Structured Review

Eurobio deoxynucleoside triphosphates
Deoxynucleoside Triphosphates, supplied by Eurobio, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleoside triphosphates/product/Eurobio
Average 92 stars, based on 8 article reviews
Price from $9.99 to $1999.99
deoxynucleoside triphosphates - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Association of Helicobacter species with hepatitis C cirrhosis with or without hepatocellular carcinoma
Article Snippet: .. Polymerase chain reaction (PCR) amplification was carried out in a final volume of 10 μl containing 1× buffer, 1.5 mM MgCl2 , 100 μM deoxynucleoside triphosphates, 0.5 μM each of the four primers, 0.4 U of Taq polymerase (Eurobio, Les Ulis, France), and 10 ng of DNA in a Perkin Elmer Cetus 9600 thermocycler under the conditions listed in table 2 . .. PCR products were analysed on a 1–4% agarose gel or on a 12% polyacrylamide gel depending on amplicon size, and stained with ethidium bromide.

Article Title: A Holistic Approach for Determining the Entomopathogenic Potential of Bacillus thuringiensis Strains
Article Snippet: .. The reaction mixture employed for identifying known cry genes when using either ordinary family primers (primers directed toward a specific gene class) or type-specific family primers (primers used to identify a specific gene subclass or type) in a triplex PCR reaction were as follows: 250 ng of total HD-133 DNA, 1 μM reverse primer I(−), 0.5 μM each forward primer [I(+) and/or a type-specific primer], 3 mM MgCl2 , 200 nM deoxynucleoside triphosphates, and 2.5 U of Taq DNA polymerase (Eurobio) in a final volume of 50 μl ( ). .. All reactions were performed in a Perkin-Elmer Cetus thermal cycler with an initial 5-min denaturation step at 94°C followed by 25 cycles of amplification consisting of a 1-min denaturation at 94°C, 45 s of annealing at 45°C, and 2 min of extension at 72°C.

Article Title: Identification of a genetic marker of Helicobacter pylori strains involved in gastric extranodal marginal zone B cell lymphoma of the MALT-type
Article Snippet: .. PCR amplifications were carried out in a 25 μl volume containing 2.5 μl of 10× PCR buffer (Eurobio, Les Ulis, France), 1.5 mM MgCl2 (Eurobio), 200 μM (each) of the deoxynucleoside triphosphates (Eurobio), 2 U of Taq DNA polymerase (Eurobio), 1 μM (each) of the primers (Q BIOgen, Strasbourg, France) and 10 ng of H pylori DNA. .. After four minutes of initial denaturation at 94°C, each reaction mixture was amplified for 35 cycles as follows: 30 seconds at 94°C, 30 seconds of annealing at 60°C, and extension at 72°C (the time depending on the length of the sequence to be amplified and the processivity of the Taq polymerase).

Article Title: Combination of Quinupristin-Dalfopristin and Gentamicin against Methicillin-Resistant Staphylococcus aureus: Experimental Rabbit Endocarditis Study
Article Snippet: .. The 50-μl reaction mixture for PCR contained 10 ng of total bacterial DNA, 20 pmol (each) oligodeoxynucleotide, 200 μM deoxynucleoside triphosphates, 2 mM MgCl2 , 1× PCR buffer, and 1 U of Taq DNA polymerase (Eurobio). .. PCR experiments were carried out in a Perkin-Elmer 4600 thermal cycler with a denaturation step (94°C for 5 min), followed by 35 amplification cycles (30 s of denaturation at 94°C, 45 s of annealing at 47°C, and 1 min of elongation at 72°C) and a final elongation step (72°C for 10 min).

Article Title: Immune Response to Mouse Mammary Tumor Virus in Mice Lacking the Alpha/Beta Interferon or the Gamma Interferon Receptor
Article Snippet: .. The PCR was performed with 1× PCR buffer containing 67 mM Tris-HCl (pH 8.8), 16 mM (NH4 )2 SO4 , 0.01% Tween 20, 2.5 mM MgCl2 , 200 μM deoxynucleoside triphosphates, 2 μCi of [α-32 P]dATP, 1.5 U of Taq polymerase (Eurobiotaq; Eurobio, Les Vlis, France), and 200 nM each oligonucleotide (5′ oligonucleotide CTCAGGAAGAAAAAGACGACAT, 3′ oligonucleotide CAAACCAAGTCAGAAACCACTTG). .. The PCR products were separated on an 8 M urea–6% polyacrylamide gel.

Amplification:

Article Title: Association of Helicobacter species with hepatitis C cirrhosis with or without hepatocellular carcinoma
Article Snippet: .. Polymerase chain reaction (PCR) amplification was carried out in a final volume of 10 μl containing 1× buffer, 1.5 mM MgCl2 , 100 μM deoxynucleoside triphosphates, 0.5 μM each of the four primers, 0.4 U of Taq polymerase (Eurobio, Les Ulis, France), and 10 ng of DNA in a Perkin Elmer Cetus 9600 thermocycler under the conditions listed in table 2 . .. PCR products were analysed on a 1–4% agarose gel or on a 12% polyacrylamide gel depending on amplicon size, and stained with ethidium bromide.

Article Title: PCR-Restriction Fragment Length Polymorphism Analysis for Detection of Point Mutations Associated with Macrolide Resistance in Campylobacter spp.
Article Snippet: .. The amplification reaction was carried out in a final volume of 50 μl containing 1× buffer, 1.5 mM MgCl2 , 200 μM deoxynucleoside triphosphates, 0.2 μM each of the primers, 1 U of Taq polymerase (Eurobio, Les Ulis, France), and 2 μl of extracted DNA. .. Amplification was performed in a Perkin-Elmer GeneAmp 9700 thermocycler under the following conditions: 1 cycle of 94°C for 5 min; 35 cycles of 94°C for 30 s, 55°C for 30 s, and 72°C for 30 s; and 1 cycle of 72°C for 7 min. PCR amplicons were purified by using MicroSpin S-400 HR columns in accordance with the manufacturer's (Amersham Pharmacia Biotech Inc., Uppsala, Sweden) instructions.

Article Title: PCR-Restriction Fragment Length Polymorphism Can Also Detect Point Mutation A2142C in the 23S rRNA Gene, Associated with Helicobacter pylori Resistance to Clarithromycin
Article Snippet: .. The amplification reaction was carried out in a final volume of 50 μl containing 1× buffer, 1.5 mM MgCl2 , 200 μM each of the four deoxynucleoside triphosphates, 0.2 μM each of the primers, 1 U of Taq polymerase (Eurobio), and 3 μl of extracted DNA. ..

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Eurobio deoxynucleoside triphosphates
    Deoxynucleoside Triphosphates, supplied by Eurobio, used in various techniques. Bioz Stars score: 92/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphates/product/Eurobio
    Average 92 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphates - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results