Structured Review

Boehringer Mannheim deoxynucleotide triphosphate
Deoxynucleotide Triphosphate, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 91/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleotide triphosphate/product/Boehringer Mannheim
Average 91 stars, based on 3 article reviews
Price from $9.99 to $1999.99
deoxynucleotide triphosphate - by Bioz Stars, 2020-09
91/100 stars

Images

Related Articles

Amplification:

Article Title: Molecular Characterization of Invasive and Noninvasive Campylobacter jejuni and Campylobacter coli Isolates
Article Snippet: .. Approximately 10 ng of purified Campylobacter genomic DNA was used as a template for RAPD amplification in a volume of 20 μl containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM of each deoxynucleotide triphosphate, 1 U of Taq DNA polymerase (Boehringer, Mannheim, Germany), and 30 pmol of 10-mer primer (Operon Technologies, Alameda, Calif.). .. This reaction was overlaid with 1 drop of mineral oil and placed in a thermal cycler (model 9600; Perkin-Elmer, Norwalk, Conn.).

Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
Article Snippet: .. All PCRs had an initial denaturation of 95°C for 5 min with a subsequent 30 cycle amplification and contained a 1 μM concentration of each primer, 10 ng of genomic DNA, a 200 μM concentration of each deoxynucleotide triphosphate, and 1.25 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, Ind.) in a 3 mM MgCl2 PCR buffer (Idaho Technologies), in a total volume of 50 μl. .. The cycle parameters consisted of annealing at 58°C for 10 s, extension at 72°C for 60 s, and denaturation at 95°C for 10 s. For the last cycle the extension step was 2 min. After amplification, 20 μl of each reaction mixture was subjected to electrophoresis in a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) buffer (pH 8.0) alongside a 100-bp ladder.

Article Title: Histochemical and Ultrastructural Modification of Mucosal Mast Cell Granules in Parasitized Mice Lacking the ?-Chymase, Mouse Mast Cell Protease-1
Article Snippet: .. The cDNA probe was amplified and DIG labeled by PCR of a 147-bp fragment using a probe B cDNA clone as a template and substitution of deoxynucleotide triphosphate with DIG-11-deoxyuridine triphosphate labeling mixture in the PCR (Boehringer Mannheim). ..

Chromatography:

Article Title: Evaluation of PCR Primers for Early Diagnosis of Cytomegalovirus Infection following Liver Transplantation
Article Snippet: .. Reaction mixtures consisted of 5 μl of target, 100 pmol of each of the oligonucleotide primers, 1.25 U of the enzyme Taq polymerase (Perkin-Elmer Cetus, Norwalk, Conn.), 200 μM (each) deoxynucleotide triphosphate (Boehringer Mannheim, Indianapolis, Ind.), 5 μl of 10× reaction buffer (500 mM KCl, 100 mM tris-HCl [pH 8.3], 15 mM MgCl2 , 0.01% gelatin), 10 μl of a 50% glycerol solution, 25 μg of isopsoralen per ml, and high-pressure liquid chromatography-grade distilled water to a total volume of 50 μl in a microcentrifuge tube. ..

Labeling:

Article Title: Histochemical and Ultrastructural Modification of Mucosal Mast Cell Granules in Parasitized Mice Lacking the ?-Chymase, Mouse Mast Cell Protease-1
Article Snippet: .. The cDNA probe was amplified and DIG labeled by PCR of a 147-bp fragment using a probe B cDNA clone as a template and substitution of deoxynucleotide triphosphate with DIG-11-deoxyuridine triphosphate labeling mixture in the PCR (Boehringer Mannheim). ..

Purification:

Article Title: Molecular Characterization of Invasive and Noninvasive Campylobacter jejuni and Campylobacter coli Isolates
Article Snippet: .. Approximately 10 ng of purified Campylobacter genomic DNA was used as a template for RAPD amplification in a volume of 20 μl containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 2.5 mM MgCl2 , 0.2 mM of each deoxynucleotide triphosphate, 1 U of Taq DNA polymerase (Boehringer, Mannheim, Germany), and 30 pmol of 10-mer primer (Operon Technologies, Alameda, Calif.). .. This reaction was overlaid with 1 drop of mineral oil and placed in a thermal cycler (model 9600; Perkin-Elmer, Norwalk, Conn.).

Concentration Assay:

Article Title: Rapid Screening Technique for Class 1 Integrons in Enterobacteriaceae and Nonfermenting Gram-Negative Bacteria and Its Use in Molecular Epidemiology
Article Snippet: .. The final reaction mixture consisted of 5 μl of DNA template, 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 2 mM MgCl2 , each deoxynucleotide triphosphate (Boehringer Mannheim, Lewes, United Kingdom), at a concentration of 50 μM, 25 pmol each of the L2 and L3 oligonucleotide primers, and the Taq -Taqstart antibody mixture. ..

Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
Article Snippet: .. All PCRs had an initial denaturation of 95°C for 5 min with a subsequent 30 cycle amplification and contained a 1 μM concentration of each primer, 10 ng of genomic DNA, a 200 μM concentration of each deoxynucleotide triphosphate, and 1.25 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, Ind.) in a 3 mM MgCl2 PCR buffer (Idaho Technologies), in a total volume of 50 μl. .. The cycle parameters consisted of annealing at 58°C for 10 s, extension at 72°C for 60 s, and denaturation at 95°C for 10 s. For the last cycle the extension step was 2 min. After amplification, 20 μl of each reaction mixture was subjected to electrophoresis in a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) buffer (pH 8.0) alongside a 100-bp ladder.

Article Title: Molecular Epidemiology of Outbreaks of Gastroenteritis Associated with Small Round-Structured Viruses in East Anglia, United Kingdom, During the 1996-1997 Season
Article Snippet: .. One microliter of random primer (20 mU; PdN6; Pharmacia Biotech) was added to the extracted RNA, the mixture was heated at 70°C for 5 min and chilled on ice, and 14 μl of the reaction mixture was added, yielding a total volume of 35 μl of the PCR mixture consisting of 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 5 mM MgCl2 , each deoxynucleotide triphosphate (dNTP; Boehringer Mannheim, Mannheim, Germany) at a concentration of 50 μM, and 200 U of Moloney murine leukemia virus (M-MuLV) RT (FPLC-pure, cloned M-MuLV; Life Technologies, Gaithersburg, Md.). .. Five microliters of cDNA was then added to 45 μl of the PCR mixture, yielding a total of 50 μl of a reaction mixture consisting of 18 mM Tris-HCl (pH 8.4), 45 mM KCl, 2 mM MgCl2 , each dNTP at a concentration of 35 μM, 1 U of Taq polymerase (Life Technologies), and 20 pmol of each primer (primers Ni and E3).

Fast Protein Liquid Chromatography:

Article Title: Molecular Epidemiology of Outbreaks of Gastroenteritis Associated with Small Round-Structured Viruses in East Anglia, United Kingdom, During the 1996-1997 Season
Article Snippet: .. One microliter of random primer (20 mU; PdN6; Pharmacia Biotech) was added to the extracted RNA, the mixture was heated at 70°C for 5 min and chilled on ice, and 14 μl of the reaction mixture was added, yielding a total volume of 35 μl of the PCR mixture consisting of 20 mM Tris-HCl (pH 8.4), 50 mM KCl, 5 mM MgCl2 , each deoxynucleotide triphosphate (dNTP; Boehringer Mannheim, Mannheim, Germany) at a concentration of 50 μM, and 200 U of Moloney murine leukemia virus (M-MuLV) RT (FPLC-pure, cloned M-MuLV; Life Technologies, Gaithersburg, Md.). .. Five microliters of cDNA was then added to 45 μl of the PCR mixture, yielding a total of 50 μl of a reaction mixture consisting of 18 mM Tris-HCl (pH 8.4), 45 mM KCl, 2 mM MgCl2 , each dNTP at a concentration of 35 μM, 1 U of Taq polymerase (Life Technologies), and 20 pmol of each primer (primers Ni and E3).

Polymerase Chain Reaction:

Article Title: Placental failure in mice lacking the homeobox gene Dlx3
Article Snippet: .. For PCR, two oligonucleotides were used to determine heterozygosity, InF (CAGGCTGAGACTAAACTGGTGTTTTTCCCCTA) and Neo5′R (CGGCCGGAGAACCTGCGTGCAATCCATCTTG) in 50-μl reaction mixtures containing 2.25 mM MgCl2 , 200 μM each deoxynucleotide triphosphate, and 1 unit of Taq / Pwo DNA polymerase mix (Boehringer Mannheim). .. The InF oligonucleotide is specific for intronic sequence of Dlx3 and Neo5′R is specific for the Neo gene; amplification with these two oligonucleotides generated a 635-bp fragment.

Article Title: Discriminatory Detection of Inhibitor-Resistant ?-Lactamases in Escherichia coli by Single-Strand Conformation Polymorphism-PCR
Article Snippet: .. To the PCR master mixture containing 20 mM Tris HCl (pH 8.0), 100 mM KCl, 3 mM MgCl2 , 400 μM (each) deoxynucleotide triphosphate, 2.5 U of Taq DNA polymerase (Boehringer Mannheim GmbH, Mannheim, Germany), and 25 pmol of each primer, 0.25 μl (2.5 μCi) of radioactive [α-32 P]dCTP was added. .. The amplification reaction consisted of 36 cycles of 30 s of denaturation at 94°C, 30 s of hybridization at 42°C, and 60 s of extension at 72°C, with a final extension step at 72°C for 10 min.

Article Title: Identification and Detection of Stenotrophomonas maltophilia by rRNA-Directed PCR
Article Snippet: .. All PCRs had an initial denaturation of 95°C for 5 min with a subsequent 30 cycle amplification and contained a 1 μM concentration of each primer, 10 ng of genomic DNA, a 200 μM concentration of each deoxynucleotide triphosphate, and 1.25 U of Taq DNA polymerase (Boehringer Mannheim, Indianapolis, Ind.) in a 3 mM MgCl2 PCR buffer (Idaho Technologies), in a total volume of 50 μl. .. The cycle parameters consisted of annealing at 58°C for 10 s, extension at 72°C for 60 s, and denaturation at 95°C for 10 s. For the last cycle the extension step was 2 min. After amplification, 20 μl of each reaction mixture was subjected to electrophoresis in a 0.8% agarose gel in 0.5× Tris-borate-EDTA (TBE) buffer (pH 8.0) alongside a 100-bp ladder.

Article Title: Histochemical and Ultrastructural Modification of Mucosal Mast Cell Granules in Parasitized Mice Lacking the ?-Chymase, Mouse Mast Cell Protease-1
Article Snippet: .. The cDNA probe was amplified and DIG labeled by PCR of a 147-bp fragment using a probe B cDNA clone as a template and substitution of deoxynucleotide triphosphate with DIG-11-deoxyuridine triphosphate labeling mixture in the PCR (Boehringer Mannheim). ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Boehringer Mannheim deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 92/100, based on 107 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/Boehringer Mannheim
    Average 92 stars, based on 107 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-09
    92/100 stars
      Buy from Supplier

    85
    Boehringer Mannheim deoxynucleotide triphosphate labeling mix
    Deoxynucleotide Triphosphate Labeling Mix, supplied by Boehringer Mannheim, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate labeling mix/product/Boehringer Mannheim
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate labeling mix - by Bioz Stars, 2020-09
    85/100 stars
      Buy from Supplier

    Image Search Results