An aliquot of the cDNA mixture was used directly for enzymatic amplifications which were performed in a 40 (xl reaction volume containing 0.5 U 'Gold-Star' polymerase (Eurogentec), 0.25 mM dNTP, 2.5 mM MgCl 2 , 0.2 pmol of primers (forward: 5'-gccgtgtgcacaatcatcgcact; reverse: 5'-caccagggagcccttgaggtg) and IX reaction buffer (Eurogentec) in the thermocycler Autogene II (CLF, Emmersacker, Germany). .. The final extension step was 72°C for 10 min. An aliquot of the PCR reaction was electrophoretically separated in a 1.6% agarose gel (Biozym, Germany), documented by a video image system (GelPrint 2000i, MWG Biotech, Germany) and densitometrically analysed using RFLP 3.0 software (Scanalytics, USA).

RNA Extraction:

Article Title: Immunome differences between porcine ileal and jejunal Peyer’s patches revealed by global transcriptome sequencing of gut-associated lymphoid tissues
Article Snippet: Paragraph title: RNA extraction and sequencing ... One µg of total RNA was reverse transcribed for 90 min at 37 °C in a 20 µl volume containing 0.25 mM dNTP of OligodT, 25 U of MuMLV reverse transcriptase in 4 μl 5X MuMLV buffer (Eurogentec, Liège, Belgium).

Sample Prep:

Article Title: Ostreid herpesvirus 1 detection and relationship with Crassostrea gigas spat mortality in France between 1998 and 2006
Article Snippet: Paragraph title: Animal sample preparation and OsHV-1 PCR analysis ... Samples were analysed using the primer pair C2 (CTCTTTACCATGAAGATACCCACC) and C6 (GTGCACGGCTTACCATTTTT) and each 50 μL PCR reaction contained the appropriate reaction buffer (10 mM Tris, pH 8.3; 50 mM KCl), 0.05 mM of each dNTP, 100 ng of each primer, 2.5 mM MgCl2 , 2.5 U of DNA polymerase Goldstar (Eurogentec, Brussels, Belgium) and 1 μL of template DNA.

Ethanol Precipitation:

Article Title: The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane
Article Snippet: This enzyme was later eliminated by extraction twice with phenol/chloroform/isoamylalcohol (25:24:1) followed by ethanol precipitation. .. Reverse transcription was performed with Superscript II reverse transcriptase (Life Technologies), in a final volume of 20 µl containing 10 mM dithiothreitol, 1 mM dNTP (Eurogentec), 50 U of reverse transcriptase and the manufacturer’s buffer (provided with the enzyme).

Concentration Assay:

Article Title: Application of kDNA Minicircle PCR-RFLP to Characterize Leishmania donovani Clinical Isolates Obtained from Post-Kala-Azar Dermal Leishmaniasis in Eastern Nepal
Article Snippet: DNA concentration and purity were verified by spectrophotometric measurement with the BioPhotometer plus (Eppendorf). .. The PCR were done in 25 µ l containing 1X PCR buffer, 2.5 mM MgCl2 , 200 µ M of each dNTP (Eurogentec), 0.1 mg/ml of bovine serum albumin (Promega), 0.8 µ M of each primer (Sigma-Aldrich), and 0.5 unit of HotStar Taq DNA polymerase (Qiagen, cat. no. 203605).

Article Title: Interactions between Ty1 Retrotransposon RNA and the T and D Regions of the tRNAiMet Primer Are Required for Initiation of Reverse Transcription In Vivo
Article Snippet: .. Reverse transcription was done at 42°C for 60 min. After denaturation of AMV-RT at 95°C for 5 min, the reverse transcription mixture was adjusted to a final volume of 100 μl containing 10 mM Tris-HCl (pH 7.8), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM each dNTP, a 2 μM concentration of the appropriate primers, and 2.5 U of Goldstar DNA polymerase (Eurogentec). .. A first PCR round was performed with a primer complementary to the tRNAi Met -derived part of the reverse transcription product (oligodeoxynucleotide 65-IMT4 with the same sequence as that of nucleotides 1 to 24 of tRNAi Met [5′AGCGCCGTGGCGCAGTGGAAGCGC3′]) and with primer 1.

Marker:

Article Title: Wind-dispersed pollen mediates postglacial gene flow among refugia
Article Snippet: Paragraph title: mtDNA Marker. ... The PCR mixture (25 μl) contained 1× PCR buffer, 1.6 mM MgCl2 , 0.2 μM each primer, 0.1 mM each dNTP, 0.5 unit of Taq DNA polymerase (Eurogentec, Cologne, Germany), and 20 ng of template DNA.

Staining:

Article Title: Melarsoprol Sensitivity Profile of Trypanosoma brucei gambiense Isolates from Cured and Relapsed Sleeping Sickness Patients from the Democratic Republic of the Congo
Article Snippet: To amplify the wild-type APQ2 locus, a 20 µl reaction volume contained 1× Coral Load Buffer (Qiagen), 1 mM MgCl2 (Qiagen), 200 µM of each dNTP (Eurogentec), 0.8 µM of AQP2/3_F 5′-AAGAAGGCTGAAACTCCACTTG-3′ and AQP2_R 5′-CTTCGGGAGAAACAAAACCTC -3′ primers (Biolegio), 0.4 U Hotstart Taq plus polymerase (Qiagen), 0.1 mg/ml acetylated BSA (Promega) and 2 µL target DNA. .. Ten µl of the PCR product were electrophorised in a 2% agarose gel for 30 min at 135 V and stained with ethidium bromide for detection of the amplicons.