Structured Review

TaKaRa deoxynucleotide triphosphate
Deoxynucleotide Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleotide triphosphate/product/TaKaRa
Average 95 stars, based on 81 article reviews
Price from $9.99 to $1999.99
deoxynucleotide triphosphate - by Bioz Stars, 2020-07
95/100 stars

Images

Related Articles

DNA Extraction:

Article Title: Quantitative Analysis of Epstein-Barr Virus Load by Using a Real-Time PCR Assay
Article Snippet: .. The same volume of the DNA extraction solution used for the real-time PCR assay was added to a total of 50 μl of reaction mixture containing 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 100 μM dATP, dCTP, dGTP, and dTTP, 0.2 μM each primer, and 1.25 U of Taq polymerase (TaKaRa, Ohtsu, Japan). .. Amplifications were carried out for 30 cycles with a PCR Thermal Cycler (TaKaRa).

Concentration Assay:

Article Title: Conservation of an Intact vif Gene of Human Immunodeficiency Virus Type 1 during Maternal-Fetal Transmission
Article Snippet: .. PCRs were performed as described above with a 25-μl reaction mixture containing 2.5 μl of 10× buffer (25 mM tris-(hydroxymethyl)-methylaminopropanesulfonic acid, sodium salt [TAPS] [pH 9.3]), 50 mM KCl, 2 mM MgCl2 , 1 mM 2-mercaptoethanol, 400 μM (each) dATP, dCTP, dGTP, and TTP, a 0.2 μM concentration of each outer primer, and 2.5 U of TaKaRa LA Taq polymerase (TaKaRa Biomedicals, Shiga, Japan). ..

Real-time Polymerase Chain Reaction:

Article Title: Quantitative Analysis of Epstein-Barr Virus Load by Using a Real-Time PCR Assay
Article Snippet: .. The same volume of the DNA extraction solution used for the real-time PCR assay was added to a total of 50 μl of reaction mixture containing 10 mM Tris (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 100 μM dATP, dCTP, dGTP, and dTTP, 0.2 μM each primer, and 1.25 U of Taq polymerase (TaKaRa, Ohtsu, Japan). .. Amplifications were carried out for 30 cycles with a PCR Thermal Cycler (TaKaRa).

Polymerase Chain Reaction:

Article Title: pO157_Sal, a Novel Conjugative Plasmid Detected in Outbreak Isolates of Escherichia coli O157:H7 ▿ O157:H7 ▿ †
Article Snippet: .. PCR was performed in a reaction volume of 20 μl containing 1× PCR buffer, 200 μM (each) dATP, dCTP, dTTP, and dGTP, 0.5 μM (each) primers, 1 U of Taq DNA polymerase (TaKaRa, Dalian, China), and 50 ng of genomic DNA templates. .. PCR products (5 μl) were visualized on ethidium bromide-stained 1.2% agarose gels by illumination with UV light.

Article Title: A genetic approach for the identification of exosporium assembly determinants of Bacillus anthracis
Article Snippet: .. Five nanograms of self-ligated DNA was used as the template in a 50 μl PCR reaction mixture containing 37.5 ng of each primer (Tn916 62–38, TAGAATAAGGCTTTACGAGC and Tn916 12185–12190, CCTTGATAAAGTGTGATAAG); 2 mM MgCl2 ; 200 μM (each) dATP, dCTP, dGTP, and dTTP; and 1.25 U of ExTaq polymerase (Takara Bio). .. After the mixture was preheated to 94°C for 3 min, 35 amplification cycles were performed, consisting of denaturation at 94°C for 30 s, primer annealing at 55°C for 30 s, and elongation at 72°C for 3 min. A final extension of 7 min at 68°C was performed.

Article Title: Multiplexed Microsphere Suspension-Array Assay for Urine Mitochondrial DNA Typing by C-Stretch Length in Hypervariable Regions
Article Snippet: .. Multiplexed ASPE was conducted in 30 µL of PCR buffer (10 mM Tris-HCl, pH 8.3, 50 mM KCl, and 1.5 mM MgCl2 ) containing 5 µM each of dATP, dTTP, dGTP, and biotin-dCTP, 1.125 U of TaKaRa Taq Hot Start DNA polymerase, 25 nM of each 27 ASPE primers and 7.5 µL of ExoSAP-IT-treated PCR products. ..

Article Title: Molecular structure of a wheat chromosome end healed after gametocidal gene-induced breakage
Article Snippet: .. PCR was carried out in 50 μl of reaction solution mixture [10 mM Tris·HCl (pH 8.3); 50 mM KCl; 1.5 mM MgCl2 ; 0.2 mM each of dATP, dGTP, dCTP, and dTTP; and 1.25 units of Taq DNA polymerase (Takara Shuzo, Kyoto)] with the templates of the plant DNAs (0.2 μg) and each combination of primers of rDNA and telomere (0.25 μM each). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    TaKaRa deoxynucleotide triphosphate
    Deoxynucleotide Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate/product/TaKaRa
    Average 93 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    93
    TaKaRa deoxynucleoside triphosphate dntp
    Deoxynucleoside Triphosphate Dntp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate dntp/product/TaKaRa
    Average 93 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate dntp - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    94
    TaKaRa deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 315 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/TaKaRa
    Average 94 stars, based on 315 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results