Structured Review

TaKaRa deoxynucleotide triphosphate
Deoxynucleotide Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 98/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleotide triphosphate/product/TaKaRa
Average 98 stars, based on 81 article reviews
Price from $9.99 to $1999.99
deoxynucleotide triphosphate - by Bioz Stars, 2020-09
98/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Genetic and population analyses of Vibrio parahaemolyticus isolates from three major coastal regions in China
Article Snippet: .. The PCR mixture with a volume of 50 μl contained 50 mM KCl, 10 mM Tris-HCl (pH8.0), 2.5 mM MgCl2 , 0.001% gelatin, 0.1% BSA, 100 μl of each of dATP, dTTP, dCTP and dGTP, 0.1 μM of each primer, two units of ExTaq polymerase (TaKaRa), and 5 ng of template DNA. .. PCR conditions were as follows: predenaturation at 95°C for 5 min; 30 cycles of 94°C for 50 s, an appropriate annealing temperature for 50 s, and 72°C for 80 s; with a final extension step of 72°C for 7 min.

Article Title: vfr, A Global Regulatory Gene, is Required for Pyrrolnitrin but not for Phenazine-1-carboxylic Acid Biosynthesis in Pseudomonas chlororaphis G05
Article Snippet: .. Regular PCR amplifications were carried out with a 25 μl reaction mixture containing 1 × LA with GC buffer, 2 mM MgSO4 , 200 μM (each) dATP, dGTP, dCTP, and dTTP, 10 pmol of each primer, 0.2 μl LA DNA polymerase (Takara Bio, Dalian, China), and 10 ng of purified genomic DNA of the strain G05 or its derivative mutants. .. All the amplifications were performed in T100TM thermal cycler (Bio-Rad Laboratory, Hercules, CA, USA).

Article Title: Development of an integrative database with 499 novel microsatellite markers for Macaca fascicularis
Article Snippet: .. Ten microliters of the reaction mixture contained 10 ng of genomic DNA, 2.5 nmol each of dATP, dCTP, dGTP, and dTTP, 0.25 units of ExTaq, 5.0 pmol of forward and reverse primers, and the manufacturer's PCR buffer (all purchased from Takara Biosystems, Otsu, Japan). ..

Article Title: pO157_Sal, a Novel Conjugative Plasmid Detected in Outbreak Isolates of Escherichia coli O157:H7 ▿ O157:H7 ▿ †
Article Snippet: .. PCR was performed in a reaction volume of 20 μl containing 1× PCR buffer, 200 μM (each) dATP, dCTP, dTTP, and dGTP, 0.5 μM (each) primers, 1 U of Taq DNA polymerase (TaKaRa, Dalian, China), and 50 ng of genomic DNA templates. .. PCR products (5 μl) were visualized on ethidium bromide-stained 1.2% agarose gels by illumination with UV light.

Article Title: Sorafenib controls the epithelial-mesenchymal transition of ovarian cancer cells via EGF and the CD44-HA signaling pathway in a cell type-dependent manner
Article Snippet: .. PCR was performed according to the manufacturer's instructions using the Prime Taq Premix with Prime Taq DNA Polymerase 1 unit/10 µl, 2X reaction buffer, 4 mM MgCl2 , enzyme stabilizer, sediment, loading dye, pH 9.0 and 0.5 mM each of dATP, dCTP, dGTP, dTTP (cat. no. #G-3002; GeNet Bio, Daejeon, Korea) with the following primers and Takara PCR Thermal Cycler Dice (cat. no. #TP600; Takara Bio, Inc.). .. Initially, the mixed RT product was reacted at 95°C for 30 sec for denaturation and then the annealing step was performed with specific primers: Vimentin (30 cycles at 60°C), sense GGA AGA GAA CTT TGC CGT TGA A, antisense GTG ACG AGC CAT TTC CTC CTT; matrix metalloproteinase (MMP)-2 (30 cycles at 66°C), sense TGG CAA GTA CGG CTT CTG TC, antisense, TGG CAA GTA CGG CTT CTG TC; MMP-9 (25 cycles at 65°C), sense TGC GCT ACC ACC TCG AAC TT, antisense GAT GCC AT TGA CGT CGT CCT; B-Raf (30 cycles at 58°C), sense TGG GGA ACG GAA CTG ATT TTT C, antisense TTT TGT GGT GAC TTG GGG TTG; hyaluronan synthase (HAS) 1 (30 cycles at 60°C), sense TAC AAC CAG AAG TTC CTG GG, antisense CTG GAG GTG TAC TTG GTA GC; HAS2 (30 cycles at 60°C), sense GTG GAT TAT GTA CAG GTT TGT GA, antisense TCC AAC CAT GGG ATC TTC TT; HAS3 (30 cycles at 60°C), sense GAG ATG TCC AGA TCC TCA ACA A, antisense CCC ACT AAT ACA CTG CAC AC; and β-actin (25 cycles at 60°C), sense ATC CAC GAA ACT ACC TTC AA and antisense ATC CAC ACG GAG TAC TTG C. Extension steps were performed at 72°C for 1 min and the final elongation step was at 72°C for 5 min. PCR products were analyzed by agarose gel (1%) electrophoresis and visualized using ethidium bromide (Sigma Aldrich; Merck KGaA, Darmstadt, Germany) under ultraviolet light using the multiple Gel DOC system (Fujifilm Corporation, Tokyo, Japan).

Article Title: A genetic approach for the identification of exosporium assembly determinants of Bacillus anthracis
Article Snippet: .. Five nanograms of self-ligated DNA was used as the template in a 50 μl PCR reaction mixture containing 37.5 ng of each primer (Tn916 62–38, TAGAATAAGGCTTTACGAGC and Tn916 12185–12190, CCTTGATAAAGTGTGATAAG); 2 mM MgCl2 ; 200 μM (each) dATP, dCTP, dGTP, and dTTP; and 1.25 U of ExTaq polymerase (Takara Bio). .. After the mixture was preheated to 94°C for 3 min, 35 amplification cycles were performed, consisting of denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and elongation at 72°C for 3 min. A final extension of 7 min at 68°C was performed.

Article Title: Simultaneous Detection and Identification of Aspergillus and Mucorales Species in Tissues Collected from Patients with Fungal Rhinosinusitis ▿
Article Snippet: .. PCR assays were performed with 25-μl reaction mixtures containing 0.5 U TaKaRa Taq polymerase, 2.5 μl PCR buffer (TaKaRa, Japan), 125 μM (each) dATP, dCTP, dGTP, and dTTP (TaKaRa, Japan), 1 μM (each) forward and reverse primers, and 2 μl of DNA template. .. Amplification was performed on a Mastercycler gradient thermocycler (Eppendorf, Germany).

Purification:

Article Title: vfr, A Global Regulatory Gene, is Required for Pyrrolnitrin but not for Phenazine-1-carboxylic Acid Biosynthesis in Pseudomonas chlororaphis G05
Article Snippet: .. Regular PCR amplifications were carried out with a 25 μl reaction mixture containing 1 × LA with GC buffer, 2 mM MgSO4 , 200 μM (each) dATP, dGTP, dCTP, and dTTP, 10 pmol of each primer, 0.2 μl LA DNA polymerase (Takara Bio, Dalian, China), and 10 ng of purified genomic DNA of the strain G05 or its derivative mutants. .. All the amplifications were performed in T100TM thermal cycler (Bio-Rad Laboratory, Hercules, CA, USA).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99
    TaKaRa deoxynucleotide triphosphate dntp
    Deoxynucleotide Triphosphate Dntp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 754 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate dntp/product/TaKaRa
    Average 99 stars, based on 754 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate dntp - by Bioz Stars, 2020-09
    99/100 stars
      Buy from Supplier

    Image Search Results