deparaffinization  (Qiagen)


Bioz Verified Symbol Qiagen is a verified supplier
Bioz Manufacturer Symbol Qiagen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Name:
    Deparaffinization Solution
    Description:
    For deparaffinization of FFPE samples Kit contents Qiagen Deparaffinization Solution 2 x 8mL Non odorous and is easily Tracked with its Blue Tracer Dye For Deparaffinization of FFPE Samples
    Catalog Number:
    19093
    Price:
    180
    Category:
    Deparaffinization Solution
    Buy from Supplier


    Structured Review

    Qiagen deparaffinization
    Deparaffinization Solution
    For deparaffinization of FFPE samples Kit contents Qiagen Deparaffinization Solution 2 x 8mL Non odorous and is easily Tracked with its Blue Tracer Dye For Deparaffinization of FFPE Samples
    https://www.bioz.com/result/deparaffinization/product/Qiagen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deparaffinization - by Bioz Stars, 2021-04
    86/100 stars

    Images

    1) Product Images from "Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis"

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0178706

    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.
    Figure Legend Snippet: Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Techniques Used: High Throughput Screening Assay, Flow Cytometry, Incubation, Modification, Lysis, Formalin-fixed Paraffin-Embedded

    Related Articles

    Lysis:

    Article Title: Detection of Merkel Cell Polyomavirus in Seborrheic Keratosis
    Article Snippet: Five consecutive 10 μm thick sections were cut from each FFPE tissue. .. After deparaffinization, the tissues were lysed with proteinase K overnight (56°C) until complete tissue lysis, and DNA was extracted using a DNA Isolation QIAamp minikit (Qiagen, Hilden, Germany). ..

    DNA Extraction:

    Article Title: Detection of Merkel Cell Polyomavirus in Seborrheic Keratosis
    Article Snippet: Five consecutive 10 μm thick sections were cut from each FFPE tissue. .. After deparaffinization, the tissues were lysed with proteinase K overnight (56°C) until complete tissue lysis, and DNA was extracted using a DNA Isolation QIAamp minikit (Qiagen, Hilden, Germany). ..

    Purification:

    Article Title: Identification of a metastatic lung adenocarcinoma of the palate mucosa through genetic and histopathological analysis: a rare case report and literature review
    Article Snippet: Furthermore, presence or abscense of KRAS mutation in pleural effusion was examined. .. Genomic DNA was purified from formalin-fixed paraffin-embedded (FFPE) cells of pleural effusion using Deparaffinization Solution (QIAGEN) and QIAamp DNA FFPE Tissue Kit (QIAGEN). .. PCR was performed using 40 ng genomic DNA and the following primers; forward primer, 5′- AGGCCTGCTGAAAATGACTG -3′, and reverse primer, 5′- GGTCCTGCACCAGTAATATGCA -3′ (annealing temperature: 55 °C) [ ].

    Formalin-fixed Paraffin-Embedded:

    Article Title: Identification of a metastatic lung adenocarcinoma of the palate mucosa through genetic and histopathological analysis: a rare case report and literature review
    Article Snippet: Furthermore, presence or abscense of KRAS mutation in pleural effusion was examined. .. Genomic DNA was purified from formalin-fixed paraffin-embedded (FFPE) cells of pleural effusion using Deparaffinization Solution (QIAGEN) and QIAamp DNA FFPE Tissue Kit (QIAGEN). .. PCR was performed using 40 ng genomic DNA and the following primers; forward primer, 5′- AGGCCTGCTGAAAATGACTG -3′, and reverse primer, 5′- GGTCCTGCACCAGTAATATGCA -3′ (annealing temperature: 55 °C) [ ].

    Article Title: Aberrant microRNA-137 promoter methylation is associated with lymph node metastasis and poor clinical outcomes in non-small cell lung cancer
    Article Snippet: Total tissue RNA was extracted from FFPE tissue sections using the miRNeasy FFPE kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. .. Paraffin was removed from freshly cut FFPE tissue sections each up to 10-µm thick using deparaffinization solution using the miRNeasy FFPE kit (Qiagen, Inc.), and samples under went protease digestion at room temperature to release RNA from the sections, then short incubation (at 56°C for 15 min, then at 80°C for 15 min) to reverse formalin cross-linking of the released nucleic acids and DNase digestion to remove DNA. ..

    Article Title: Up-Regulation of miR-21, miR-25, miR-93, and miR-106b in Gastric Cancer
    Article Snippet: For the analysis of GD and GC samples, a pathologist assessed the slides to ensure the appropriate selection of tumor tissue and blocks with more than 50% tumor content per block. .. Deparaffinization solution (Qiagen, Hilden, Germany) was used to remove paraffin from FFPE tissue. .. For RNA extraction, we used the Qiagen miRNeasy FFPE kit (Qiagen) according to the manufacturer’s protocol.

    Incubation:

    Article Title: Aberrant microRNA-137 promoter methylation is associated with lymph node metastasis and poor clinical outcomes in non-small cell lung cancer
    Article Snippet: Total tissue RNA was extracted from FFPE tissue sections using the miRNeasy FFPE kit (Qiagen, Inc., Valencia, CA, USA) according to the manufacturer's protocol. .. Paraffin was removed from freshly cut FFPE tissue sections each up to 10-µm thick using deparaffinization solution using the miRNeasy FFPE kit (Qiagen, Inc.), and samples under went protease digestion at room temperature to release RNA from the sections, then short incubation (at 56°C for 15 min, then at 80°C for 15 min) to reverse formalin cross-linking of the released nucleic acids and DNase digestion to remove DNA. ..

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86
    Qiagen deparaffinization
    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the <t>lysis/deparaffinization</t> steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.
    Deparaffinization, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deparaffinization/product/Qiagen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deparaffinization - by Bioz Stars, 2021-04
    86/100 stars
      Buy from Supplier

    86
    Qiagen heptane based deparaffinization
    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the <t>lysis/deparaffinization</t> steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.
    Heptane Based Deparaffinization, supplied by Qiagen, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/heptane based deparaffinization/product/Qiagen
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    heptane based deparaffinization - by Bioz Stars, 2021-04
    86/100 stars
      Buy from Supplier

    Image Search Results


    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Journal: PLoS ONE

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis

    doi: 10.1371/journal.pone.0178706

    Figure Lengend Snippet: Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Article Snippet: The manual lysis, deparaffinization, proteinase K treatment and reverse crosslinking of the samples as well as the automation of the subsequent purification steps on Qiagen’s QIAcube robot allows the processing of 96 samples in 8–9 separate one-day runs (with > 6hrs total hands-on time).

    Techniques: High Throughput Screening Assay, Flow Cytometry, Incubation, Modification, Lysis, Formalin-fixed Paraffin-Embedded

    Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Journal: PLoS ONE

    Article Title: Automated high throughput nucleic acid purification from formalin-fixed paraffin-embedded tissue samples for next generation sequence analysis

    doi: 10.1371/journal.pone.0178706

    Figure Lengend Snippet: Automated high throughput FormaPure-based extraction protocol. ( A ) Work flow illustration of sample acquisition, upstream sample processing and extraction. Note that a separate high temperature incubation step is added to facilitate the reversal of remaining crosslinks. The upstream processes are manual in the original protocol whereas those steps are modified to be suitable for automation in the modified protocol. The in-house on-deck heating blocks were instrumental in rendering the lysis/deparaffinization steps automatable. Acquisition of samples in SBS format matrix tubes with their automated capping and decapping were also further measures that allowed the entire process to be amenable for automated liquid handling. ( B ) gDNA yield. Historical gDNA yield data from the Qiagen/High Pure protocol (Q; n = 142) using equivalent sizes of numerous FFPE samples of lymphoma origin was compared with that of the FormaPure protocol (F; n-91). (C) RNA yield. Comparison of the Qiagen-High Pure (Q-H), and FormaPure (F) protocols are shown. N = 142 for Q-H and N = 44 for F.

    Article Snippet: The protocol also includes upstream steps such as heptane-based deparaffinization that are different from those employed in either the Qiagen or Roche protocols.

    Techniques: High Throughput Screening Assay, Flow Cytometry, Incubation, Modification, Lysis, Formalin-fixed Paraffin-Embedded