Structured Review

Kaneka Corp deoxynucleoside triphosphates
Deoxynucleoside Triphosphates, supplied by Kaneka Corp, used in various techniques. Bioz Stars score: 92/100, based on 17 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleoside triphosphates/product/Kaneka Corp
Average 92 stars, based on 17 article reviews
Price from $9.99 to $1999.99
deoxynucleoside triphosphates - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Pneumolysin Is a Key Factor in Misidentification of Macrolide-Resistant Streptococcus pneumoniae and Is a Putative Virulence Factor of S. mitis and Other Streptococci
Article Snippet: .. PCR conditions were as follows: 0.5 μM primers, 1.5 mM MgCl2 , 0.2 mM deoxynucleoside triphosphates, 1 U of HotGoldStar DNA polymerase (Eurogentec, Seraing, Belgium), 1× reaction buffer, and 2 μl of DNA in a total volume of 50 μl. ..

Article Title: Evaluation of Antibiotic Susceptibilities of Ehrlichia canis, Ehrlichia chaffeensis, and Anaplasma phagocytophilum by Real-Time PCR
Article Snippet: .. The PCR mixture had a final volume of 20 μl in each capillary tube and contained 2 μl of DNA Master Mix (DNA Master SYBR Green I kit [Roche Diagnostics] including SYBR Green, deoxynucleoside triphosphates, and Taq polymerase), 1.6 μl of MgCl2 , 12.4 μl of sterile water, 1 μl of each primer (EHR16S D [5′ GGTACCYACAGAAGAAGTCC 3′] and EHR16S R [5′ TAGCACTCATCGTTTACAGC 3′] [Eurogentec, Seraing, Belgium]) , and 2 μl of extracted DNA. .. Each PCR mixture included sterile distilled water and uninfected cells as a negative control.

Article Title: Rapid Discrimination among Dermatophytes, Scytalidium spp., and Other Fungi with a PCR-Restriction Fragment Length Polymorphism Ribotyping Method
Article Snippet: .. PCR was performed in a reaction mixture of 25 μl containing 1.5 mM MgCl2 , 50 μM concentrations (each) of various deoxynucleoside triphosphates, 25 pmol of each primer, 1 U of Taq DNA polymerase (Eurogentec, Seraing, Belgium), and 25 ng of extracted DNA. .. Amplification conditions varied according to the primer set.

Article Title: Reverse Gyrase from the Hyperthermophilic Bacterium Thermotoga maritima: Properties and Gene Structure
Article Snippet: .. PCR was carried out in a total volume of 100 μl which contained 0.5 μg of genomic DNA, all four deoxynucleoside triphosphates (each at 0.2 mM), 10 μl of 10× PCR buffer (Eurogentec), 2.5 U of Taq polymerase (Eurogentec Goldstar), and 100 pmol of each oligonucleotide primer. .. The forward primer P1 sequence was 5′CGCGGATCCMGNATHGARGAYMGNTGGAT3′ (Y = C + T; N = A + C + G + T; M = A + C; H = A + T + C; R = A + G), and the reverse primer P2 sequence was 5′CGGGGTACCTCNGTNCKRTGRTANGTDAT3′ (K = G + T; D = G + A + T).

Article Title: Clearance of Human-Pathogenic Viruses from Sludge: Study of Four Stabilization Processes by Real-Time Reverse Transcription-PCR and Cell Culture
Article Snippet: .. The reaction mixture (final volume, 25 μl) was prepared in a single tube as follows: 1× TaqMan buffer (Eurogentec), 6 mM MgCl2 (Applera), 700 μM deoxynucleoside triphosphates (Eurogentec), 120 nM each of primers Ev1 and Ev2 (Genosys, Pampisford, England), 100 nM Ev-probe (Eurogentec), 60 nM each of primers pAW1 and pAW2 (Genosys), 80 nM pAW-probe (Eurogentec), 1.5% PVP-25 (Coger), 0.6 μg bovine serum albumin (Roche Diagnostic), 2 μg of T4 gene 32 protein (Roche Diagnostic), 1.5 U of murine leukemia virus reverse transcriptase (Applera), 1.5 U of HotStart Gold (Eurogentec), 20 U of RNasin (Promega), and 1 μl of internal positive control RNA (1,000 copies/μl); 20 μl of the reaction mixture was added to PCR tubes containing 5 μl of RNA extract from sludge samples or RNA standard in serial dilution. .. Enterovirus RNA and the internal positive control RNA were reverse transcribed into cDNA (40 min at 50.1°C), followed by a murine leukemia virus Taq Gold denaturation-activation step (10 min at 94°C).

SYBR Green Assay:

Article Title: Evaluation of Antibiotic Susceptibilities of Ehrlichia canis, Ehrlichia chaffeensis, and Anaplasma phagocytophilum by Real-Time PCR
Article Snippet: .. The PCR mixture had a final volume of 20 μl in each capillary tube and contained 2 μl of DNA Master Mix (DNA Master SYBR Green I kit [Roche Diagnostics] including SYBR Green, deoxynucleoside triphosphates, and Taq polymerase), 1.6 μl of MgCl2 , 12.4 μl of sterile water, 1 μl of each primer (EHR16S D [5′ GGTACCYACAGAAGAAGTCC 3′] and EHR16S R [5′ TAGCACTCATCGTTTACAGC 3′] [Eurogentec, Seraing, Belgium]) , and 2 μl of extracted DNA. .. Each PCR mixture included sterile distilled water and uninfected cells as a negative control.

Amplification:

Article Title: DNA Microarray Format for Detection and Subtyping of Human Papillomavirus
Article Snippet: .. Target amplification was performed in a T1 or T gradient thermocycler (Biometra, Göttingen, Germany) in five separate 50- μl reactions (one for each cluster) containing 100 ng of template DNA, 1 μM concentrations of both forward and reverse amplification primers, 0.2 mM deoxynucleoside triphosphates, 1 U of HotGoldStar DNA polymerase (Eurogentec, Seraing, Belgium), 1× reaction buffer, and 2 mM MgCl2 . ..

Positive Control:

Article Title: Clearance of Human-Pathogenic Viruses from Sludge: Study of Four Stabilization Processes by Real-Time Reverse Transcription-PCR and Cell Culture
Article Snippet: .. The reaction mixture (final volume, 25 μl) was prepared in a single tube as follows: 1× TaqMan buffer (Eurogentec), 6 mM MgCl2 (Applera), 700 μM deoxynucleoside triphosphates (Eurogentec), 120 nM each of primers Ev1 and Ev2 (Genosys, Pampisford, England), 100 nM Ev-probe (Eurogentec), 60 nM each of primers pAW1 and pAW2 (Genosys), 80 nM pAW-probe (Eurogentec), 1.5% PVP-25 (Coger), 0.6 μg bovine serum albumin (Roche Diagnostic), 2 μg of T4 gene 32 protein (Roche Diagnostic), 1.5 U of murine leukemia virus reverse transcriptase (Applera), 1.5 U of HotStart Gold (Eurogentec), 20 U of RNasin (Promega), and 1 μl of internal positive control RNA (1,000 copies/μl); 20 μl of the reaction mixture was added to PCR tubes containing 5 μl of RNA extract from sludge samples or RNA standard in serial dilution. .. Enterovirus RNA and the internal positive control RNA were reverse transcribed into cDNA (40 min at 50.1°C), followed by a murine leukemia virus Taq Gold denaturation-activation step (10 min at 94°C).

Serial Dilution:

Article Title: Clearance of Human-Pathogenic Viruses from Sludge: Study of Four Stabilization Processes by Real-Time Reverse Transcription-PCR and Cell Culture
Article Snippet: .. The reaction mixture (final volume, 25 μl) was prepared in a single tube as follows: 1× TaqMan buffer (Eurogentec), 6 mM MgCl2 (Applera), 700 μM deoxynucleoside triphosphates (Eurogentec), 120 nM each of primers Ev1 and Ev2 (Genosys, Pampisford, England), 100 nM Ev-probe (Eurogentec), 60 nM each of primers pAW1 and pAW2 (Genosys), 80 nM pAW-probe (Eurogentec), 1.5% PVP-25 (Coger), 0.6 μg bovine serum albumin (Roche Diagnostic), 2 μg of T4 gene 32 protein (Roche Diagnostic), 1.5 U of murine leukemia virus reverse transcriptase (Applera), 1.5 U of HotStart Gold (Eurogentec), 20 U of RNasin (Promega), and 1 μl of internal positive control RNA (1,000 copies/μl); 20 μl of the reaction mixture was added to PCR tubes containing 5 μl of RNA extract from sludge samples or RNA standard in serial dilution. .. Enterovirus RNA and the internal positive control RNA were reverse transcribed into cDNA (40 min at 50.1°C), followed by a murine leukemia virus Taq Gold denaturation-activation step (10 min at 94°C).