dideoxy chain termination method  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93

    Structured Review

    Thermo Fisher dideoxy chain termination method
    Dideoxy Chain Termination Method, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 93/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dideoxy chain termination method/product/Thermo Fisher
    Average 93 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    dideoxy chain termination method - by Bioz Stars, 2020-04
    93/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems). ..

    Article Title: Hepatitis E Virus Quasispecies and the Outcome of Acute Hepatitis E in Solid-Organ Transplant Patients
    Article Snippet: The cDNAs of the 20 previously selected clones were amplified under the following conditions: 10 min at 94°C followed by 35 cycles of 15 s at 94°C, 30 s at 55°C, and 1 min 30 s at 68°C. .. The PCR products were extracted using Qiaquick PCR purification (Qiagen, Courtaboeuf, France) and sequenced on both strands by the dideoxy chain termination method (Prism Ready Reaction AmpliTaq Fs and dye deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL high-throughout capillary DNA analyzer (Applied Biosystems, Foster City, CA).

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: Paragraph title: Isolation and Sequence Analysis of the Medsa;cycA2;2 Genomic Clones ... The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems).

    Article Title: Microbial Origin of Plant-Type 2-Keto-3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthases, Exemplified by the Chorismate- and Tryptophan-Regulated Enzyme from Xanthomonas campestris
    Article Snippet: Cloning experiments were carried out according to the methods described by Sambrook et al. ( ). .. The DNA sequence of aroA II and flanking 5′ and 3′ regions was determined from plasmid pTacIQ and selected subclones and by primer walking by the dideoxy chain termination procedure ( ) using a Taq FS dye terminator fluorescence-based cycle sequencing kit (Applied Biosystems) with a Perkin-Elmer/Applied Biosystems Model 377-18E1 sequencer.

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: The subfragments generated were cloned into pUC118 and pUC119 to provide templates. .. DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems).

    Amplification:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: If all fragments were indistinguishable from the control, then all fragments were sequenced with the amplification sense primer. .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems).

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: Paragraph title: PCR amplification and sequencing of PfMSP-119 ... Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France).

    Article Title: Hepatitis E Virus Quasispecies and the Outcome of Acute Hepatitis E in Solid-Organ Transplant Patients
    Article Snippet: The amplification was performed using the Expand High Fidelity PCR system (Roche, Mannheim, Germany). .. The PCR products were extracted using Qiaquick PCR purification (Qiagen, Courtaboeuf, France) and sequenced on both strands by the dideoxy chain termination method (Prism Ready Reaction AmpliTaq Fs and dye deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL high-throughout capillary DNA analyzer (Applied Biosystems, Foster City, CA).

    Article Title: Hepatitis E Virus Strains in Rabbits and Evidence of a Closely Related Strain in Humans, France
    Article Snippet: .. DNA Sequencing Two fragments, one within ORF2 (189 bp) and the other within ORF1, encompassing the hypervariable region and X domain (≈1,400 bp), were amplified and sequenced in both directions by the dideoxy chain termination method (PRISM Ready Reaction Ampli Taq Fs and Dye Deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL capillary DNA analyzer (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: The NS5A and NS5B regions were amplified as previous reported [ ], using nested PCR by MasterMix 2.5x, 5prime (Quantabio©, Hamburg, Germany). .. Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems).

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: .. The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.). .. Homology searches based on the nucleotide sequences of the PCR products were performed with the Basic Local Alignment Search Tool (BLAST) in the DNA Data Bank of Japan (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html ) [ ].

    Article Title: A molecular epidemiological survey of Babesia,Hepatozoon, Ehrlichia and Anaplasmainfections of dogs in Japan
    Article Snippet: .. The nucleotide sequences of amplified DNA fragments were inserted into a pCR2.1 plasmid vector (Invitrogen, Carlsbad, CA, U.S.A.), and the nucleotide sequence of the inserted DNA fragments was determined by the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA, U.S.A.). .. Nucleotide sequence data from each sample were subjected to Basic Local Alignment Search Tool (BLAST) analysis in the DNA data bank of Japan [ ] (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html) to find closely-related species of pathogens.

    Fluorescence:

    Article Title: Microbial Origin of Plant-Type 2-Keto-3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthases, Exemplified by the Chorismate- and Tryptophan-Regulated Enzyme from Xanthomonas campestris
    Article Snippet: .. The DNA sequence of aroA II and flanking 5′ and 3′ regions was determined from plasmid pTacIQ and selected subclones and by primer walking by the dideoxy chain termination procedure ( ) using a Taq FS dye terminator fluorescence-based cycle sequencing kit (Applied Biosystems) with a Perkin-Elmer/Applied Biosystems Model 377-18E1 sequencer. ..

    Mutagenesis:

    Article Title: Genomic instability at the 13q31 locus and somatic mtDNA mutation in the D-loop site correlate with tumor aggressiveness in sporadic Brazilian breast cancer cases
    Article Snippet: mtDNA sequencing Hypervariable mitochondrial DNA regions I and II (D-loop region) were sequenced using the dideoxy chain termination method (BigDye® Terminator v3.1 Cycle Sequencing Kit) and analyzed in an automated ABI310 Sequencer (Applied Biosystems, USA). .. The mitochondrial somatic mutation data were assessed by comparing cancerous and adjacent non-cancerous breast samples.

    Isolation:

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: Paragraph title: Isolation and Sequence Analysis of the Medsa;cycA2;2 Genomic Clones ... The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems).

    Subcloning:

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: Paragraph title: Subcloning and DNA sequencing. ... DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems).

    Chromosome Walking:

    Article Title: Microbial Origin of Plant-Type 2-Keto-3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthases, Exemplified by the Chorismate- and Tryptophan-Regulated Enzyme from Xanthomonas campestris
    Article Snippet: .. The DNA sequence of aroA II and flanking 5′ and 3′ regions was determined from plasmid pTacIQ and selected subclones and by primer walking by the dideoxy chain termination procedure ( ) using a Taq FS dye terminator fluorescence-based cycle sequencing kit (Applied Biosystems) with a Perkin-Elmer/Applied Biosystems Model 377-18E1 sequencer. ..

    Plasmid Preparation:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems). ..

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: .. The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems). .. cycA2 ; 2pr - Gus was constructed by cloning the 2,310-bp Bsu36- Xho I promoter region in front of the Gus reporter gene ( uidA from Escherichia coli ) into the binary vector pPR97 ( ).

    Article Title: Microbial Origin of Plant-Type 2-Keto-3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthases, Exemplified by the Chorismate- and Tryptophan-Regulated Enzyme from Xanthomonas campestris
    Article Snippet: .. The DNA sequence of aroA II and flanking 5′ and 3′ regions was determined from plasmid pTacIQ and selected subclones and by primer walking by the dideoxy chain termination procedure ( ) using a Taq FS dye terminator fluorescence-based cycle sequencing kit (Applied Biosystems) with a Perkin-Elmer/Applied Biosystems Model 377-18E1 sequencer. ..

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: .. The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.). .. Homology searches based on the nucleotide sequences of the PCR products were performed with the Basic Local Alignment Search Tool (BLAST) in the DNA Data Bank of Japan (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html ) [ ].

    Article Title: A molecular epidemiological survey of Babesia,Hepatozoon, Ehrlichia and Anaplasmainfections of dogs in Japan
    Article Snippet: .. The nucleotide sequences of amplified DNA fragments were inserted into a pCR2.1 plasmid vector (Invitrogen, Carlsbad, CA, U.S.A.), and the nucleotide sequence of the inserted DNA fragments was determined by the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA, U.S.A.). .. Nucleotide sequence data from each sample were subjected to Basic Local Alignment Search Tool (BLAST) analysis in the DNA data bank of Japan [ ] (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html) to find closely-related species of pathogens.

    TA Cloning:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems). ..

    Microscopy:

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: Detection of Plasmodium species in samples was performed by both microscopy and nested-PCR amplification as described previously [ ]. .. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France).

    Purification:

    Article Title: Hepatitis E Virus Quasispecies and the Outcome of Acute Hepatitis E in Solid-Organ Transplant Patients
    Article Snippet: .. The PCR products were extracted using Qiaquick PCR purification (Qiagen, Courtaboeuf, France) and sequenced on both strands by the dideoxy chain termination method (Prism Ready Reaction AmpliTaq Fs and dye deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL high-throughout capillary DNA analyzer (Applied Biosystems, Foster City, CA). ..

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: The PCR products were purified by PCR Illustra MicroSpin S-300 HR Columns (Gelifesciences, Buckinghamshire, UK) in accordance with the manufacturer’s instructions. .. Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems).

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: Phage particles were purified with LambdaSorb phage adsorbent (Promega), and DNA was extracted with phenol-chloroform. .. DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems).

    Sequencing:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems). ..

    Article Title: Characterization of the Polyproline Region of the Hepatitis E Virus in Immunocompromised Patients
    Article Snippet: Paragraph title: (ii) Nucleotide sequencing. ... Nested PCR products were sequenced on both strands by the dideoxy chain termination method (PRISM Ready Reaction AmpliTaq Fs and BigDye Terminator; Applied Biosystems, Paris, France) on an ABI 3130XL analyzer (Applied Biosystems, Foster City, CA) using primers 1710-S, 2080-S (GCAYATCTGGGAGTCTGCTAACCC), 3050-AS, and 2150-AS (GGGGAGAAGTCGCTAGAGAAACCTGATGT).

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: .. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France). ..

    Article Title: Hepatitis E Virus Quasispecies and the Outcome of Acute Hepatitis E in Solid-Organ Transplant Patients
    Article Snippet: Paragraph title: (iii) Nucleotide sequencing. ... The PCR products were extracted using Qiaquick PCR purification (Qiagen, Courtaboeuf, France) and sequenced on both strands by the dideoxy chain termination method (Prism Ready Reaction AmpliTaq Fs and dye deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL high-throughout capillary DNA analyzer (Applied Biosystems, Foster City, CA).

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: Paragraph title: Isolation and Sequence Analysis of the Medsa;cycA2;2 Genomic Clones ... The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems).

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: .. Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems). ..

    Article Title: Microbial Origin of Plant-Type 2-Keto-3-Deoxy-d-arabino-Heptulosonate 7-Phosphate Synthases, Exemplified by the Chorismate- and Tryptophan-Regulated Enzyme from Xanthomonas campestris
    Article Snippet: .. The DNA sequence of aroA II and flanking 5′ and 3′ regions was determined from plasmid pTacIQ and selected subclones and by primer walking by the dideoxy chain termination procedure ( ) using a Taq FS dye terminator fluorescence-based cycle sequencing kit (Applied Biosystems) with a Perkin-Elmer/Applied Biosystems Model 377-18E1 sequencer. ..

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: .. The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.). .. Homology searches based on the nucleotide sequences of the PCR products were performed with the Basic Local Alignment Search Tool (BLAST) in the DNA Data Bank of Japan (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html ) [ ].

    Article Title: Genomic instability at the 13q31 locus and somatic mtDNA mutation in the D-loop site correlate with tumor aggressiveness in sporadic Brazilian breast cancer cases
    Article Snippet: .. mtDNA sequencing Hypervariable mitochondrial DNA regions I and II (D-loop region) were sequenced using the dideoxy chain termination method (BigDye® Terminator v3.1 Cycle Sequencing Kit) and analyzed in an automated ABI310 Sequencer (Applied Biosystems, USA). .. All of the sequences were aligned to the Revised Cambridge Reference Sequence, accession number NC_012920.

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems). .. The sequencing reaction was carried out as recommended in the manuals for Taq dye terminator cycle sequencing kits (Applied Biosystems).

    Article Title: A molecular epidemiological survey of Babesia,Hepatozoon, Ehrlichia and Anaplasmainfections of dogs in Japan
    Article Snippet: .. The nucleotide sequences of amplified DNA fragments were inserted into a pCR2.1 plasmid vector (Invitrogen, Carlsbad, CA, U.S.A.), and the nucleotide sequence of the inserted DNA fragments was determined by the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA, U.S.A.). .. Nucleotide sequence data from each sample were subjected to Basic Local Alignment Search Tool (BLAST) analysis in the DNA data bank of Japan [ ] (DDBJ, http://www.ddbj.nig.ac.jp/Welcome-j.html) to find closely-related species of pathogens.

    Polymerase Chain Reaction:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems). ..

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: .. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France). ..

    Article Title: Hepatitis E Virus Quasispecies and the Outcome of Acute Hepatitis E in Solid-Organ Transplant Patients
    Article Snippet: .. The PCR products were extracted using Qiaquick PCR purification (Qiagen, Courtaboeuf, France) and sequenced on both strands by the dideoxy chain termination method (Prism Ready Reaction AmpliTaq Fs and dye deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL high-throughout capillary DNA analyzer (Applied Biosystems, Foster City, CA). ..

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: This probe was generated by PCR using as forward primer the 5′-GCTGGAGAGGTTTCAAGTCG-3′ and as reverse primer the 5′-ACATGAGGTTGAGCAGGCTT-3′ sequences in the presence of [α-32 P]dCTP according to the Taq polymerase manufacturer instructions (Roche Diagnostics, Mannheim, Germany). .. The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems).

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: The PCR products were purified by PCR Illustra MicroSpin S-300 HR Columns (Gelifesciences, Buckinghamshire, UK) in accordance with the manufacturer’s instructions. .. Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems).

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: This analysis showed that the PCR detected EBV in one reaction mixture containing 100 copies of the EBV DNA (data not shown). .. The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.).

    Article Title: Genomic instability at the 13q31 locus and somatic mtDNA mutation in the D-loop site correlate with tumor aggressiveness in sporadic Brazilian breast cancer cases
    Article Snippet: mtDNA sequencing Hypervariable mitochondrial DNA regions I and II (D-loop region) were sequenced using the dideoxy chain termination method (BigDye® Terminator v3.1 Cycle Sequencing Kit) and analyzed in an automated ABI310 Sequencer (Applied Biosystems, USA). .. The primer pairs designed for the PCR and direct sequencing of mtDNAs are provided in Supplementary .

    Article Title: A molecular epidemiological survey of Babesia,Hepatozoon, Ehrlichia and Anaplasmainfections of dogs in Japan
    Article Snippet: In the second round PCR, primers EHR16SD (5′-GGT ACC TAC AGA AGA AGT CC-3′) and EHR16SR (5′-TAG CAC TCA TCG TTT ACA GC-3′) were used. .. The nucleotide sequences of amplified DNA fragments were inserted into a pCR2.1 plasmid vector (Invitrogen, Carlsbad, CA, U.S.A.), and the nucleotide sequence of the inserted DNA fragments was determined by the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA, U.S.A.).

    Generated:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: If a heteroduplex was generated, this fragment was sequenced selectively. .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems).

    Article Title: The Medicago Species A2-Type Cyclin Is Auxin Regulated and Involved in Meristem Formation But Dispensable for Endoreduplication-Associated Developmental Programs 1
    Article Snippet: This probe was generated by PCR using as forward primer the 5′-GCTGGAGAGGTTTCAAGTCG-3′ and as reverse primer the 5′-ACATGAGGTTGAGCAGGCTT-3′ sequences in the presence of [α-32 P]dCTP according to the Taq polymerase manufacturer instructions (Roche Diagnostics, Mannheim, Germany). .. The promoter region of the longest insert hybridizing with the probe was subcloned into pBluescript II KS vector (Stratagene, La Jolla, CA) and sequenced using Automatic Sequencer 373A (Applied Biosystems, Foster City, CA) with the dideoxy chain termination method (Big Dye Terminator, Applied Biosystems).

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems). .. The newly generated NS5A and NS5B sequences can be retrieved from GenBank® under accession numbers: MK814770-MK814771-MK814772-MK814773.

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: The subfragments generated were cloned into pUC118 and pUC119 to provide templates. .. DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems).

    Construct:

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.). .. We performed the distance matrix calculations and constructed a phylogenetic tree with ClustalW version 1.8 in DDBJ.

    DNA Purification:

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: To define the sequence polymorphism in Pfmsp -1 19 gene (corresponding to 4894 to 5242 bp) the following primers were used: PfF: TCCAAggATCCTTAAACATTTCACAACAC PfR: TCCTACTCgAgTTAAATgAAACTgTATAAT Amplified fragments (n = 50) were gel-purified using the QIAGEN DNA purification kit (Qiagen, Germany) following the manufacturer's instructions. .. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France).

    Reverse Transcription Polymerase Chain Reaction:

    Article Title: Hepatitis E Virus Strains in Rabbits and Evidence of a Closely Related Strain in Humans, France
    Article Snippet: DNA Sequencing Two fragments, one within ORF2 (189 bp) and the other within ORF1, encompassing the hypervariable region and X domain (≈1,400 bp), were amplified and sequenced in both directions by the dideoxy chain termination method (PRISM Ready Reaction Ampli Taq Fs and Dye Deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL capillary DNA analyzer (Applied Biosystems, Foster City, CA, USA). .. The whole genomes of 2 rabbit strains (W1–11 and W7–57) and 1 human strain (TLS-18516-human) were amplified by overlapping RT-PCR.

    DNA Sequencing:

    Article Title: Hepatitis E Virus Strains in Rabbits and Evidence of a Closely Related Strain in Humans, France
    Article Snippet: .. DNA Sequencing Two fragments, one within ORF2 (189 bp) and the other within ORF1, encompassing the hypervariable region and X domain (≈1,400 bp), were amplified and sequenced in both directions by the dideoxy chain termination method (PRISM Ready Reaction Ampli Taq Fs and Dye Deoxy primers; Applied Biosystems, Paris, France) on an ABI 3130XL capillary DNA analyzer (Applied Biosystems, Foster City, CA, USA). ..

    Article Title: Cloning, Overexpression, and Mutagenesis of the Sporobolomyces salmonicolor AKU4429 Gene Encoding a New Aldehyde Reductase, Which Catalyzes the Stereoselective Reduction of Ethyl 4-Chloro-3-Oxobutanoate to Ethyl (S)-4-Chloro-3-Hydroxybutanoate
    Article Snippet: .. DNA sequencing was performed by the dideoxy chain termination method ( , ) by using an automated DNA sequencer (model 373A; Applied Biosystems). .. The sequencing reaction was carried out as recommended in the manuals for Taq dye terminator cycle sequencing kits (Applied Biosystems).

    Nested PCR:

    Article Title: Characterization of the Polyproline Region of the Hepatitis E Virus in Immunocompromised Patients
    Article Snippet: .. Nested PCR products were sequenced on both strands by the dideoxy chain termination method (PRISM Ready Reaction AmpliTaq Fs and BigDye Terminator; Applied Biosystems, Paris, France) on an ABI 3130XL analyzer (Applied Biosystems, Foster City, CA) using primers 1710-S, 2080-S (GCAYATCTGGGAGTCTGCTAACCC), 3050-AS, and 2150-AS (GGGGAGAAGTCGCTAGAGAAACCTGATGT). .. Electropherogram data were analyzed using Sequencher 4.8 (Gene Codes Corporation).

    Article Title: Non-variant specific antibody responses to the C-terminal region of merozoite surface protein-1 of Plasmodium falciparum (PfMSP-119) in Iranians exposed to unstable malaria transmission
    Article Snippet: Detection of Plasmodium species in samples was performed by both microscopy and nested-PCR amplification as described previously [ ]. .. Direct sequencing of the DNA fragments was performed in both directions for each PCR product using the dideoxy chain termination procedure (Chemistry V3.1, Applied Biosystems) and also the 3730XL DNA analyser (Applied Biosystems) by MilleGen sequencing service (Labege, France).

    Article Title: Clinical, Virological Characteristics, and Outcomes of Treatment with Sofosbuvir/Ledipasvir in Two Pediatric Patients Infected by HCV Genotype 4
    Article Snippet: The NS5A and NS5B regions were amplified as previous reported [ ], using nested PCR by MasterMix 2.5x, 5prime (Quantabio©, Hamburg, Germany). .. Sequencing reactions were performed by means the traditional dideoxy chain termination method (ABI PRISM 3500 genetic analyzer, Applied Biosystems).

    Derivative Assay:

    Article Title: Haploinsufficiency for One COL3A1 Allele of Type III Procollagen Results in a Phenotype Similar to the Vascular Form of Ehlers-Danlos Syndrome, Ehlers-Danlos Syndrome Type IV
    Article Snippet: The sequences of the primers (see the Appendix) were derived from the previously published cDNA sequence for COL3A1 (Ala-Kokko et al. ; Benson-Chanda et al. ). .. Sequence was determined either by the dideoxy-chain–termination method (Sanger et al. ) using T7 polymerase (Sequenase version 2.0; US Biochemicals) after the fragment of interest was directly cloned into the PCR II vector, according to instructions provided in the TA cloning kit (Invitrogen), or by an ABI PRISM BigDye Terminator cycle sequencing reaction and ABI PRISM 310 Genetic Analyzer (Perkin-Elmer Applied Biosystems).

    Software:

    Article Title: Molecular epidemiological study of gammaherpesvirus in domestic cats in Japan
    Article Snippet: The nucleotide sequences of the amplified DNA fragments were inserted into the pCR2.1 plasmid vector (Invitrogen), and the nucleotide sequence of each inserted DNA fragment was determined with the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit; Applied Biosystems, Foster City, CA, U.S.A.). .. The Kimura two-parameter method was used to calculate the distance matrix of the aligned sequences, with all gaps ignored, and the neighbor-joining method in the DNADIST program from the PHYLIP software package ( http://evolution.genetics.washington.edu/phylip.html ) was used to construct the phylogenetic tree, as previously described [ ].

    Article Title: A molecular epidemiological survey of Babesia,Hepatozoon, Ehrlichia and Anaplasmainfections of dogs in Japan
    Article Snippet: The nucleotide sequences of amplified DNA fragments were inserted into a pCR2.1 plasmid vector (Invitrogen, Carlsbad, CA, U.S.A.), and the nucleotide sequence of the inserted DNA fragments was determined by the dideoxy chain termination method (ABI Prism BigDye Primer Cycle Sequencing Ready Reaction Kit, Applied Biosystems, Foster City, CA, U.S.A.). .. 10.0.3 software (GENETYX Corp., Tokyo, Japan).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher dideoxy chain termination procedure
    Dideoxy Chain Termination Procedure, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 19 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dideoxy chain termination procedure/product/Thermo Fisher
    Average 90 stars, based on 19 article reviews
    Price from $9.99 to $1999.99
    dideoxy chain termination procedure - by Bioz Stars, 2020-04
    90/100 stars
      Buy from Supplier

    Image Search Results