Structured Review

Thermo Fisher dna free
Global and clonal TE-inhibition; no enhanced Nanog expression prior to 32-cell stage but attenuated PrE-specific marker expression. ( a ) The experimental strategy to down-regulate Tead4 and inhibit TE-differentiation throughout all cells of the embryo prior to Q-RTPCR analysis (upper). Normalised expression fold changes, resulting from Tead4 -KD, of the stated transcripts at the mid-16-cell (E3.1) or 32-cell (E3.6) stages (lower panels). Individual gene mRNA levels were normalised against Rpl23 and/or H2afz transcript levels within control and experimental knockdown conditions prior to fold change calculation. Errors = s.e.m, n = at least 2 for biological and 3 for technical replicates ( n.b. Tead4 specific data is repeated from Fig. 1 as Q-RTPCR was performed from same <t>cDNA</t> preparations). ( b ) Confocal microscopy analysis of Nanog (green) expression after clonal Tead4 -KD at the mid-16-cell (E3.1) and 32-cell (E3.6) stages. Arrows and arrow-heads denote exemplar Nanog expression in non-microinjected and microinjected clones, respectively. Asterisks highlight TE cells without Nanog expression reflecting previously characterised inter-cell heterogeneity. ( c ) Confocal microscopy analysis of Fgfr2 (red) expression after clonal Tead4 -KD at the non-cavitated 32-cell (E3.5) blastocyst stage. Representative single z-plane confocal micrographs are shown (middle panels) with the lower 4 panels detailing magnified anti-Fgfr2 immuno-stained images, according to numbered regions of interest. Arrow-heads highlight plasma membrane associated Fgfr2 between neighbouring ICM cells (control embryos) and arrows approximate equivalent regions of other neighbouring ICM cells without anti-Fgfr2 signal (illustrating heterogeneous Fgfr2 expression within control embryo ICMs). Similarly, arrows show ICM cell boundaries between cells of the microinjected clone devoid of Fgfr2 in Tead4 -KD embryos. Asterisks and lollipop markers, in both control and Tead4 -KD embryos, show nuclear Fgfr2 protein (especially in Tead4-KD embryos) or expression at the interface of TE and ICM cells, respectively. In both ( b , c ) progeny cells of microinjected clones are distinguishable by co-injected RDBs (red) or OGDBs (Oregon-green dextran beads—green). <t>DNA</t> was counterstained with DAPI (blue) and scale bars = 10 μm.
Dna Free, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 190 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dna free/product/Thermo Fisher
Average 99 stars, based on 190 article reviews
Price from $9.99 to $1999.99
dna free - by Bioz Stars, 2020-01
99/100 stars

Images

1) Product Images from "The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent"

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent

Journal: Scientific Reports

doi: 10.1038/srep15034

Global and clonal TE-inhibition; no enhanced Nanog expression prior to 32-cell stage but attenuated PrE-specific marker expression. ( a ) The experimental strategy to down-regulate Tead4 and inhibit TE-differentiation throughout all cells of the embryo prior to Q-RTPCR analysis (upper). Normalised expression fold changes, resulting from Tead4 -KD, of the stated transcripts at the mid-16-cell (E3.1) or 32-cell (E3.6) stages (lower panels). Individual gene mRNA levels were normalised against Rpl23 and/or H2afz transcript levels within control and experimental knockdown conditions prior to fold change calculation. Errors = s.e.m, n = at least 2 for biological and 3 for technical replicates ( n.b. Tead4 specific data is repeated from Fig. 1 as Q-RTPCR was performed from same cDNA preparations). ( b ) Confocal microscopy analysis of Nanog (green) expression after clonal Tead4 -KD at the mid-16-cell (E3.1) and 32-cell (E3.6) stages. Arrows and arrow-heads denote exemplar Nanog expression in non-microinjected and microinjected clones, respectively. Asterisks highlight TE cells without Nanog expression reflecting previously characterised inter-cell heterogeneity. ( c ) Confocal microscopy analysis of Fgfr2 (red) expression after clonal Tead4 -KD at the non-cavitated 32-cell (E3.5) blastocyst stage. Representative single z-plane confocal micrographs are shown (middle panels) with the lower 4 panels detailing magnified anti-Fgfr2 immuno-stained images, according to numbered regions of interest. Arrow-heads highlight plasma membrane associated Fgfr2 between neighbouring ICM cells (control embryos) and arrows approximate equivalent regions of other neighbouring ICM cells without anti-Fgfr2 signal (illustrating heterogeneous Fgfr2 expression within control embryo ICMs). Similarly, arrows show ICM cell boundaries between cells of the microinjected clone devoid of Fgfr2 in Tead4 -KD embryos. Asterisks and lollipop markers, in both control and Tead4 -KD embryos, show nuclear Fgfr2 protein (especially in Tead4-KD embryos) or expression at the interface of TE and ICM cells, respectively. In both ( b , c ) progeny cells of microinjected clones are distinguishable by co-injected RDBs (red) or OGDBs (Oregon-green dextran beads—green). DNA was counterstained with DAPI (blue) and scale bars = 10 μm.
Figure Legend Snippet: Global and clonal TE-inhibition; no enhanced Nanog expression prior to 32-cell stage but attenuated PrE-specific marker expression. ( a ) The experimental strategy to down-regulate Tead4 and inhibit TE-differentiation throughout all cells of the embryo prior to Q-RTPCR analysis (upper). Normalised expression fold changes, resulting from Tead4 -KD, of the stated transcripts at the mid-16-cell (E3.1) or 32-cell (E3.6) stages (lower panels). Individual gene mRNA levels were normalised against Rpl23 and/or H2afz transcript levels within control and experimental knockdown conditions prior to fold change calculation. Errors = s.e.m, n = at least 2 for biological and 3 for technical replicates ( n.b. Tead4 specific data is repeated from Fig. 1 as Q-RTPCR was performed from same cDNA preparations). ( b ) Confocal microscopy analysis of Nanog (green) expression after clonal Tead4 -KD at the mid-16-cell (E3.1) and 32-cell (E3.6) stages. Arrows and arrow-heads denote exemplar Nanog expression in non-microinjected and microinjected clones, respectively. Asterisks highlight TE cells without Nanog expression reflecting previously characterised inter-cell heterogeneity. ( c ) Confocal microscopy analysis of Fgfr2 (red) expression after clonal Tead4 -KD at the non-cavitated 32-cell (E3.5) blastocyst stage. Representative single z-plane confocal micrographs are shown (middle panels) with the lower 4 panels detailing magnified anti-Fgfr2 immuno-stained images, according to numbered regions of interest. Arrow-heads highlight plasma membrane associated Fgfr2 between neighbouring ICM cells (control embryos) and arrows approximate equivalent regions of other neighbouring ICM cells without anti-Fgfr2 signal (illustrating heterogeneous Fgfr2 expression within control embryo ICMs). Similarly, arrows show ICM cell boundaries between cells of the microinjected clone devoid of Fgfr2 in Tead4 -KD embryos. Asterisks and lollipop markers, in both control and Tead4 -KD embryos, show nuclear Fgfr2 protein (especially in Tead4-KD embryos) or expression at the interface of TE and ICM cells, respectively. In both ( b , c ) progeny cells of microinjected clones are distinguishable by co-injected RDBs (red) or OGDBs (Oregon-green dextran beads—green). DNA was counterstained with DAPI (blue) and scale bars = 10 μm.

Techniques Used: Inhibition, Expressing, Marker, Reverse Transcription Polymerase Chain Reaction, Confocal Microscopy, Clone Assay, Staining, Injection

2) Product Images from "The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila"

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila

Journal: The Journal of Cell Biology

doi: 10.1083/jcb.201008119

A fob null allele is hypersensitive to infections with E. coli . (A) Schematic representation of the Drosophila fob gene and its neighbors. The targeting fragment generated in vivo ( Gong and Golic, 2003 ) contains portions of neighboring genes around the mini- white gene (red box). (B) Southern hybridization with the entire fob gene yielded a signal with Ore-R (wt) but with any fob allele. Reprobing the same membrane with dVps33b confirmed the presence of DNA in all lanes. (C) qRT-PCR showed no expression of fob but similar levels of expression for neighboring genes in fob 1 compared with wild type. Gene expression levels were normalized with rp49 as an internal control and are shown relative to wild type. (D and E) Survival after infection was measured for wt, fob 1 , and rescued fob 1 flies after injection with E. coli (D) or E. faecalis (E). (F) Induction of AMP genes 6 h after injection with E. coli (Drosocin, Diptericin, Cecropin, and Attacin) or 12 h after injection with E. faecalis (Defensin). (G) Bacterial load in injected flies at the indicated day after injection with E. coli . Error bars indicate standard deviation.
Figure Legend Snippet: A fob null allele is hypersensitive to infections with E. coli . (A) Schematic representation of the Drosophila fob gene and its neighbors. The targeting fragment generated in vivo ( Gong and Golic, 2003 ) contains portions of neighboring genes around the mini- white gene (red box). (B) Southern hybridization with the entire fob gene yielded a signal with Ore-R (wt) but with any fob allele. Reprobing the same membrane with dVps33b confirmed the presence of DNA in all lanes. (C) qRT-PCR showed no expression of fob but similar levels of expression for neighboring genes in fob 1 compared with wild type. Gene expression levels were normalized with rp49 as an internal control and are shown relative to wild type. (D and E) Survival after infection was measured for wt, fob 1 , and rescued fob 1 flies after injection with E. coli (D) or E. faecalis (E). (F) Induction of AMP genes 6 h after injection with E. coli (Drosocin, Diptericin, Cecropin, and Attacin) or 12 h after injection with E. faecalis (Defensin). (G) Bacterial load in injected flies at the indicated day after injection with E. coli . Error bars indicate standard deviation.

Techniques Used: Generated, In Vivo, Hybridization, Quantitative RT-PCR, Expressing, Infection, Injection, Standard Deviation

3) Product Images from "Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected"

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected

Journal: PLoS ONE

doi: 10.1371/journal.pone.0098077

Post-integration HIV-1 mRNA transcription and de novo viral protein production in epithelial cells (MOI: 0.2). (A) Detection of spliced HIV-1 tat mRNA in TR146, FaDu, A431 and TZM-bl control cells by PCR 24 h post-infection with YU2 (R5) or LAI (X4) infectious virus. Equal amounts of total RNA was used to synthesise viral cDNA which was then subjected to PCR using primers designed to span the TAT 1 and 2 exon junctions. (B) p55 gag protein detection in TR146, FaDu, A431 and TZM-bl control cells by Western blot after 24 h infection with R5 (YU2) and LAI (X4) virus. (C) Infection of TR146, FaDu, A431 and NP2-R5/X4 control cells with GFP-linked single-cycle X4, R5 and dual tropic HIV-1 gp160 pseudotyped virus and detection of GFP incorporation into epithelial cell DNA by flow cytometry. Error bars show standard error from the mean. Data are representative of three independent experiments.
Figure Legend Snippet: Post-integration HIV-1 mRNA transcription and de novo viral protein production in epithelial cells (MOI: 0.2). (A) Detection of spliced HIV-1 tat mRNA in TR146, FaDu, A431 and TZM-bl control cells by PCR 24 h post-infection with YU2 (R5) or LAI (X4) infectious virus. Equal amounts of total RNA was used to synthesise viral cDNA which was then subjected to PCR using primers designed to span the TAT 1 and 2 exon junctions. (B) p55 gag protein detection in TR146, FaDu, A431 and TZM-bl control cells by Western blot after 24 h infection with R5 (YU2) and LAI (X4) virus. (C) Infection of TR146, FaDu, A431 and NP2-R5/X4 control cells with GFP-linked single-cycle X4, R5 and dual tropic HIV-1 gp160 pseudotyped virus and detection of GFP incorporation into epithelial cell DNA by flow cytometry. Error bars show standard error from the mean. Data are representative of three independent experiments.

Techniques Used: Polymerase Chain Reaction, Infection, Western Blot, Flow Cytometry, Cytometry

4) Product Images from "Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions"

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions

Journal:

doi: 10.1128/AEM.71.5.2663-2676.2005

Comparison of the expression profiles of selected gene groups in biofilm cells and planktonic cells. Cells were grown as described in the text, and total RNA was extracted from the cells at the five times indicated and used in DNA microarray analyses.
Figure Legend Snippet: Comparison of the expression profiles of selected gene groups in biofilm cells and planktonic cells. Cells were grown as described in the text, and total RNA was extracted from the cells at the five times indicated and used in DNA microarray analyses.

Techniques Used: Expressing, Microarray

Related Articles

Amplification:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). .. The following primer sets were used for amplification: fob left, 5′-TATTGGAACCGATCCTCTCG-3′; fob right, 5′-CACCAGTTTCAATGCCTCCT-3′; Ca left, 5′-CCATATCAGCCGCATTTCTT-3′; Ca right, 5′-AAGCTGGCATCGTTCTGACT-3′; CG7829 left, 5′-CAGGAACCTACTGGGCAAAA-3′; CG7829 right, 5′-AGTAGACTCCCGGCTTGTCC-3′; CG7802 left, 5′-GTCGCGACATCGACACTTC-3′; CG7802 right, 5′-CGTTGGCAGTGAATGTGGT-3′; Attacin A left, 5′-TGCAGAACACAAGCATCCTAA-3′; Attacin A right, 5′-TAAGGAACCTCCGAGCACCT-3′; Cecropin A1 left, 5′-TCTTCGTTTTCGTCGCTCTC-3′; Cecropin A1 right, 5′-ACATTGGCGGCTTGTTGAG-3′; Defensin left, 5′-GATGTGGATCCAATTCCAGA-3′; Defensin right, 5′-CTTTGAACCCCTTGGCAAT-3′; Diptericin left, 5′-ACCGCAGTACCCACTCAATC-3′; Diptericin right, 5′-CCATATGGTCCTCCCAAGT-3′; G Drosocin left, 5′-TTCACCATCGTTTTCCTGCT-3′; Drosocin right, 5′-GGCAGCTTGAGTCAGGTGAT-3′; Drosomycin left, 5′-GTACTTGTTCGCCCTCTTCG-3′; Drosomycin right, 5′-ACTGGAGCGTCCCTCCTC-3′; rp49 left, 5′-ATCGGTTACGGATCGAACAA-3′; and rp49 right, 5′-GACAATCTCCTTGCGCTTCT-3′.

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: RNA was quantified using a NanoDrop 2000/2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed on RNA to confirm that all amplification from RNA was not above the background (no template control). .. Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE).

Synthesized:

Article Title: Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes
Article Snippet: .. The total RNA was then rendered DNA-free using TURBO DNA-free ™ kit (Ambion, Vilnius, Lithuania). cDNA was synthesized from 150 ng of total RNA using the qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK). .. PCR amplification of AdTEP1 and AdNOS coding sequences and of AdEF1 and AdAct partial sequences At the time of this study, the An. dirus genome was not sequenced.

Article Title: A Small RNA Encoded in the Rv2660c Locus of Mycobacterium tuberculosis Is Induced during Starvation and Infection
Article Snippet: .. Quantitative RT-PCR Total RNA was treated with Turbo DNase (Ambion) until DNA free. cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. .. Primers were designed using the Applied Biosystems software Primer Express, and sequences are listed in .

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: .. All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions. .. Primers were obtained from RTPrimerDB ( http://medgen.ugent.be/rtprimerdb/ ) and PrimerBank ( http://pga.mgh.harvard.edu/primerbank ) , .

Immunostaining:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: FITC-E. coli (catalogue No. F6694; Invitrogen) were used for phagocytosis and immunostaining experiments in hemocytes. .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems).

Real-time Polymerase Chain Reaction:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). ..

Article Title: Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β-Cells
Article Snippet: Paragraph title: RNA RT-PCR and Quantitative PCR of cDNA, Mitochondrial DNA, and Nuclear DNA ... Total RNA was DNase treated (DNA-Free; Ambion) and reverse transcribed (ABI High Capacity Reverse Transcriptase kit; ABI) following the manufacturers’ protocols.

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’). .. 0.5 μl of diluted cDNA (1:3, nuclease-free water) was used as template in 10 μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad, ‘CFX96 Real-Time System’)—see for oligonucleotide primer sequences (final reaction conc.

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: .. Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE). .. Northern blot analysis was performed using the NorthernMax kit (Thermo Fisher Scientific, Wilmington, DE) with the BrightStar BioDetect kit (Thermo Fisher Scientific, Wilmington, DE).

Article Title: FAS/FASL are dysregulated in chordoma and their loss-of-function impairs zebrafish notochord formation
Article Snippet: .. RT and quantitative real time PCR (qPCR) RTs were performed using 1 μg of DNase treated (DNA-free ™, Ambion) total RNA in pre sence of random hexamers (Life Technologies) and SuperScript II reverse transcriptase (Life Technologies). qPCRs were carried out as reported in Malafoglia [ ] and colleagues and also Supplementary Materials. .. Western blot analysis The whole proteins extraction was performed on fresh/frozen specimens from the new enrolled patients, which were disaggregated into a SDS-PAGE sample buffer containing protease inhibitors as in Bellipanni and colleague [ ].

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions. .. Gene expression of CD4, CCR5, CXCR4, DC-SIGN, SDC-1 (syndecan-1) and SDC-4 (syndecan-4) was quantified by real-time PCR using SYBR Green JumpStart Taq Ready Mix (Sigma) with 4 pmol primers and 1 µL cDNA in 10 µL reactions on the Corbett Research Rotor-Gene 6000 (Qiagen) using the following cycling parameters: 95°C for 3 min; followed by 95°C for 3 s, annealing for 10 s and extension for 20–30 s for 40 cycles.

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: Paragraph title: Quantitative real-time polymerase chain reaction ... Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA).

Incubation:

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions
Article Snippet: Sterile glass beads (200 mg) were added, and the cells were vortexed for 30 s, followed by 30 s of incubation on ice. .. Contaminating DNA in the RNA preparations was removed using “DNA-free” (Ambion).

Article Title: Identification of the ?B Regulon of Bacillus cereus and Conservation of ?B-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿ †
Article Snippet: When the A 600 of this culture reached 0.4 (mid-exponential growth phase), one of the other two cultures was transferred into a shaking water bath at 42°C and incubated for a further 10 min, which was followed by RNA isolation. .. Residual chromosomal DNA was removed by treating samples with DNA- free (Ambion).

Infection:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: Paragraph title: Infection experiments ... For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems).

Expressing:

Article Title: A Small RNA Encoded in the Rv2660c Locus of Mycobacterium tuberculosis Is Induced during Starvation and Infection
Article Snippet: Quantitative RT-PCR Total RNA was treated with Turbo DNase (Ambion) until DNA free. cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. .. Absolute quantitation was perfomed and all genes were normalised to 16S expression.

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: Paragraph title: HIV-1 receptor expression by quantitative reverse transcription-PCR ... All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions.

Article Title: Identification of the ?B Regulon of Bacillus cereus and Conservation of ?B-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿ †
Article Snippet: We previously found that at 10 min after the start of the heat shock, the levels of σB protein reached maximum levels , which leads to high-level expression of σB -dependent genes at this time point. .. Residual chromosomal DNA was removed by treating samples with DNA- free (Ambion).

Derivative Assay:

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’). .. Transcript levels were internally normalised against Rpl23 (60S ribosomal subunit component) and/or H2afz levels, and fold changes (plus s.e.m.) derived using the ΔΔCt method .

Sequencing:

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: Paragraph title: Transcriptome sequencing (RNA-Seq). ... DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion).

Article Title: A novel long non-coding natural antisense RNA is a negative regulator of Nos1 gene expression
Article Snippet: Two cDNA synthesis reactions were carried out on the DNA-free poly(A)+ RNA in the presence of SuperScript II reverse transcriptase (Life Technologies). .. In the second reaction we used primer 2 (5’-AACACCCTTGTTACCACAC-3’), which has the same sequence as Mm-antiNos1 RNA.

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA). .. A 10 μL qRT-PCR reaction included 1 μl of template cDNA (0.1 μL for limited LNCaP Hollow Fibre samples), 1× Platinum SYBR Green qPCR SuperMix-UDG with ROX (Invitrogen) and 0.3 μM each of forward and reverse intron-spanning primers that produce products between 85-115 bp in size (see Additional file for primer sequences). qRT-PCR reactions were cycled as follows in a 7900 HT Sequence Detection System (Applied Biosystems): 50°C for 2 min, 95°C for 2 min, (95°C for 0.5 min, 55-56°C for 0.3-0.5 min, and 72°C for 0.5 min) for 40-45 cycles, 95°C for 0.25 min, 60°C for 0.25 min, and 95°C for 0.25 min. All qRT-PCR reactions were performed in technical triplicates for each of at least three biological replicates. cDNAs (from different conditions) and genes [target and reference (glyceraldehyde-3-phosphate, GAPDH )] to be directly compared were assayed in the same instrument run.

Transferring:

Article Title: Identification of the ?B Regulon of Bacillus cereus and Conservation of ?B-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿ †
Article Snippet: RNA isolation was performed by transferring the cultures into a 50-ml Falcon tube, and the cultures were spun down at 13,000 × g for 20 s. After decanting the supernatant, the cell pellets were snap-frozen in liquid nitrogen. .. Residual chromosomal DNA was removed by treating samples with DNA- free (Ambion).

Northern Blot:

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: Paragraph title: RT-qPCR and Northern blot analysis. ... Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE).

Quantitative RT-PCR:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). ..

Article Title: The CCCTC Binding Factor, CTRL2, Modulates Heterochromatin Deposition and the Establishment of Herpes Simplex Virus 1 Latency In Vivo
Article Snippet: Paragraph title: qRT-PCR analysis. ... RNA was precipitated from the aqueous phase using a 0.7 volume of isopropanol, followed by DNase treatment using DNA-free (Ambion), according to the manufacturer’s directions.

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: Paragraph title: RT-qPCR and Northern blot analysis. ... Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE).

Article Title: A Small RNA Encoded in the Rv2660c Locus of Mycobacterium tuberculosis Is Induced during Starvation and Infection
Article Snippet: .. Quantitative RT-PCR Total RNA was treated with Turbo DNase (Ambion) until DNA free. cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. .. Primers were designed using the Applied Biosystems software Primer Express, and sequences are listed in .

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: Quantitative real-time polymerase chain reaction qRT-PCR was performed on TRIZOL-extracted RNA from LNCaP (serum-starved ± R1881 or the exception in Figure in 10% serum), DU145 (10% serum) and PC-3 (5% serum) cells maintained in vitro , and LNCaP cells maintained in the in vivo Hollow Fibre model[ ] (see below). .. Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA).

Cell Culture:

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Quantitative RTPCR (Q-RTPCR) Total RNA was prepared from ~30 cultured 16- (E3.1) or 32-cell stage (E3.6) Tead4 -KD or control embryos previously microinjected at the 2-cell stages (E1.5, in either one or both blastomeres) as instructed (Arcturus Biosciences; ‘PicoPure RNA isolation’). .. Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’).

Polymerase Chain Reaction:

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’). .. 0.5 μl of diluted cDNA (1:3, nuclease-free water) was used as template in 10 μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad, ‘CFX96 Real-Time System’)—see for oligonucleotide primer sequences (final reaction conc.

Sonication:

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions
Article Snippet: Biofilm cells, which adhere very strongly to each other, were separated by a 30-s pulse of sonication. .. Contaminating DNA in the RNA preparations was removed using “DNA-free” (Ambion).

Injection:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). ..

In Vivo:

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: Quantitative real-time polymerase chain reaction qRT-PCR was performed on TRIZOL-extracted RNA from LNCaP (serum-starved ± R1881 or the exception in Figure in 10% serum), DU145 (10% serum) and PC-3 (5% serum) cells maintained in vitro , and LNCaP cells maintained in the in vivo Hollow Fibre model[ ] (see below). .. Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA).

RNA Sequencing Assay:

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: Paragraph title: Transcriptome sequencing (RNA-Seq). ... DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion).

Fluorescence:

Article Title: Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β-Cells
Article Snippet: Total RNA was DNase treated (DNA-Free; Ambion) and reverse transcribed (ABI High Capacity Reverse Transcriptase kit; ABI) following the manufacturers’ protocols. .. Fluorescence-based real-time PCR was performed using the IQ Sybr Green Supermix kit (BioRad) and the IQ-5 Single Color Real-Time PCR Detection System (BioRad).

Isolation:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). ..

Article Title: The CCCTC Binding Factor, CTRL2, Modulates Heterochromatin Deposition and the Establishment of Herpes Simplex Virus 1 Latency In Vivo
Article Snippet: Mouse TG were isolated and placed in RNAlater and stored according to the manufacturer’s specifications. .. RNA was precipitated from the aqueous phase using a 0.7 volume of isopropanol, followed by DNase treatment using DNA-free (Ambion), according to the manufacturer’s directions.

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: Total RNA was isolated using a MasterPure RNA purification kit (Epicentre), and contaminating DNA was removed using a Turbo DNA-Free kit (Ambion). .. DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion).

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions
Article Snippet: Paragraph title: RNA isolation. ... Contaminating DNA in the RNA preparations was removed using “DNA-free” (Ambion).

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Quantitative RTPCR (Q-RTPCR) Total RNA was prepared from ~30 cultured 16- (E3.1) or 32-cell stage (E3.6) Tead4 -KD or control embryos previously microinjected at the 2-cell stages (E1.5, in either one or both blastomeres) as instructed (Arcturus Biosciences; ‘PicoPure RNA isolation’). .. Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’).

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: Following RNA isolation, an additional DNase I (New England Biolabs, Inc., Ipswich, MA) reaction was carried out, and RNA was then precipitated. .. Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE).

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: HIV-1 receptor expression by quantitative reverse transcription-PCR RNA was isolated from resting TZM-bl, TR146, FaDu and A431 cells using GenElute Mammalian Total RNA Miniprep Kit (Sigma), followed by treatment with Turbo DNA free DNAse (Ambion) according to the manufacturer's instructions. .. All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions.

Article Title: Identification of the ?B Regulon of Bacillus cereus and Conservation of ?B-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿-Regulated Genes in Low-GC-Content Gram-Positive Bacteria ▿ †
Article Snippet: Paragraph title: Strains, growth conditions, and RNA isolation. ... Residual chromosomal DNA was removed by treating samples with DNA- free (Ambion).

Microscopy:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: After 2 h, flies were mounted and imaged on a microscope with 1.5× magnification (SZX12; Olympus). .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems).

Purification:

Article Title: The CCCTC Binding Factor, CTRL2, Modulates Heterochromatin Deposition and the Establishment of Herpes Simplex Virus 1 Latency In Vivo
Article Snippet: RNA was precipitated from the aqueous phase using a 0.7 volume of isopropanol, followed by DNase treatment using DNA-free (Ambion), according to the manufacturer’s directions. .. In the case of ICP0, a 10-μl aliquot of purified RNA was used with the strand-specific primer for the ICP0 transcript (LAT I-1, GACACGGATTGGCTGGTGTAGTGGG; nucleotides 120797 to 120820) ( ).

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: Total RNA was isolated using a MasterPure RNA purification kit (Epicentre), and contaminating DNA was removed using a Turbo DNA-Free kit (Ambion). .. DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion).

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions
Article Snippet: Contaminating DNA in the RNA preparations was removed using “DNA-free” (Ambion). .. Purified RNA was stored at −20°C.

Reverse Transcription Polymerase Chain Reaction:

Article Title: The CCCTC Binding Factor, CTRL2, Modulates Heterochromatin Deposition and the Establishment of Herpes Simplex Virus 1 Latency In Vivo
Article Snippet: RNA was precipitated from the aqueous phase using a 0.7 volume of isopropanol, followed by DNase treatment using DNA-free (Ambion), according to the manufacturer’s directions. .. One-step RT-PCR was done using a SuperScript III One-Step RT-PCR system with Platinum Taq DNA polymerase according to the manufacturer’s protocol (Life Technologies).

Article Title: Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β-Cells
Article Snippet: Paragraph title: RNA RT-PCR and Quantitative PCR of cDNA, Mitochondrial DNA, and Nuclear DNA ... Total RNA was DNase treated (DNA-Free; Ambion) and reverse transcribed (ABI High Capacity Reverse Transcriptase kit; ABI) following the manufacturers’ protocols.

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Paragraph title: Quantitative RTPCR (Q-RTPCR) ... Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’).

Labeling:

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE). .. The probe to antigenome/CAT mRNA was approximately 700 base pairs in length; it was made in vitro using the TranscriptAid T7 high-yield transcription kit (Thermo Fisher Scientific, Wilmington, DE) and labeled with psoralen-biotin using the BrightStar psoralen-biotin kit (Thermo Fisher Scientific, Wilmington, DE).

Chloramphenicol Acetyltransferase Assay:

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: .. Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE). .. Northern blot analysis was performed using the NorthernMax kit (Thermo Fisher Scientific, Wilmington, DE) with the BrightStar BioDetect kit (Thermo Fisher Scientific, Wilmington, DE).

Mouse Assay:

Article Title: Gene expression profiling of the Notch-AhR-IL22 axis at homeostasis and in response to tissue injury
Article Snippet: Under general anesthesia, mice were killed by cervical dislocation and tissues were immediately transferred to RNAlater (Ambion, Carlsbad, CA, U.S.A.). .. Ten milligrams of tissue mass was used to obtain high quality, DNA-free, RNA with Pure Link RNA Mini Kit (Ambion, Carlsbad, CA, U.S.A.) according to manufacturer’s instructions, to ensure high-quality DNAse solution was applied to each sample and traces of DNAse were eliminated by additional washing steps.

Software:

Article Title: A Small RNA Encoded in the Rv2660c Locus of Mycobacterium tuberculosis Is Induced during Starvation and Infection
Article Snippet: Quantitative RT-PCR Total RNA was treated with Turbo DNase (Ambion) until DNA free. cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. .. Primers were designed using the Applied Biosystems software Primer Express, and sequences are listed in .

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions. .. Data was analyzed with Corbett Research Rotor-Gene 6000 Series Software 1.7 using the two standard curve method with β-actin used as the normalizer gene.

SYBR Green Assay:

Article Title: The full-of-bacteria gene is required for phagosome maturation during immune defense in Drosophila
Article Snippet: .. For anti-microbial peptide measurements, RNA was isolated from five flies after injection (6 h for E. coli and 12 h for E. faecalis ). qRT-PCR was performed using a DNA-free, high-capacity cDNA reverse transcription kit (Fast SYBR Green master mix; Applied Biosystems) and a Fast Real-Time PCR System (7500; Applied Biosystems). ..

Article Title: Diabetes Susceptibility Genes Pdx1 and Clec16a Function in a Pathway Regulating Mitophagy in β-Cells
Article Snippet: Total RNA was DNase treated (DNA-Free; Ambion) and reverse transcribed (ABI High Capacity Reverse Transcriptase kit; ABI) following the manufacturers’ protocols. .. Fluorescence-based real-time PCR was performed using the IQ Sybr Green Supermix kit (BioRad) and the IQ-5 Single Color Real-Time PCR Detection System (BioRad).

Article Title: The first two cell-fate decisions of preimplantation mouse embryo development are not functionally independent
Article Snippet: Eluted RNA (10 μl) was DNaseI treated (Ambion; ‘DNA-free ’ kit) and used to derive cDNA (30 μl) using oligodT priming (Invitrogen; ‘SuperscriptIII Reverse Transcriptase’). .. 0.5 μl of diluted cDNA (1:3, nuclease-free water) was used as template in 10 μl real-time PCR reactions (Qiagen: ‘SYBR Green PCR kit’) to assay specific transcripts (BioRad, ‘CFX96 Real-Time System’)—see for oligonucleotide primer sequences (final reaction conc.

Article Title: Oral and Vaginal Epithelial Cell Lines Bind and Transfer Cell-Free Infectious HIV-1 to Permissive Cells but Are Not Productively Infected
Article Snippet: All samples were confirmed DNA free prior to analysis. cDNA was synthesized from 1 µg of RNA using HIV reverse transcriptase (Ambion) according to the manufacturer's instructions. .. Gene expression of CD4, CCR5, CXCR4, DC-SIGN, SDC-1 (syndecan-1) and SDC-4 (syndecan-4) was quantified by real-time PCR using SYBR Green JumpStart Taq Ready Mix (Sigma) with 4 pmol primers and 1 µL cDNA in 10 µL reactions on the Corbett Research Rotor-Gene 6000 (Qiagen) using the following cycling parameters: 95°C for 3 min; followed by 95°C for 3 s, annealing for 10 s and extension for 20–30 s for 40 cycles.

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA). .. A 10 μL qRT-PCR reaction included 1 μl of template cDNA (0.1 μL for limited LNCaP Hollow Fibre samples), 1× Platinum SYBR Green qPCR SuperMix-UDG with ROX (Invitrogen) and 0.3 μM each of forward and reverse intron-spanning primers that produce products between 85-115 bp in size (see Additional file for primer sequences). qRT-PCR reactions were cycled as follows in a 7900 HT Sequence Detection System (Applied Biosystems): 50°C for 2 min, 95°C for 2 min, (95°C for 0.5 min, 55-56°C for 0.3-0.5 min, and 72°C for 0.5 min) for 40-45 cycles, 95°C for 0.25 min, 60°C for 0.25 min, and 95°C for 0.25 min. All qRT-PCR reactions were performed in technical triplicates for each of at least three biological replicates. cDNAs (from different conditions) and genes [target and reference (glyceraldehyde-3-phosphate, GAPDH )] to be directly compared were assayed in the same instrument run.

RNA Extraction:

Article Title: Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes
Article Snippet: Paragraph title: Total RNA extraction of whole mosquitoes and cDNA synthesis ... The total RNA was then rendered DNA-free using TURBO DNA-free ™ kit (Ambion, Vilnius, Lithuania). cDNA was synthesized from 150 ng of total RNA using the qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK).

Agarose Gel Electrophoresis:

Article Title: Differential Gene Expression Profiling of Staphylococcus aureus Cultivated under Biofilm and Planktonic Conditions
Article Snippet: Contaminating DNA in the RNA preparations was removed using “DNA-free” (Ambion). .. The RNA quality and quantity were determined by agarose gel electrophoresis and by measuring the absorbance at 260 and 280 nm (results not shown).

In Vitro:

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE). .. The probe to antigenome/CAT mRNA was approximately 700 base pairs in length; it was made in vitro using the TranscriptAid T7 high-yield transcription kit (Thermo Fisher Scientific, Wilmington, DE) and labeled with psoralen-biotin using the BrightStar psoralen-biotin kit (Thermo Fisher Scientific, Wilmington, DE).

Article Title: Identification of novel androgen-responsive genes by sequencing of LongSAGE libraries
Article Snippet: .. Contaminating genomic DNA was removed from in vitro RNA samples using DNA-free or TURBO DNA-free (Ambion, Austin, TX, USA). .. Input RNA (1 μg) was reverse transcribed with SuperScript III First Strand Synthesis kit (Invitrogen).

Homogenization:

Article Title: Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes
Article Snippet: The pooled mosquitoes were first cold-anesthetized before homogenization in cold lysis buffer using the handheld homogenizer, BioMasher-II (Nippi, Tokyo, Japan). .. The total RNA was then rendered DNA-free using TURBO DNA-free ™ kit (Ambion, Vilnius, Lithuania). cDNA was synthesized from 150 ng of total RNA using the qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK).

Ethanol Precipitation:

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion). .. The cDNA libraries were purified by phenol extraction and ethanol precipitation.

Quantitation Assay:

Article Title: A Small RNA Encoded in the Rv2660c Locus of Mycobacterium tuberculosis Is Induced during Starvation and Infection
Article Snippet: Quantitative RT-PCR Total RNA was treated with Turbo DNase (Ambion) until DNA free. cDNA was synthesized using Superscript III (Invitrogen) and random hexamers. .. Absolute quantitation was perfomed and all genes were normalised to 16S expression.

Spectrophotometry:

Article Title: Single Nucleoprotein Residue Modulates Arenavirus Replication Complex Formation
Article Snippet: RNA was quantified using a NanoDrop 2000/2000c spectrophotometer (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed on RNA to confirm that all amplification from RNA was not above the background (no template control). .. Once RNA was confirmed to be DNA free, reverse transcription was performed using Maxima reverse transcriptase (Thermo Fisher Scientific, Wilmington, DE). qPCR was performed using a primer pair specific to CAT (MG-870, 5′ ATCCGGCCTTTATTCACATTCTTG, and MG-987, 5′ ATGGAAAACGGTGTAACAAGGGTG) and Maxima SYBR green/ROX qPCR master mix (2×) (Thermo Fisher Scientific, Wilmington, DE).

Article Title: Gene expression profiling of the Notch-AhR-IL22 axis at homeostasis and in response to tissue injury
Article Snippet: Ten milligrams of tissue mass was used to obtain high quality, DNA-free, RNA with Pure Link RNA Mini Kit (Ambion, Carlsbad, CA, U.S.A.) according to manufacturer’s instructions, to ensure high-quality DNAse solution was applied to each sample and traces of DNAse were eliminated by additional washing steps. .. NanoDrop 1000 spectrophotometer (PEQLAB Biotechnologie, Erlangen, Germany) was used to assess the concentration and purity of aqueous RNA samples as described [ , ].

Concentration Assay:

Article Title: Gene expression profiling of the Notch-AhR-IL22 axis at homeostasis and in response to tissue injury
Article Snippet: Ten milligrams of tissue mass was used to obtain high quality, DNA-free, RNA with Pure Link RNA Mini Kit (Ambion, Carlsbad, CA, U.S.A.) according to manufacturer’s instructions, to ensure high-quality DNAse solution was applied to each sample and traces of DNAse were eliminated by additional washing steps. .. NanoDrop 1000 spectrophotometer (PEQLAB Biotechnologie, Erlangen, Germany) was used to assess the concentration and purity of aqueous RNA samples as described [ , ].

Construct:

Article Title: Regulation of the Min Cell Division Inhibition Complex by the Rcs Phosphorelay in Proteus mirabilis
Article Snippet: DNA-free samples were then enriched for mRNA using a MicrobExpress bacterial mRNA enrichment kit (Ambion). .. Two rounds of rRNA depletion were performed, and RNA purity was confirmed on an Agilent 2100 Bioanalyzer (Agilent Technologies). cDNA libraries were constructed from HI4320 and rcsB ::Strr mRNA using the SuperScript double-stranded cDNA synthesis kit (Invitrogen).

Lysis:

Article Title: Quantitative real-time PCR analysis of Anopheles dirus TEP1 and NOS during Plasmodium berghei infection, using three reference genes
Article Snippet: The pooled mosquitoes were first cold-anesthetized before homogenization in cold lysis buffer using the handheld homogenizer, BioMasher-II (Nippi, Tokyo, Japan). .. The total RNA was then rendered DNA-free using TURBO DNA-free ™ kit (Ambion, Vilnius, Lithuania). cDNA was synthesized from 150 ng of total RNA using the qPCRBIO cDNA synthesis kit (PCR Biosystems, London, UK).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher turbo dna free kit
    Turbo Dna Free Kit, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 935 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/turbo dna free kit/product/Thermo Fisher
    Average 90 stars, based on 935 article reviews
    Price from $9.99 to $1999.99
    turbo dna free kit - by Bioz Stars, 2020-01
    90/100 stars
      Buy from Supplier

    N/A
    Thermo Scientific pT7CFE1 NHis is a cloning plasmid optimized to use with the Thermo Scientific 1 Step Human In Vitro Protein Expression System for in vitro translation IVT of tagged
      Buy from Supplier

    N/A
    Thermo Scientific pT7CFE1 CHA is a cloning plasmid optimized to use with the Thermo Scientific 1 Step Human In Vitro Protein Expression System for in vitro translation IVT of tagged
      Buy from Supplier

    Image Search Results