Structured Review

BioTools Co dna polymerases
Dna Polymerases, supplied by BioTools Co, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna polymerases/product/BioTools Co
Average 89 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dna polymerases - by Bioz Stars, 2020-02
89/100 stars

Images

Related Articles

Clone Assay:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Amplification:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: Plasmids Construction The pEV-A71 5′-UTR and 3′-UTR were constructed as follows: The 5′-UTR of EV-A71 was amplified by PCR from the EV-A71 full-length infectious cDNA clone using #W416 5′-(TAATACGACTCACTATAGGGAGATTAAAACAGCCTGTGGGT); #W417 5′-(GTTTGATTGTGTTGAGGGTC) and the primers for 3′-UTR using #W418 5′-(TAATACGACTCACTATAGGGAGAATTTACAGTTTGTAACTG); #W419 5′-(GCTATTCTGGTTATAACAAA), which contained the T7 promoter. .. The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan).

Ligation:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The Stau1 full length and different truncated PCR products were then treated with Sal I, Not I, following by ligation into the pGEX vector, which was designed to produce GST-binding protein (GST) fusions, (GE Healthcare Bio-Sciences Co., Ltd, Piscataway, NJ, USA) that were previously digested with the restriction enzymes as shown above.

Isolation:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Construct:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: Plasmids Construction The pEV-A71 5′-UTR and 3′-UTR were constructed as follows: The 5′-UTR of EV-A71 was amplified by PCR from the EV-A71 full-length infectious cDNA clone using #W416 5′-(TAATACGACTCACTATAGGGAGATTAAAACAGCCTGTGGGT); #W417 5′-(GTTTGATTGTGTTGAGGGTC) and the primers for 3′-UTR using #W418 5′-(TAATACGACTCACTATAGGGAGAATTTACAGTTTGTAACTG); #W419 5′-(GCTATTCTGGTTATAACAAA), which contained the T7 promoter. .. The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan).

Polymerase Chain Reaction:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: .. The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Generated:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: .. The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Reverse Transcription Polymerase Chain Reaction:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Plasmid Preparation:

Article Title: Staufen1 Protein Participates Positively in the Viral RNA Replication of Enterovirus 71
Article Snippet: .. The Blunt-end PCR products generated by proofreading DNA polymerases could be directly ligated with the pZBack/blunt linearized vector (BioTools Co., Ltd, Taipei, Taiwan). .. The GAPDH 5′-UTR was constructed as follows: The 5-terminus untranslated region (188 bp) of Glyceraldehyde-3-phophate dehydrogenase (GAPDH, NCBI reference: NM_002046.5) was amplified by RT-PCR from total RNA isolated from HeLa cells using #W487 5′-(TAATACGACTCACTATA GGGGCCTCAAGACCTTGGGCTG ) and #488 5′-(GGTGTCTGAGCGATGTGGC), followed by cloning in the pZBack/blunt lineared vector as described above.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 89
    BioTools Co dna polymerases
    Dna Polymerases, supplied by BioTools Co, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dna polymerases/product/BioTools Co
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dna polymerases - by Bioz Stars, 2020-02
    89/100 stars
      Buy from Supplier

    Image Search Results