Structured Review

Fisher Scientific dntp
Dntp, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dntp/product/Fisher Scientific
Average 99 stars, based on 32 article reviews
Price from $9.99 to $1999.99
dntp - by Bioz Stars, 2020-03
99/100 stars

Images

Related Articles

Amplification:

Article Title: Dominant Fecal Microbiota in Newly Diagnosed Untreated Inflammatory Bowel Disease Patients
Article Snippet: Each PCR reaction was performed in a total volume of 25 μ L, and the PCR conditions were as follows: HotFirePol 1.25 U (Solis Biodyne, Tartu, Estonia), B2 buffer 1x (SolisBiodyne), MgCl2 2.5 mM (Solis Biodyne), dNTP 200 μ M (Termo Fisher scientific, Surrey, USA), forward primer 0.2 μ M, reverse primer 0.2 μ M. The amount of DNA template used was 5 ng. .. The 16S rRNA genes were PCR amplified from each DNA extract using the GA universal cover-all 16S rRNA primers (Genetic Analysis, Oslo, Norway), providing a PCR product of approximately 1200 bp [ ].

Article Title: E47 is required for V(D)J recombinase activity in common lymphoid progenitors
Article Snippet: .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl2 , 1X Buffer A (Fisher Scientific), and 4 μM of each primer. ..

Article Title: A Toll-like Receptor 1 Polymorphism Is Associated with Heightened T-helper 1 Inflammatory Responses and Antibiotic-Refractory Lyme Arthritis
Article Snippet: .. Isolated genomic DNA (~50 ng) from each patient was amplified in a 50 µl reaction containing 200 µM of dNTP (Fisher Scientific, Springfield, NJ), 0.5 µM of forward and reverse PCR primers (IDT, Eugene, OR), and 2.5 units of HotStarTaq DNA polymerase (Qiagen). .. PCR reactions were performed with the following primers: for TLR1, the forward primer was CTTGATCTTCACAGCAATAAAATAAAGAGCATT and reverse primer was GGCCATGATACACTAGAACACACATCACT ( ); for TLR2, the forward primer was GCCTACTGGGTGGAGAACCT and the reverse primer was GGCCACTCCAGGTAGGTCTT , and for TLR5, the forward primer was GGTAGCCTACATTGATTTGC, and the reverse primer was GAGAATCTGGAGATGAGGTACCCG ( ).

Article Title: Myelogenous Leukemia in Adult Inbred MHC Defined Miniature Swine: a model for human myeloid leukemias
Article Snippet: The reaction consisted of 1x buffer A (Fisher Scientific Co), 1uM of each primer, 200uM each dNTP (Fisher Scientific Co.) and 2.5U Taq polymerase (Fisher Scientific Co.) in a final volume of 50ul. .. The GAPDH RT-PCR reactions were done under the same conditions using primers 314 (5’-GGATTTGGTCGTATTGGGC-3’) and 315 (5’-TGAGCTTGACAAAGTGGTCG-3’) and thirty cycles of amplification.

Article Title: B Lineage-specific Regulation of V(D)J Recombinase Activity Is Established in Common Lymphoid Progenitors
Article Snippet: .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP + dTTP + dCTP + dGTP), 2.5 U Taq, 4 mM MgCl2 , 1× buffer A (Fisher Scientific), and 4 μM of each primer. ..

Article Title: Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome
Article Snippet: Paragraph title: 16S rRNA PCR amplification for library construction ... All PCR reactions had a final volume of 50 μl containing 25 μl Master mix (50 units per ml of Taq DNA polymerase supplied in a reaction buffer (pH 8.5), 400 μ each dNTP, 3 m MgCl2), 10 μ of each primer, 2.5 μl of DMSO (Dimethyl Sulfoxide, Fisher Scientific, Loughborough, Leicestershire, UK), 2 μl bovine serum albumin (BSA 10 mg per ml, SIGMA, St Louis, MO, USA) and 1–3 μl of template DNA (50–100 ng) were carried out using the following conditions: 1 cycle of 95 °C for 2 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min with a final extension of 72 °C for 10 min.

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min. .. RT-PCR amplification of Nppc One-step RT-PCR kit (Invitrogen, Carlsbad, CA) was used to detect the expression of mutated Nppc at the mRNA level.

Article Title: Comparative genomics and evolution of conserved noncoding elements (CNE) in rainbow trout
Article Snippet: The PCR reaction mixture consisted of 30 ng of template DNA, 1× PCR buffer, 0.2 mM each dNTP (Fisher Scientific), 0.1 μM of each primer, 2 mM MgCl2 and 0.15 U of the GoTaq DNA polymerase (Promega). .. The PCR cocktails were then subjected to the following amplification conditions: initial denaturation at 94°C for 4 min followed by 35 amplification cycles of 94°C for 20 s, 48–62°C for 20 s and 72°C for 30 s. Details on the mutation detection strategies and linkage mapping have previously been outlined [ , - ].

Polymerase Chain Reaction:

Article Title: Dominant Fecal Microbiota in Newly Diagnosed Untreated Inflammatory Bowel Disease Patients
Article Snippet: .. Each PCR reaction was performed in a total volume of 25 μ L, and the PCR conditions were as follows: HotFirePol 1.25 U (Solis Biodyne, Tartu, Estonia), B2 buffer 1x (SolisBiodyne), MgCl2 2.5 mM (Solis Biodyne), dNTP 200 μ M (Termo Fisher scientific, Surrey, USA), forward primer 0.2 μ M, reverse primer 0.2 μ M. The amount of DNA template used was 5 ng. .. Amplicons were checked with 1.5% Agarose gel (80 V; 60 min).

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: At the VGL, an allele specific assay was developed for the detection of c.364C > T. Each PCR contained 3μl of template DNA isolated as previously described [ ]. .. Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.).

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Article Snippet: .. PCR was performed in a final volume of 10 μl containing 1 to 10 ng genomic DNA, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.3, 0.2 mmol/L of each dNTP, 1 μmol/L of each primer, 0.5 U Taq polymerase (Fisher Scientific, Pittsburgh, PA). .. PCR conditions consisted of initial denaturation at 95°C for 5 minutes, 31 cycles of 95°C for 30 seconds, 52°C for 30 seconds, and 72°C for 40 seconds, and a final extension step of 10 minutes at 72°C.

Article Title: FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Article Snippet: .. 2 ul of the RT reaction was then mixed with 1 ul of 10X PCR Buffer (500 mM Tris-HCl (pH8.3), 2.5 mg/ml crystalline BSA and MgCl2 at 10, 20 or 30 mM (Idaho Technology Inc., Idaho Falls, ID), 0.2 mM each dNTP, 0.05 μM of each primer and 1.25 Units Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA) in a total volume of 10 μl. .. Reactions were loaded into a capillary tube and PCR cycles were carried out using the Rapidcycler Thermal cycler (Idaho Technology).

Article Title: E47 is required for V(D)J recombinase activity in common lymphoid progenitors
Article Snippet: .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl2 , 1X Buffer A (Fisher Scientific), and 4 μM of each primer. ..

Article Title: A Toll-like Receptor 1 Polymorphism Is Associated with Heightened T-helper 1 Inflammatory Responses and Antibiotic-Refractory Lyme Arthritis
Article Snippet: .. Isolated genomic DNA (~50 ng) from each patient was amplified in a 50 µl reaction containing 200 µM of dNTP (Fisher Scientific, Springfield, NJ), 0.5 µM of forward and reverse PCR primers (IDT, Eugene, OR), and 2.5 units of HotStarTaq DNA polymerase (Qiagen). .. PCR reactions were performed with the following primers: for TLR1, the forward primer was CTTGATCTTCACAGCAATAAAATAAAGAGCATT and reverse primer was GGCCATGATACACTAGAACACACATCACT ( ); for TLR2, the forward primer was GCCTACTGGGTGGAGAACCT and the reverse primer was GGCCACTCCAGGTAGGTCTT , and for TLR5, the forward primer was GGTAGCCTACATTGATTTGC, and the reverse primer was GAGAATCTGGAGATGAGGTACCCG ( ).

Article Title: Prevalence of Tick-Borne Pathogens in Northeast Missouri
Article Snippet: .. PCR reactions of 25 μl contained 1.0 μM of each primer (Fisher Scientific, Pittsburgh, PA), 10 mM of each dNTP, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2 , 1.25 U of Taq DNA Polymerase (Fisher Scientific, Pittsburgh, PA), and 100 ng of extracted DNA from pooled ticks. .. With every PCR assay, a positive and negative control was included.

Article Title: Myelogenous Leukemia in Adult Inbred MHC Defined Miniature Swine: a model for human myeloid leukemias
Article Snippet: Paragraph title: Polymerase Chain Reaction (PCR) ... The reaction consisted of 1x buffer A (Fisher Scientific Co), 1uM of each primer, 200uM each dNTP (Fisher Scientific Co.) and 2.5U Taq polymerase (Fisher Scientific Co.) in a final volume of 50ul.

Article Title: TGF-β Effects on Prostate Cancer Cell Migration and Invasion Require FosB
Article Snippet: Total RNAs (2 μg) were reverse transcribed in a 50 μl reaction mixture containing 0.5 mM dNTP (Fisher Scientific, Pittsburgh, PA), 0.5 mM dithiotreitol (Bio-Rad), 0.5 μg of oligo dT, and 400 U of M-MLV Reverse Transcriptase (Promega) at 37°C for 1.5 hr. .. PCR was performed to detect mRNA levels of FosB1, FosB2, cFos, Fra1, Fra2, and L-19.

Article Title: B Lineage-specific Regulation of V(D)J Recombinase Activity Is Established in Common Lymphoid Progenitors
Article Snippet: .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP + dTTP + dCTP + dGTP), 2.5 U Taq, 4 mM MgCl2 , 1× buffer A (Fisher Scientific), and 4 μM of each primer. ..

Article Title: Ovine pedomics: the first study of the ovine foot 16S rRNA-based microbiome
Article Snippet: .. All PCR reactions had a final volume of 50 μl containing 25 μl Master mix (50 units per ml of Taq DNA polymerase supplied in a reaction buffer (pH 8.5), 400 μ each dNTP, 3 m MgCl2), 10 μ of each primer, 2.5 μl of DMSO (Dimethyl Sulfoxide, Fisher Scientific, Loughborough, Leicestershire, UK), 2 μl bovine serum albumin (BSA 10 mg per ml, SIGMA, St Louis, MO, USA) and 1–3 μl of template DNA (50–100 ng) were carried out using the following conditions: 1 cycle of 95 °C for 2 min, 35 cycles of 95 °C for 1 min, 55 °C for 1 min and 72 °C for 2 min with a final extension of 72 °C for 10 min. .. To test the reliability of D. nodosus extraction, PCR reactions were carried out using a direct or a nested PCR approach.

Article Title: Temporal Dynamics of the Microbial Community Composition with a Focus on Toxic Cyanobacteria and Toxin Presence during Harmful Algal Blooms in Two South German Lakes
Article Snippet: The initial PCR reaction was performed with the primer pair mcy E-F2/mcy E-R4 described in (see Table ). .. A 50-μL reaction volume was used with 2.5 U DreamTaq DNA polymerase and DreamTaq buffer (10x) (Fisher Scientific, Schwerte, Germany), 0.75 mM MgCl2 , 0.2 μM of each primer, 0.15 mM dNTP (Fisher Scientific, Schwerte, Germany), and 0.1 mg/mL BSA (Fisher Scientific, Schwerte, Germany).

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min. .. RT-PCR amplification of Nppc One-step RT-PCR kit (Invitrogen, Carlsbad, CA) was used to detect the expression of mutated Nppc at the mRNA level.

Article Title: Comparative genomics and evolution of conserved noncoding elements (CNE) in rainbow trout
Article Snippet: .. The PCR reaction mixture consisted of 30 ng of template DNA, 1× PCR buffer, 0.2 mM each dNTP (Fisher Scientific), 0.1 μM of each primer, 2 mM MgCl2 and 0.15 U of the GoTaq DNA polymerase (Promega). .. The PCR cocktails were then subjected to the following amplification conditions: initial denaturation at 94°C for 4 min followed by 35 amplification cycles of 94°C for 20 s, 48–62°C for 20 s and 72°C for 30 s. Details on the mutation detection strategies and linkage mapping have previously been outlined [ , - ].

TA Cloning:

Article Title: Temporal Dynamics of the Microbial Community Composition with a Focus on Toxic Cyanobacteria and Toxin Presence during Harmful Algal Blooms in Two South German Lakes
Article Snippet: A 50-μL reaction volume was used with 2.5 U DreamTaq DNA polymerase and DreamTaq buffer (10x) (Fisher Scientific, Schwerte, Germany), 0.75 mM MgCl2 , 0.2 μM of each primer, 0.15 mM dNTP (Fisher Scientific, Schwerte, Germany), and 0.1 mg/mL BSA (Fisher Scientific, Schwerte, Germany). .. The clone library was prepared using the TOPO TA Cloning Kit (Invitrogen, Carlsbad, CA, United States) according to the manufacturer’s instructions.

Multiplex Assay:

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Article Snippet: Paragraph title: Multiplex PCR ... PCR was performed in a final volume of 10 μl containing 1 to 10 ng genomic DNA, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.3, 0.2 mmol/L of each dNTP, 1 μmol/L of each primer, 0.5 U Taq polymerase (Fisher Scientific, Pittsburgh, PA).

Quantitation Assay:

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Article Snippet: PCR was performed in a final volume of 10 μl containing 1 to 10 ng genomic DNA, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.3, 0.2 mmol/L of each dNTP, 1 μmol/L of each primer, 0.5 U Taq polymerase (Fisher Scientific, Pittsburgh, PA). .. Quantitation of the bands was performed with the Image-Pro Plus program (Media Cybernetics, Silver Spring, MD), and the PTEN : desmin ratio was calculated.

Modification:

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Article Snippet: Homozygous deletions of the PTEN gene were assayed using a modification of a comparative multiplex PCR approach described previously. .. PCR was performed in a final volume of 10 μl containing 1 to 10 ng genomic DNA, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.3, 0.2 mmol/L of each dNTP, 1 μmol/L of each primer, 0.5 U Taq polymerase (Fisher Scientific, Pittsburgh, PA).

High Performance Liquid Chromatography:

Article Title: Differentiation and Maturation of Oligodendrocytes in Human Three-Dimensional Neural Cultures
Article Snippet: .. The lysis buffer contains 4 U RNase inhibitor (40 U/μl, Clontech, 2313B), 0.05% Triton, 2.5 mM dNTP, 2.5 μM Oligo-dT30 VN (IDT, RNase-free HPLC purification) , 4 enzyme units (U) RNase inhibitor…2.5 mM deoxynucleotide triphosphates (dNTP)… external RNA control consortium (ERCC) RNA Spike-In Mix (1:2.4 X 107 diluted, Thermal Fisher Scientific, 4456740). ..

Reverse Transcription Polymerase Chain Reaction:

Article Title: FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Article Snippet: Paragraph title: Reverse transcription-polymerase chain reaction ... 2 ul of the RT reaction was then mixed with 1 ul of 10X PCR Buffer (500 mM Tris-HCl (pH8.3), 2.5 mg/ml crystalline BSA and MgCl2 at 10, 20 or 30 mM (Idaho Technology Inc., Idaho Falls, ID), 0.2 mM each dNTP, 0.05 μM of each primer and 1.25 Units Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA) in a total volume of 10 μl.

Article Title: Myelogenous Leukemia in Adult Inbred MHC Defined Miniature Swine: a model for human myeloid leukemias
Article Snippet: RT-PCR was performed with the pABL (5’-TGTTGACCGGTGTGATGTAGTTGCTTGG-3’) and pBCR (5’-ATAGCATCCCGCTGACCATCAACAAA-3’) primers. .. The reaction consisted of 1x buffer A (Fisher Scientific Co), 1uM of each primer, 200uM each dNTP (Fisher Scientific Co.) and 2.5U Taq polymerase (Fisher Scientific Co.) in a final volume of 50ul.

Article Title: TGF-β Effects on Prostate Cancer Cell Migration and Invasion Require FosB
Article Snippet: Paragraph title: RNA Isolation, cDNA Synthesis, and RT-PCR ... Total RNAs (2 μg) were reverse transcribed in a 50 μl reaction mixture containing 0.5 mM dNTP (Fisher Scientific, Pittsburgh, PA), 0.5 mM dithiotreitol (Bio-Rad), 0.5 μg of oligo dT, and 400 U of M-MLV Reverse Transcriptase (Promega) at 37°C for 1.5 hr.

DNA Extraction:

Article Title: E47 is required for V(D)J recombinase activity in common lymphoid progenitors
Article Snippet: Paragraph title: DNA isolation and PCR. ... PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl2 , 1X Buffer A (Fisher Scientific), and 4 μM of each primer.

Article Title: B Lineage-specific Regulation of V(D)J Recombinase Activity Is Established in Common Lymphoid Progenitors
Article Snippet: Paragraph title: DNA Isolation and PCR. ... PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP + dTTP + dCTP + dGTP), 2.5 U Taq, 4 mM MgCl2 , 1× buffer A (Fisher Scientific), and 4 μM of each primer.

Mutagenesis:

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: Genotyping A pair of primers flanking the position of a single nucleotide mutation of the Nppc gene (forward primer: CTCTTGGGTGCAGAGCTAGG; reverse primer: AGCTGGTGGCAATCAGAAAA) was used to genotype +/+, lbab /+, and lbab/lbab mice. .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min.

Article Title: Comparative genomics and evolution of conserved noncoding elements (CNE) in rainbow trout
Article Snippet: CNE specific primers were designed to generate PCR products, suitable for use in various mutation detection techniques [ , ] (Additional file ). .. The PCR reaction mixture consisted of 30 ng of template DNA, 1× PCR buffer, 0.2 mM each dNTP (Fisher Scientific), 0.1 μM of each primer, 2 mM MgCl2 and 0.15 U of the GoTaq DNA polymerase (Promega).

Isolation:

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: At the VGL, an allele specific assay was developed for the detection of c.364C > T. Each PCR contained 3μl of template DNA isolated as previously described [ ]. .. Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.).

Article Title: E47 is required for V(D)J recombinase activity in common lymphoid progenitors
Article Snippet: Genomic DNA was isolated with the QIAGEN DNeasy kit according to the manufacturer's instructions. .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl2 , 1X Buffer A (Fisher Scientific), and 4 μM of each primer.

Article Title: A Toll-like Receptor 1 Polymorphism Is Associated with Heightened T-helper 1 Inflammatory Responses and Antibiotic-Refractory Lyme Arthritis
Article Snippet: .. Isolated genomic DNA (~50 ng) from each patient was amplified in a 50 µl reaction containing 200 µM of dNTP (Fisher Scientific, Springfield, NJ), 0.5 µM of forward and reverse PCR primers (IDT, Eugene, OR), and 2.5 units of HotStarTaq DNA polymerase (Qiagen). .. PCR reactions were performed with the following primers: for TLR1, the forward primer was CTTGATCTTCACAGCAATAAAATAAAGAGCATT and reverse primer was GGCCATGATACACTAGAACACACATCACT ( ); for TLR2, the forward primer was GCCTACTGGGTGGAGAACCT and the reverse primer was GGCCACTCCAGGTAGGTCTT , and for TLR5, the forward primer was GGTAGCCTACATTGATTTGC, and the reverse primer was GAGAATCTGGAGATGAGGTACCCG ( ).

Article Title: Myelogenous Leukemia in Adult Inbred MHC Defined Miniature Swine: a model for human myeloid leukemias
Article Snippet: RNA was isolated from the human and porcine PBL as well as from the porcine 14736 and K562 tumor cells with an RNAeasy Mini Kit (Qiagen) according to the manfacturer’s protocol. cDNA was transcribed with the Superscript III First Strand Synthesis System (Invitrogen). .. The reaction consisted of 1x buffer A (Fisher Scientific Co), 1uM of each primer, 200uM each dNTP (Fisher Scientific Co.) and 2.5U Taq polymerase (Fisher Scientific Co.) in a final volume of 50ul.

Article Title: TGF-β Effects on Prostate Cancer Cell Migration and Invasion Require FosB
Article Snippet: Paragraph title: RNA Isolation, cDNA Synthesis, and RT-PCR ... Total RNAs (2 μg) were reverse transcribed in a 50 μl reaction mixture containing 0.5 mM dNTP (Fisher Scientific, Pittsburgh, PA), 0.5 mM dithiotreitol (Bio-Rad), 0.5 μg of oligo dT, and 400 U of M-MLV Reverse Transcriptase (Promega) at 37°C for 1.5 hr.

Article Title: B Lineage-specific Regulation of V(D)J Recombinase Activity Is Established in Common Lymphoid Progenitors
Article Snippet: Genomic DNA was isolated with the QIAGEN DNeasy kit according to the manufacturer's instructions. .. PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP + dTTP + dCTP + dGTP), 2.5 U Taq, 4 mM MgCl2 , 1× buffer A (Fisher Scientific), and 4 μM of each primer.

Size-exclusion Chromatography:

Article Title: Dominant Fecal Microbiota in Newly Diagnosed Untreated Inflammatory Bowel Disease Patients
Article Snippet: Each PCR reaction was performed in a total volume of 25 μ L, and the PCR conditions were as follows: HotFirePol 1.25 U (Solis Biodyne, Tartu, Estonia), B2 buffer 1x (SolisBiodyne), MgCl2 2.5 mM (Solis Biodyne), dNTP 200 μ M (Termo Fisher scientific, Surrey, USA), forward primer 0.2 μ M, reverse primer 0.2 μ M. The amount of DNA template used was 5 ng. .. PCR amplification was carried out with an initial denaturation step at 95°C for 15 min, followed by 30 cycles consisting of denaturation for 30 sec at 95°C, annealing for 30 sec at 55°C, and elongation for 1 min 20 sec at 72°C.

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: Thermal cycling consisted of: 95°C 3 min, 85°C 5 min, 33 cycles of 95°C 45 sec, 60°C 30 sec, 72°C 30 sec, followed by 1 cycle of 72°C for 15 min and a 10°C hold. .. Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.).

Purification:

Article Title: Differentiation and Maturation of Oligodendrocytes in Human Three-Dimensional Neural Cultures
Article Snippet: .. The lysis buffer contains 4 U RNase inhibitor (40 U/μl, Clontech, 2313B), 0.05% Triton, 2.5 mM dNTP, 2.5 μM Oligo-dT30 VN (IDT, RNase-free HPLC purification) , 4 enzyme units (U) RNase inhibitor…2.5 mM deoxynucleotide triphosphates (dNTP)… external RNA control consortium (ERCC) RNA Spike-In Mix (1:2.4 X 107 diluted, Thermal Fisher Scientific, 4456740). ..

Article Title: FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Article Snippet: Reverse transcription-polymerase chain reaction Total RNA was purified as described above from EML and MPRO cells at 24 hour timepoints during the differentiation process of each cell line The primers were designed using the Vector NTI sequence analysis suite of programs (InforMax, Frederick, MD) and were follows: MmFam20a forward 5'-catagaggcccacggcgagcg-3' and reverse 5'-atggaatggggcaacag gggc-3'; Mmfam20b forward 5'-tggacaggattctgggtttc-3' and reverse 5'-ccagggatgtcgatgtttct-3'; MmFam20c forward 5'-agcagacgagagagcaggag-3' and reverse 5'-cggatctccttggtcatgtt-3'; HsFAM20a forward 5'-ctggcaggaaaagagtg-3' and 5'-cccgaacttggtgaacatct-3', HsFAM20b forward 5'-ccctgaagagacaccagaagagc-3' and reverse 5'-gaaacccagaatcctgtcca-3', HsFAM20c forward 5'-ggctcacgttccacattggt-3' and reverse 5'-aaagtcagggggtgtctcct-3'. .. 2 ul of the RT reaction was then mixed with 1 ul of 10X PCR Buffer (500 mM Tris-HCl (pH8.3), 2.5 mg/ml crystalline BSA and MgCl2 at 10, 20 or 30 mM (Idaho Technology Inc., Idaho Falls, ID), 0.2 mM each dNTP, 0.05 μM of each primer and 1.25 Units Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA) in a total volume of 10 μl.

Sequencing:

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: The newly identified c.364C > T variant was genotyped by direct sequencing using the genomic primers CMAH4F and CMAH4R, and sequenced as previously described in the genomic analysis section ( ). .. Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.).

Article Title: FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Article Snippet: Reverse transcription-polymerase chain reaction Total RNA was purified as described above from EML and MPRO cells at 24 hour timepoints during the differentiation process of each cell line The primers were designed using the Vector NTI sequence analysis suite of programs (InforMax, Frederick, MD) and were follows: MmFam20a forward 5'-catagaggcccacggcgagcg-3' and reverse 5'-atggaatggggcaacag gggc-3'; Mmfam20b forward 5'-tggacaggattctgggtttc-3' and reverse 5'-ccagggatgtcgatgtttct-3'; MmFam20c forward 5'-agcagacgagagagcaggag-3' and reverse 5'-cggatctccttggtcatgtt-3'; HsFAM20a forward 5'-ctggcaggaaaagagtg-3' and 5'-cccgaacttggtgaacatct-3', HsFAM20b forward 5'-ccctgaagagacaccagaagagc-3' and reverse 5'-gaaacccagaatcctgtcca-3', HsFAM20c forward 5'-ggctcacgttccacattggt-3' and reverse 5'-aaagtcagggggtgtctcct-3'. .. 2 ul of the RT reaction was then mixed with 1 ul of 10X PCR Buffer (500 mM Tris-HCl (pH8.3), 2.5 mg/ml crystalline BSA and MgCl2 at 10, 20 or 30 mM (Idaho Technology Inc., Idaho Falls, ID), 0.2 mM each dNTP, 0.05 μM of each primer and 1.25 Units Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA) in a total volume of 10 μl.

Article Title: Temporal Dynamics of the Microbial Community Composition with a Focus on Toxic Cyanobacteria and Toxin Presence during Harmful Algal Blooms in Two South German Lakes
Article Snippet: Paragraph title: Clone Library and Sanger Sequencing ... A 50-μL reaction volume was used with 2.5 U DreamTaq DNA polymerase and DreamTaq buffer (10x) (Fisher Scientific, Schwerte, Germany), 0.75 mM MgCl2 , 0.2 μM of each primer, 0.15 mM dNTP (Fisher Scientific, Schwerte, Germany), and 0.1 mg/mL BSA (Fisher Scientific, Schwerte, Germany).

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: The individual and mixed PCR products were then run on TGCE to detect possible sequence variations. .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min.

Lysis:

Article Title: Differentiation and Maturation of Oligodendrocytes in Human Three-Dimensional Neural Cultures
Article Snippet: .. The lysis buffer contains 4 U RNase inhibitor (40 U/μl, Clontech, 2313B), 0.05% Triton, 2.5 mM dNTP, 2.5 μM Oligo-dT30 VN (IDT, RNase-free HPLC purification) , 4 enzyme units (U) RNase inhibitor…2.5 mM deoxynucleotide triphosphates (dNTP)… external RNA control consortium (ERCC) RNA Spike-In Mix (1:2.4 X 107 diluted, Thermal Fisher Scientific, 4456740). ..

Mouse Assay:

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: The PCR products from heterozygous and homozygous mice were mixed with those from normal mice. .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min.

Plasmid Preparation:

Article Title: FAM20: an evolutionarily conserved family of secreted proteins expressed in hematopoietic cells
Article Snippet: Reverse transcription-polymerase chain reaction Total RNA was purified as described above from EML and MPRO cells at 24 hour timepoints during the differentiation process of each cell line The primers were designed using the Vector NTI sequence analysis suite of programs (InforMax, Frederick, MD) and were follows: MmFam20a forward 5'-catagaggcccacggcgagcg-3' and reverse 5'-atggaatggggcaacag gggc-3'; Mmfam20b forward 5'-tggacaggattctgggtttc-3' and reverse 5'-ccagggatgtcgatgtttct-3'; MmFam20c forward 5'-agcagacgagagagcaggag-3' and reverse 5'-cggatctccttggtcatgtt-3'; HsFAM20a forward 5'-ctggcaggaaaagagtg-3' and 5'-cccgaacttggtgaacatct-3', HsFAM20b forward 5'-ccctgaagagacaccagaagagc-3' and reverse 5'-gaaacccagaatcctgtcca-3', HsFAM20c forward 5'-ggctcacgttccacattggt-3' and reverse 5'-aaagtcagggggtgtctcct-3'. .. 2 ul of the RT reaction was then mixed with 1 ul of 10X PCR Buffer (500 mM Tris-HCl (pH8.3), 2.5 mg/ml crystalline BSA and MgCl2 at 10, 20 or 30 mM (Idaho Technology Inc., Idaho Falls, ID), 0.2 mM each dNTP, 0.05 μM of each primer and 1.25 Units Taq DNA polymerase (Fisher Scientific, Pittsburgh, PA) in a total volume of 10 μl.

Software:

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.). .. PCR amplicons were visualized on an ABI3730 DNA analyzer (Applied Biosystems) and analyzed using STRand software [ ].

Negative Control:

Article Title: Prevalence of Tick-Borne Pathogens in Northeast Missouri
Article Snippet: PCR reactions of 25 μl contained 1.0 μM of each primer (Fisher Scientific, Pittsburgh, PA), 10 mM of each dNTP, 10 mM Tris-HCl (pH 9.0), 50 mM KCl, 1.5 mM MgCl2 , 1.25 U of Taq DNA Polymerase (Fisher Scientific, Pittsburgh, PA), and 100 ng of extracted DNA from pooled ticks. .. With every PCR assay, a positive and negative control was included.

Agarose Gel Electrophoresis:

Article Title: Dominant Fecal Microbiota in Newly Diagnosed Untreated Inflammatory Bowel Disease Patients
Article Snippet: Each PCR reaction was performed in a total volume of 25 μ L, and the PCR conditions were as follows: HotFirePol 1.25 U (Solis Biodyne, Tartu, Estonia), B2 buffer 1x (SolisBiodyne), MgCl2 2.5 mM (Solis Biodyne), dNTP 200 μ M (Termo Fisher scientific, Surrey, USA), forward primer 0.2 μ M, reverse primer 0.2 μ M. The amount of DNA template used was 5 ng. .. Amplicons were checked with 1.5% Agarose gel (80 V; 60 min).

Article Title: E47 is required for V(D)J recombinase activity in common lymphoid progenitors
Article Snippet: PCR amplification was performed with 10 μl DNA in 25 μl total volume with 1.6 μM dNTP (dATP, dTTP, dCTP, and dGTP), 2.5 U Taq, 4 mM MgCl2 , 1X Buffer A (Fisher Scientific), and 4 μM of each primer. .. PCR products were visualized with ethidium bromide on a 1.5% agarose gel in TBE buffer.

Concentration Assay:

Article Title: A single nucleotide mutation in Nppc is associated with a long bone abnormality in lbab mice
Article Snippet: .. PCR amplification was performed in a total volume of 25 μl at a final concentration of 1.5 mM MgCl2 concentration and 0.2 mmol/L each dNTP, 0.2 μmol/L oligonucleotide primer, 100 ng template DNA, and 0.7 units Taq polymerase (Fisher Scientific, Pittsburgh, PA) for 35 cycles of 94°C for 1 min, 50–55°C for 1 min, and 72°C for 1 min. .. RT-PCR amplification of Nppc One-step RT-PCR kit (Invitrogen, Carlsbad, CA) was used to detect the expression of mutated Nppc at the mRNA level.

Staining:

Article Title: PTEN Is a Target of Chromosome 10q Loss in Anaplastic Oligodendrogliomas and PTEN Alterations Are Associated with Poor Prognosis
Article Snippet: PCR was performed in a final volume of 10 μl containing 1 to 10 ng genomic DNA, 50 mmol/L KCl, 1.5 mmol/L MgCl2, 10 mmol/L Tris-HCl, pH 8.3, 0.2 mmol/L of each dNTP, 1 μmol/L of each primer, 0.5 U Taq polymerase (Fisher Scientific, Pittsburgh, PA). .. PCR products were separated on 4% TBE-agarose gel and visualized by ethidium bromide staining.

Article Title: A Toll-like Receptor 1 Polymorphism Is Associated with Heightened T-helper 1 Inflammatory Responses and Antibiotic-Refractory Lyme Arthritis
Article Snippet: Isolated genomic DNA (~50 ng) from each patient was amplified in a 50 µl reaction containing 200 µM of dNTP (Fisher Scientific, Springfield, NJ), 0.5 µM of forward and reverse PCR primers (IDT, Eugene, OR), and 2.5 units of HotStarTaq DNA polymerase (Qiagen). .. Undigested and digested PCR products for TLR1-1805GG, TLR2-2258GA, and TLR5-1174CT genotypes were electrophoresed on 1.5%, 2% and 3% agarose gels, respectively, and stained with ethidium bromide.

Variant Assay:

Article Title: A Novel Variant in CMAH Is Associated with Blood Type AB in Ragdoll Cats
Article Snippet: Paragraph title: Variant analysis of feline CMAH ... Each 25 μl reaction contained 1μM of each primer (the forward FAM-364, the wild-type reverse 364wtR and the affected reverse 364affectedR), 1X reaction buffer (Denville Scientific, Inc., South Plainfield, NJ), 2.5mM MgCl2 , 1.0mM dNTP, 0.02μl DMSO (Fisher Scientific) and 1.0U Choice Taq DNA polymerase (Denville Scientific Inc.).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 78
    Fisher Scientific deoxynucleotide triphosphates dntp
    Deoxynucleotide Triphosphates Dntp, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphates dntp/product/Fisher Scientific
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphates dntp - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    78
    Fisher Scientific x dntps
    X Dntps, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/x dntps/product/Fisher Scientific
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    x dntps - by Bioz Stars, 2020-03
    78/100 stars
      Buy from Supplier

    99
    Fisher Scientific dntp
    Dntp, supplied by Fisher Scientific, used in various techniques. Bioz Stars score: 99/100, based on 32 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Fisher Scientific
    Average 99 stars, based on 32 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-03
    99/100 stars
      Buy from Supplier

    Image Search Results