Structured Review

CinnaGen Co dna polymerase
1.5% agarose gel electrophoresis of <t>PCR</t> product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: <t>DNA</t> extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples
Dna Polymerase, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerase/product/CinnaGen Co
Average 88 stars, based on 3 article reviews
Price from $9.99 to $1999.99
dna polymerase - by Bioz Stars, 2020-04
88/100 stars

Images

1) Product Images from "Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran"

Article Title: Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran

Journal: Iranian Journal of Parasitology

doi:

1.5% agarose gel electrophoresis of PCR product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: DNA extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples
Figure Legend Snippet: 1.5% agarose gel electrophoresis of PCR product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: DNA extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples

Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Positive Control, DNA Extraction

Related Articles

DNA Extraction:

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: Paragraph title: DNA Extraction and PCR ... PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran).

Amplification:

Article Title: Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran
Article Snippet: Each sample was amplified using different volumes of DNA preparation (0.5, 1 and 2 µl). .. Each PCR reaction contained 30µl. of 200 nmol of each primer,0.2 mM of dNTP, 1.5mM of MgCl2, 2.5U DNA polymerase, 3µL of 10x PCR buffer(CinnaGen), and 1 µL of bovine serum albumin (BSA, 10 mg/mL).

Positive Control:

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran). .. An initial denaturation of 10 min at 94°C was followed by 35 cycles of denaturation at 94°C (1 min), annealing at 58°C for 1 min and extension at 72°C for 1 min, followed by a final extension at 72°C for 10 min. product length were 941bp for E. faecalis , 658bp for E. faecium and 95bp for esp. Positive control for PCR were E. faecalis MMH594 (also esp positive), E. faecalis 29212, E. faecium C38 and C68.

End-sequence Profiling:

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: .. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran). ..

Polymerase Chain Reaction:

Article Title: Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran
Article Snippet: .. Each PCR reaction contained 30µl. of 200 nmol of each primer,0.2 mM of dNTP, 1.5mM of MgCl2, 2.5U DNA polymerase, 3µL of 10x PCR buffer(CinnaGen), and 1 µL of bovine serum albumin (BSA, 10 mg/mL). .. PCR consisted of a predenaturation at 94°C for 3 min; 35 cycles of 94°C for 45 second, 60°C for 50 second and 72°C for 1 min and final extension at 72°C for 7 min.

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: .. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran). ..

Article Title: Molecular Diversity of Mycobacterium tuberculosis Strains in Northwestern Iran
Article Snippet: .. ETR Typing The PCR was performed in a volume of 20 μL containing 10-100 ng of DNA; 0.5 μM of specific primers ( ) (Metabion, Germany); 1.5 mM of MgCl2 ; 100 μM of dATP, dTTP, dCTP, and dGTP; 50 mM of KCl; 20 mM of Tris-Cl (pH 8.4); and 1.25 U of DNA polymerase (Cinnagen, Iran). .. The PCR was done with an initial 7-minute denaturation step at 94°C and a final extension step at 72°C.

Incubation:

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: Briefly, bacterial pellet was resuspended in 100 µl gram positive prelysis buffer and added 20 µl lysosyme and incubated at 37°C for at least 30 min. After adding lysis buffer and precipitation solution, the solution was transferred to a spin column and after washing the spin, DNA was eluted by elution buffer in 65°C [ ]. .. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran).

Nested PCR:

Article Title: Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran
Article Snippet: Cryptosporidium oocysts in water samples were identified by a previously described nested- PCR technique and 850 bp encoding 18s rRNA was amplified ( ). .. Each PCR reaction contained 30µl. of 200 nmol of each primer,0.2 mM of dNTP, 1.5mM of MgCl2, 2.5U DNA polymerase, 3µL of 10x PCR buffer(CinnaGen), and 1 µL of bovine serum albumin (BSA, 10 mg/mL).

Lysis:

Article Title: Spread of Enterococcal Surface Protein in Antibiotic Resistant Entero-coccus faecium and Enterococcus faecalis isolates from Urinary Tract Infections
Article Snippet: Briefly, bacterial pellet was resuspended in 100 µl gram positive prelysis buffer and added 20 µl lysosyme and incubated at 37°C for at least 30 min. After adding lysis buffer and precipitation solution, the solution was transferred to a spin column and after washing the spin, DNA was eluted by elution buffer in 65°C [ ]. .. PCR was performed in 25 µl volumes that contained 20-200ng DNA, 0.5 µM of specific primers for E. faecalis ddlE1:ATCAAGTACAGTTAGTCTTTATTAG ddlE2: ACGATTCAAAGCTAACTGAATCAGT) [ ], E. faecium (ddlF1: TTGAGGCAGACCAGATTGACG, ddlF2: TAT-GACAGCGACTCCGATTCC) [ ] and for esp (espA: GGAACGCCTTGGTATGCTAAC, espB: GCCACTTTAT-CAGCCTGAACC) [ ] with 1.5 mM MgCl2, 200 µM of each dNTP, 1X PCR buffer and 2 U DNA polymerase (Cinnagen, Iran).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 88
    CinnaGen Co dna polymerase
    1.5% agarose gel electrophoresis of <t>PCR</t> product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: <t>DNA</t> extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples
    Dna Polymerase, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 88/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerase/product/CinnaGen Co
    Average 88 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    dna polymerase - by Bioz Stars, 2020-04
    88/100 stars
      Buy from Supplier

    92
    CinnaGen Co smar taq dna polymerase
    1.5% agarose gel electrophoresis of <t>PCR</t> product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: <t>DNA</t> extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples
    Smar Taq Dna Polymerase, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/smar taq dna polymerase/product/CinnaGen Co
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    smar taq dna polymerase - by Bioz Stars, 2020-04
    92/100 stars
      Buy from Supplier

    97
    CinnaGen Co taq dna polymerase
    1.5% agarose gel electrophoresis of <t>PCR</t> product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: <t>DNA</t> extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples
    Taq Dna Polymerase, supplied by CinnaGen Co, used in various techniques. Bioz Stars score: 97/100, based on 165 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/taq dna polymerase/product/CinnaGen Co
    Average 97 stars, based on 165 article reviews
    Price from $9.99 to $1999.99
    taq dna polymerase - by Bioz Stars, 2020-04
    97/100 stars
      Buy from Supplier

    Image Search Results


    1.5% agarose gel electrophoresis of PCR product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: DNA extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples

    Journal: Iranian Journal of Parasitology

    Article Title: Development of Sensitive Detection of Cryptosporidium and Giardia from Surface Water in Iran

    doi:

    Figure Lengend Snippet: 1.5% agarose gel electrophoresis of PCR product. Lane 1: Giardia positive control by Phenol-chloroform extraction; Lanes 2 and 3: DNA extraction by Phenol-chloroform of surface water samples; Lanes 4 and 5: DNA extraction by QIAamp DNA mini kit of surface water samples

    Article Snippet: Each PCR reaction contained 30µl. of 200 nmol of each primer,0.2 mM of dNTP, 1.5mM of MgCl2, 2.5U DNA polymerase, 3µL of 10x PCR buffer(CinnaGen), and 1 µL of bovine serum albumin (BSA, 10 mg/mL).

    Techniques: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Positive Control, DNA Extraction