dntp mix promega u1515  (Promega)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Name:
    dNTP Mix
    Description:
    Premixed solution of dATP dCTP dGTP and dTTP in water
    Catalog Number:
    u1511
    Price:
    None
    Category:
    Nucleic Acid Extraction Analysis PCR Endpoint PCR
    Buy from Supplier


    Structured Review

    Promega dntp mix promega u1515
    Premixed solution of dATP dCTP dGTP and dTTP in water
    https://www.bioz.com/result/dntp mix promega u1515/product/Promega
    Average 99 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    dntp mix promega u1515 - by Bioz Stars, 2020-08
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Regulation of Vascular Endothelial Growth Factor (VEGF) Splicing from Pro-angiogenic to Anti-angiogenic Isoforms
    Article Snippet: .. Construction of Plasmids The VEGF sequence of interest (from 35-bp upstream of exon 8a to 35-bp downstream of exon 8b) was amplified from a BAC DNA template using 50 ng of BAC DNA, 10 μm of each primers (see ), 10 mm dNTP mix (Promega), and Taq polymerase (Promega). .. A modified ADML-MS2 plasmid was digested with EcoR1 and BamH1, and PCR products ligated into the vector and subsequently transformed.

    Concentration Assay:

    Article Title: CK12a, a CCL19-like chemokine that orchestrates both nasal and systemic antiviral immune responses in rainbow trout
    Article Snippet: .. The RNA concentration was determined by spectrophotometry (Nanodrop ND1000, LabTech) and the integrity of the RNA was determined by electrophoresis (Agilent Bioanalyser, 2100). cDNA synthesis was performed using 1 μg of total RNA, which was denatured (65°C, 5 min) in the presence of 1 μl of oligo-dT17, 1 μl dNTP (deoxynucleoside triphosphate mix 10 mM each (Promega) and RNA/DNA free water (Sigma) in a volume of 13 μl. .. Synthesis was carried out using 1 μl Superscript III enzyme reverse transcriptase (Invitrogen) in the presence of 5 μl of 5x first strand buffer, 1 μl 0.1 M DTT, made up to a final volume of 25 μl with water, and incubated at 55°C for 1 h. The resultant cDNA was stored at −20°C.

    Incubation:

    Article Title: Regulation of GluR1 abundance in murine hippocampal neurones by serum- and glucocorticoid-inducible kinase 3
    Article Snippet: .. A RT mix of 2 μl 10× reaction buffer (Biolabs), 1 μl dNTP mix (dATP, dCTP, dGTP, dTTP, 10 m m each, Promega), 0.5 μl recombinant RNase inhibitor (Roche), 0.1 μl M-MuLV reverse transcriptase (Biolabs), and 2.9 μl DEPC-H2 O was then added, and the reaction mixture was incubated for 60 min at 42°C. .. The cDNA was stored at −20°C until PCR analysis.

    Article Title: A New Method for Stranded Whole Transcriptome RNA-seq
    Article Snippet: .. The DNase reaction was incubated for 60 min at 37°C and then inactivated with DNase at 80°C for 5 min. cDNA was made by adding 2 μL/1μg random hexamer (Qiagen Sciences, Valencia, CA 91355, cat. no. 79236) and denatured at 70°C for 2 min. Then, the DNase-treated RNA was combined with 5 μL 5X MMLV reverse transcriptase buffer (Promega supplied), 2 μL 10 mM dNTP mix (Promega cat. no. U1511), 1 μL RNasin (Promega cat. no. N251B), 1.6 μL MMLV Reverse Transcriptase (Promega cat. no. M1708), 13.4 μL DIW and incubated at 42°C for 60 min, then the cDNA was denatured at 95°C for 5 min. .. Prior to qRT-PCR, the cDNA was diluted with 160 μL DIW, and the sample was stored at −20°C. qRT-PCR was carried out as described in sec. 2.12 except that 5 μL of diluted cDNA was used instead of diluted RNA-seq PCR1.

    Article Title: Deletion is neither sufficient nor necessary for the induction of peripheral tolerance in mature CD8+ T cells
    Article Snippet: .. The RNA/random hexamer mix was added to 10 µl of a RT reaction mix ((2× First Strand Buffer; Invitrogen; Carlsbad, CA), 10 m m dithiothreitol (DTT), 2 m m dinucleotide triphosphate (dNTP) mix, 40 U RNasin® (Promega Biosciences, San Luis Obispo, CA), and 200 U Superscript II® Reverse Transcriptase (Invitrogen)) and incubated in sequence at 25° for 10 min, 50° for 50 min, 85° for 5 min, and stored at 4°. .. Two µl of the RT reaction was used in a 25 µl total PCR reaction containing: 0·5 µ m 5′ Ova Primer (AATGAGCATGTTGGTGCTGTTGC), 0·5 µ m 3′ Ova Primer (5′-GAAACACATCTGCCAAAGAAGAGAACG-3′), 200 µ m dNTP mix, 1× PCR Buffer (Roche), 2·5 U Taq Polymerase (Roche).

    Spectrophotometry:

    Article Title: CK12a, a CCL19-like chemokine that orchestrates both nasal and systemic antiviral immune responses in rainbow trout
    Article Snippet: .. The RNA concentration was determined by spectrophotometry (Nanodrop ND1000, LabTech) and the integrity of the RNA was determined by electrophoresis (Agilent Bioanalyser, 2100). cDNA synthesis was performed using 1 μg of total RNA, which was denatured (65°C, 5 min) in the presence of 1 μl of oligo-dT17, 1 μl dNTP (deoxynucleoside triphosphate mix 10 mM each (Promega) and RNA/DNA free water (Sigma) in a volume of 13 μl. .. Synthesis was carried out using 1 μl Superscript III enzyme reverse transcriptase (Invitrogen) in the presence of 5 μl of 5x first strand buffer, 1 μl 0.1 M DTT, made up to a final volume of 25 μl with water, and incubated at 55°C for 1 h. The resultant cDNA was stored at −20°C.

    Electrophoresis:

    Article Title: CK12a, a CCL19-like chemokine that orchestrates both nasal and systemic antiviral immune responses in rainbow trout
    Article Snippet: .. The RNA concentration was determined by spectrophotometry (Nanodrop ND1000, LabTech) and the integrity of the RNA was determined by electrophoresis (Agilent Bioanalyser, 2100). cDNA synthesis was performed using 1 μg of total RNA, which was denatured (65°C, 5 min) in the presence of 1 μl of oligo-dT17, 1 μl dNTP (deoxynucleoside triphosphate mix 10 mM each (Promega) and RNA/DNA free water (Sigma) in a volume of 13 μl. .. Synthesis was carried out using 1 μl Superscript III enzyme reverse transcriptase (Invitrogen) in the presence of 5 μl of 5x first strand buffer, 1 μl 0.1 M DTT, made up to a final volume of 25 μl with water, and incubated at 55°C for 1 h. The resultant cDNA was stored at −20°C.

    CTG Assay:

    Article Title: Sexual intraspecific recombination but not de novo origin governs the genesis of new apomictic genotypes in Potentilla puberula (Rosaceae)
    Article Snippet: .. The reactions were held at 72°C for 2 min followed by 30 cycles of: 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. For the selective PCR, 2 μl of 1 : 20-diluted pre-selective PCR product was used as a template in three different reactions including differently labelled primer combinations, for a reaction volume of 10 μl each containing: 5× Green GoTaq Buffer (Promega), 0.28 mM dNTP mix, 0.34 μM EcoRI-fluorescence-labelled primer, 0.34 μM MseI primer (EcoRI-AGG [VIC]/MseI-CTC, EcoRI-AAC [6-FAM]/MseI-CTT, EcoRI-AGC [NED]/MseI- CTG), and 0.2 U GoTaq G2 polymerase (Promega). .. The product of each step (restrictionligation, pre-selective and selective amplifications) was run on 1% agarose gel together with a negative control.

    Random Hexamer Labeling:

    Article Title: A New Method for Stranded Whole Transcriptome RNA-seq
    Article Snippet: .. The DNase reaction was incubated for 60 min at 37°C and then inactivated with DNase at 80°C for 5 min. cDNA was made by adding 2 μL/1μg random hexamer (Qiagen Sciences, Valencia, CA 91355, cat. no. 79236) and denatured at 70°C for 2 min. Then, the DNase-treated RNA was combined with 5 μL 5X MMLV reverse transcriptase buffer (Promega supplied), 2 μL 10 mM dNTP mix (Promega cat. no. U1511), 1 μL RNasin (Promega cat. no. N251B), 1.6 μL MMLV Reverse Transcriptase (Promega cat. no. M1708), 13.4 μL DIW and incubated at 42°C for 60 min, then the cDNA was denatured at 95°C for 5 min. .. Prior to qRT-PCR, the cDNA was diluted with 160 μL DIW, and the sample was stored at −20°C. qRT-PCR was carried out as described in sec. 2.12 except that 5 μL of diluted cDNA was used instead of diluted RNA-seq PCR1.

    Polymerase Chain Reaction:

    Article Title: Using long ssDNA polynucleotides to amplify STRs loci in degraded DNA samples
    Article Snippet: .. Long ssDNA polynucleotide triplex PCR mix A long ssDNA polynucleotide triplex PCR mixture was prepared with 1X Colorless GoTaq® reaction buffer (containing 1.5mM MgCl2 ) (Promega), 200uM of each dNTP (Promega, USA), 1U GoTaq® Hot Start DNA Polymerase (Promega), 500nM of each of the following primers (IDT): PEM1325FW, PE26RVFL, D5S200FW, D5S60RVTM and 250nM of CSF200FW and CSF60RVJOE. .. Long ssDNA polynucleotide nonaplex PCR mix A long ssDNA polynucleotide multiplex PCR mixture was prepared with 1X Colorless GoTaq® reaction buffer (containing 1.5mM MgCl2 ) (Promega), 0.625 mM of additionally supplemented MgCl2 (Promega), 200uM of each dNTP (Promega), 2.5 units of GoTaq® Hot Start DNA Polymerase (Promega) a set of primers (IDT) at the following concentrations: 250nM for PEM1325FW, PE26RVFL, D5S200FW, D5S60RVTM, SE33M1329FWROX, SE33200RV, TPOX60FWTM, TPOX200RV and D22S200FW, D22S60RVROX; 125nM for CSF200FW, CSF60RVJOE, D13M1325FW, D13M1325RVFL, PDM1325FW and PDM1325RVJOE and 62.5nM for AmelFWJOE and AmelRV.

    Article Title: Upregulating CXCR4 in Human Fetal Mesenchymal Stem Cells Enhances Engraftment and Bone Mechanics in a Mouse Model of Osteogenesis Imperfecta
    Article Snippet: .. The PCR mix (20 μl per sample) consisted of 12.7 μl diethylpyrocarbonate (DEPC)-treated water (Invitrogen), 2 μl 10× NH4 buffer (Bioline, Tauton, MA, ), 0.6 μl 50 mM MgCl2 (Bioline), 2 μl 2.5 mM dNTP (Promega), 20 μM each of forward and reverse primers as described elsewhere (5′-ACGTCAGTGAGGCAGATG-3′; 5′-GATGACTGTGGTCTTGAG-3′) [ ], 0.2 μl BioTaq DNA polymerase (Bioline), and 2 μl cDNA. .. The reaction was run in a Peltier Thermal cycler (MJ Research, St. Bruno, Quebec, Canada, ).

    Article Title: Sexual intraspecific recombination but not de novo origin governs the genesis of new apomictic genotypes in Potentilla puberula (Rosaceae)
    Article Snippet: .. The reactions were held at 72°C for 2 min followed by 30 cycles of: 94°C for 30 s, 56°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. For the selective PCR, 2 μl of 1 : 20-diluted pre-selective PCR product was used as a template in three different reactions including differently labelled primer combinations, for a reaction volume of 10 μl each containing: 5× Green GoTaq Buffer (Promega), 0.28 mM dNTP mix, 0.34 μM EcoRI-fluorescence-labelled primer, 0.34 μM MseI primer (EcoRI-AGG [VIC]/MseI-CTC, EcoRI-AAC [6-FAM]/MseI-CTT, EcoRI-AGC [NED]/MseI- CTG), and 0.2 U GoTaq G2 polymerase (Promega). .. The product of each step (restrictionligation, pre-selective and selective amplifications) was run on 1% agarose gel together with a negative control.

    BAC Assay:

    Article Title: Regulation of Vascular Endothelial Growth Factor (VEGF) Splicing from Pro-angiogenic to Anti-angiogenic Isoforms
    Article Snippet: .. Construction of Plasmids The VEGF sequence of interest (from 35-bp upstream of exon 8a to 35-bp downstream of exon 8b) was amplified from a BAC DNA template using 50 ng of BAC DNA, 10 μm of each primers (see ), 10 mm dNTP mix (Promega), and Taq polymerase (Promega). .. A modified ADML-MS2 plasmid was digested with EcoR1 and BamH1, and PCR products ligated into the vector and subsequently transformed.

    Sequencing:

    Article Title: Deletion is neither sufficient nor necessary for the induction of peripheral tolerance in mature CD8+ T cells
    Article Snippet: .. The RNA/random hexamer mix was added to 10 µl of a RT reaction mix ((2× First Strand Buffer; Invitrogen; Carlsbad, CA), 10 m m dithiothreitol (DTT), 2 m m dinucleotide triphosphate (dNTP) mix, 40 U RNasin® (Promega Biosciences, San Luis Obispo, CA), and 200 U Superscript II® Reverse Transcriptase (Invitrogen)) and incubated in sequence at 25° for 10 min, 50° for 50 min, 85° for 5 min, and stored at 4°. .. Two µl of the RT reaction was used in a 25 µl total PCR reaction containing: 0·5 µ m 5′ Ova Primer (AATGAGCATGTTGGTGCTGTTGC), 0·5 µ m 3′ Ova Primer (5′-GAAACACATCTGCCAAAGAAGAGAACG-3′), 200 µ m dNTP mix, 1× PCR Buffer (Roche), 2·5 U Taq Polymerase (Roche).

    Article Title: Regulation of Vascular Endothelial Growth Factor (VEGF) Splicing from Pro-angiogenic to Anti-angiogenic Isoforms
    Article Snippet: .. Construction of Plasmids The VEGF sequence of interest (from 35-bp upstream of exon 8a to 35-bp downstream of exon 8b) was amplified from a BAC DNA template using 50 ng of BAC DNA, 10 μm of each primers (see ), 10 mm dNTP mix (Promega), and Taq polymerase (Promega). .. A modified ADML-MS2 plasmid was digested with EcoR1 and BamH1, and PCR products ligated into the vector and subsequently transformed.

    Recombinant:

    Article Title: Regulation of GluR1 abundance in murine hippocampal neurones by serum- and glucocorticoid-inducible kinase 3
    Article Snippet: .. A RT mix of 2 μl 10× reaction buffer (Biolabs), 1 μl dNTP mix (dATP, dCTP, dGTP, dTTP, 10 m m each, Promega), 0.5 μl recombinant RNase inhibitor (Roche), 0.1 μl M-MuLV reverse transcriptase (Biolabs), and 2.9 μl DEPC-H2 O was then added, and the reaction mixture was incubated for 60 min at 42°C. .. The cDNA was stored at −20°C until PCR analysis.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    Promega dntp
    Dntp, supplied by Promega, used in various techniques. Bioz Stars score: 99/100, based on 2343 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dntp/product/Promega
    Average 99 stars, based on 2343 article reviews
    Price from $9.99 to $1999.99
    dntp - by Bioz Stars, 2020-08
    99/100 stars
      Buy from Supplier

    Image Search Results