Structured Review

PerkinElmer deoxynucleoside triphosphates
Deoxynucleoside Triphosphates, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 190 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleoside triphosphates/product/PerkinElmer
Average 92 stars, based on 190 article reviews
Price from $9.99 to $1999.99
deoxynucleoside triphosphates - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Emergence of Drug Resistance Mutations in Human Immunodeficiency Virus Type 2-Infected Subjects Undergoing Antiretroviral Therapy
Article Snippet: .. Briefly, PCR reactions were carried out in a 50-μl reaction mixture containing 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates, 100 ng of each primer, and 2.5 U of Taq polymerase (Perkin-Elmer, Foster City, Calif.). ..

Article Title: A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Article Snippet: .. Reaction conditions used for 2426 PCR were as follows: each PCR mixture (20 μl) contained 1× PCR buffer II (10× PCR buffer II contained 500 mM KCl and 100 mM Tris-HCl [pH 8.3]), 2.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (0.2 mM [each] dATP, dTTP, dCTP, and dGTP), an 0.5 μM concentration of each primer (MU4, 5′ ATCGCCGAAGCCTGCCGGAT 3′, positions 1119 to 1138, and MU9, 5′ TCTTCGTGGTTTTGTGATGGC 3′, positions 1306 to 1326), 1 U of Ampli- Taq DNA polymerase (Perkin-Elmer, Melbourne, Australia), and 2 μl of DNA. .. PCR was performed in an FTS-960 thermal sequencer (Corbett Research, Sydney, Australia) with the following protocol, optimized for this application: 5 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min and 25 cycles (30 cycles for tissue specimens) of 95°C for 20 s, 58°C for 30 s, and 72°C for 40 s, followed by a final extension step at 72°C for 5 min.

Article Title: Fluorescent Heteroduplex Assay for Monitoring Bacillus anthracis and Close Relatives in Environmental Samples
Article Snippet: .. Each 50-μl PCR mixture contained 30 mM Tris (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates, a 0.1 μM concentration of each primer, and 1.25 U of Ampli Taq LD polymerase (Perkin-Elmer). .. For soil DNA templates, 1.875 U of Ampli Taq LD polymerase was used for amplification, and reaction mixtures were supplemented with 10 μg of bovine serum albumin (Boehringer Mannheim).

Article Title: Development of Methods To Detect "Norwalk-Like Viruses" (NLVs) and Hepatitis A Virus in Delicatessen Foods: Application to a Food-Borne NLV Outbreak
Article Snippet: .. Seventy microliters of PCR mixture was added to the RT mixture to yield a mixture containing 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , a 1 μM concentration of each primer, 200 μM deoxynucleoside triphosphates, and 5 U of Taq polymerase (Perkin-Elmer, Foster City, Calif.). .. PCR amplification consisted of an initial 2-min denaturation at 94°C followed by 40 cycles of denaturation at 92°C for 15 s, annealing at 55°C (NVp35-NVp36 and HAVp3-HAVp4) or 50°C (SR33-SR46, Mon381-Mon383, and Mon441-Mon443) for 30 s, and extension for 30 s at 72°C, with a final 5-min extension at 72°C.

Article Title: Molecular Characterization of the Toxic Cyanobacterium Cylindrospermopsis raciborskii and Design of a Species-Specific PCR
Article Snippet: .. Each 50-μl reaction mixture contained 1 to 10 ng of genomic DNA, 20 pmol of each PCR primer, 200 μM deoxynucleoside triphosphates, 250 μM magnesium chloride, 1× PCR buffer II, and 2.5 U of Ampli Taq Gold (Perkin-Elmer). ..

Article Title: Worldwide Genetic Relationships among Francisella tularensis Isolates Determined by Multiple-Locus Variable-Number Tandem Repeat Analysis
Article Snippet: .. PCR amplification of the 25 variable loci (including Ft-M19, a F. tularensis subsp. holarctica -specific direct repeat locus) was carried out as follows: 2 mM MgCl2 , 1× PCR buffer, 0.1 mM deoxynucleoside triphosphates, 1 μM R110, R6G, or carboxytetramethyl rhodamine phosphoramide fluorescent-labeled dUTPs (Perkin-Elmer Biosystems), 0.5 U of Taq polymerase (Life Technologies, Inc., Rockville, Md.), 1.0 μl of template DNA, 0.5 μM forward primer, 0.5 μM reverse primer, and filtered sterile water to a volume of 12.5 μl. .. The reaction mixtures were incubated at 94°C for 5 min and then cycled at 94°C for 30 s, 56 or 61°C for 30 s, and 72°C for 30 s for 35 cycles, with a final incubation of 72°C for 5 min. Reagents used in the PCRs were obtained from Life Technologies, Inc. An annealing temperature of 64°C was used for the Ft-M19 primer set.

Article Title: Vaccination with Calpain Induces a Th1-Biased Protective Immune Response against Schistosoma japonicum
Article Snippet: .. The PCR solution contained 2 μl of cDNA, 50 mM KCl (pH 8.4), 20 mM Tris-HCl, 1.5 mM MgCl2 , 200 mM deoxynucleoside triphosphates, 2 U of Taq gold DNA polymerase (all from Perkin-Elmer); and 1.2 mM primers in a 50-μl volume. .. The PCR mixture was subjected to 35 cycles, and the annealing temperature was 60°C.

Concentration Assay:

Article Title: A Simple PCR Method for Rapid Genotype Analysis of Mycobacterium ulcerans
Article Snippet: .. Reaction conditions used for 2426 PCR were as follows: each PCR mixture (20 μl) contained 1× PCR buffer II (10× PCR buffer II contained 500 mM KCl and 100 mM Tris-HCl [pH 8.3]), 2.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates (0.2 mM [each] dATP, dTTP, dCTP, and dGTP), an 0.5 μM concentration of each primer (MU4, 5′ ATCGCCGAAGCCTGCCGGAT 3′, positions 1119 to 1138, and MU9, 5′ TCTTCGTGGTTTTGTGATGGC 3′, positions 1306 to 1326), 1 U of Ampli- Taq DNA polymerase (Perkin-Elmer, Melbourne, Australia), and 2 μl of DNA. .. PCR was performed in an FTS-960 thermal sequencer (Corbett Research, Sydney, Australia) with the following protocol, optimized for this application: 5 cycles of 95°C for 1 min, 60°C for 1 min, and 72°C for 1 min and 25 cycles (30 cycles for tissue specimens) of 95°C for 20 s, 58°C for 30 s, and 72°C for 40 s, followed by a final extension step at 72°C for 5 min.

Article Title: Fluorescent Heteroduplex Assay for Monitoring Bacillus anthracis and Close Relatives in Environmental Samples
Article Snippet: .. Each 50-μl PCR mixture contained 30 mM Tris (pH 8.4), 50 mM KCl, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates, a 0.1 μM concentration of each primer, and 1.25 U of Ampli Taq LD polymerase (Perkin-Elmer). .. For soil DNA templates, 1.875 U of Ampli Taq LD polymerase was used for amplification, and reaction mixtures were supplemented with 10 μg of bovine serum albumin (Boehringer Mannheim).

Article Title: Development of Methods To Detect "Norwalk-Like Viruses" (NLVs) and Hepatitis A Virus in Delicatessen Foods: Application to a Food-Borne NLV Outbreak
Article Snippet: .. Seventy microliters of PCR mixture was added to the RT mixture to yield a mixture containing 10 mM Tris-HCl, 50 mM KCl, 1.5 mM MgCl2 , a 1 μM concentration of each primer, 200 μM deoxynucleoside triphosphates, and 5 U of Taq polymerase (Perkin-Elmer, Foster City, Calif.). .. PCR amplification consisted of an initial 2-min denaturation at 94°C followed by 40 cycles of denaturation at 92°C for 15 s, annealing at 55°C (NVp35-NVp36 and HAVp3-HAVp4) or 50°C (SR33-SR46, Mon381-Mon383, and Mon441-Mon443) for 30 s, and extension for 30 s at 72°C, with a final 5-min extension at 72°C.

Amplification:

Article Title: Worldwide Genetic Relationships among Francisella tularensis Isolates Determined by Multiple-Locus Variable-Number Tandem Repeat Analysis
Article Snippet: .. PCR amplification of the 25 variable loci (including Ft-M19, a F. tularensis subsp. holarctica -specific direct repeat locus) was carried out as follows: 2 mM MgCl2 , 1× PCR buffer, 0.1 mM deoxynucleoside triphosphates, 1 μM R110, R6G, or carboxytetramethyl rhodamine phosphoramide fluorescent-labeled dUTPs (Perkin-Elmer Biosystems), 0.5 U of Taq polymerase (Life Technologies, Inc., Rockville, Md.), 1.0 μl of template DNA, 0.5 μM forward primer, 0.5 μM reverse primer, and filtered sterile water to a volume of 12.5 μl. .. The reaction mixtures were incubated at 94°C for 5 min and then cycled at 94°C for 30 s, 56 or 61°C for 30 s, and 72°C for 30 s for 35 cycles, with a final incubation of 72°C for 5 min. Reagents used in the PCRs were obtained from Life Technologies, Inc. An annealing temperature of 64°C was used for the Ft-M19 primer set.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    PerkinElmer deoxynucleoside triphosphates
    Deoxynucleoside Triphosphates, supplied by PerkinElmer, used in various techniques. Bioz Stars score: 92/100, based on 190 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphates/product/PerkinElmer
    Average 92 stars, based on 190 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphates - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results