Structured Review

TaKaRa deoxynucleoside triphosphate
Deoxynucleoside Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 315 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleoside triphosphate/product/TaKaRa
Average 94 stars, based on 315 article reviews
Price from $9.99 to $1999.99
deoxynucleoside triphosphate - by Bioz Stars, 2020-07
94/100 stars

Images

Related Articles

Countercurrent Chromatography:

Article Title: Effective In Vitro Clearance of Porphyromonas gingivalis by Fc? Receptor I (CD89) on Gingival Crevicular Neutrophils
Article Snippet: .. Briefly, 0.5 μg of total RNA was reverse transcribed in 40-μl reaction mixtures containing 20 U of Moloney murine leukemia virus reverse transcriptase (RT; Toyobo, Osaka, Japan), 25 mM each deoxynucleoside triphosphate (Takara Shuzo, Shiga, Japan), 80 U of RNase inhibitor (Stratagene, La Jolla, Calif.), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 , and 1 μg of oligo(dT)18 (Stratagene) by incubation at 37°C for 60 min, followed by heating at 95°C for 5 min. PCR amplifications were performed with 10 μl of cDNA, 15 mM Tris-HCl (pH 8.0), 50 mM KCl, 2.5 mM MgCl2 , 40 nM each deoxynucleoside triphosphate, 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, Conn.), 200 nM each oligonucleotide primer encompassing the entire CD89 coding region (sense: 5′-ATG GAC CCC AAA CAG ACC-3′; anti-sense: 5′-TCC AGG TGT TTA CTT GCA GAC AC-3′) , and β-actin-specific primers (forward: 5′-GCG AGA AGA TGA CCC AGA TCA TGT T-3′; reverse: 5′-GCT TCT CCT TAA TGT CAC GCA CGA T-3′) ( ) in a 50-μl reaction volume. .. PCR conditions were as follows: 95°C for 10 min, followed by 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min, with an extension step at 72°C for 10 min. PCR products were electrophoresed on 2% agarose gels and visualized by ethidium bromide staining.

Negative Control:

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template viral DNA (with HaV01 DNA serving as a positive control) or the H. akashiwo DNA genome uninfected by viruses (as a negative control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers IT-F and IT-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 1% (wt/vol) agarose S gels to verify if a single band was obtained from each sample.

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template cDNA prepared as described above (the sample from time zero served as a negative control) or HaV01 genomic DNA (positive control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers DPC-F and DPC-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 2% (wt/vol) agarose S (Nippon Gene Co., Ltd.) gels, and the nucleic acids were visualized by ethidium bromide staining.

Amplification:

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template viral DNA (with HaV01 DNA serving as a positive control) or the H. akashiwo DNA genome uninfected by viruses (as a negative control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers IT-F and IT-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 1% (wt/vol) agarose S gels to verify if a single band was obtained from each sample.

Article Title: Prevalence of Cardinium Bacteria in Planthoppers and Spider Mites and Taxonomic Revision of "Candidatus Cardinium hertigii" Based on Detection of a New Cardinium Group from Biting Midges ▿ Group from Biting Midges ▿ † Group from Biting Midges ▿ † ‡
Article Snippet: .. PCR amplification was performed in 20 μl of reaction buffer containing 1× buffer, 0.16 mM of each deoxynucleoside triphosphate, 0.5 mM of each primer, 0.5 U of Taq DNA polymerase (Takara Bio Inc., Tokyo, Japan), and 2 μl of template DNA. .. DNA of Cardinium from Ixodes scapularis ( ) was used as a positive control.

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template cDNA prepared as described above (the sample from time zero served as a negative control) or HaV01 genomic DNA (positive control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers DPC-F and DPC-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 2% (wt/vol) agarose S (Nippon Gene Co., Ltd.) gels, and the nucleic acids were visualized by ethidium bromide staining.

Positive Control:

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template viral DNA (with HaV01 DNA serving as a positive control) or the H. akashiwo DNA genome uninfected by viruses (as a negative control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers IT-F and IT-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 1% (wt/vol) agarose S gels to verify if a single band was obtained from each sample.

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template cDNA prepared as described above (the sample from time zero served as a negative control) or HaV01 genomic DNA (positive control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers DPC-F and DPC-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 2% (wt/vol) agarose S (Nippon Gene Co., Ltd.) gels, and the nucleic acids were visualized by ethidium bromide staining.

Concentration Assay:

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template viral DNA (with HaV01 DNA serving as a positive control) or the H. akashiwo DNA genome uninfected by viruses (as a negative control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers IT-F and IT-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 1% (wt/vol) agarose S gels to verify if a single band was obtained from each sample.

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template cDNA prepared as described above (the sample from time zero served as a negative control) or HaV01 genomic DNA (positive control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers DPC-F and DPC-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 2% (wt/vol) agarose S (Nippon Gene Co., Ltd.) gels, and the nucleic acids were visualized by ethidium bromide staining.

Incubation:

Article Title: Effective In Vitro Clearance of Porphyromonas gingivalis by Fc? Receptor I (CD89) on Gingival Crevicular Neutrophils
Article Snippet: .. Briefly, 0.5 μg of total RNA was reverse transcribed in 40-μl reaction mixtures containing 20 U of Moloney murine leukemia virus reverse transcriptase (RT; Toyobo, Osaka, Japan), 25 mM each deoxynucleoside triphosphate (Takara Shuzo, Shiga, Japan), 80 U of RNase inhibitor (Stratagene, La Jolla, Calif.), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 , and 1 μg of oligo(dT)18 (Stratagene) by incubation at 37°C for 60 min, followed by heating at 95°C for 5 min. PCR amplifications were performed with 10 μl of cDNA, 15 mM Tris-HCl (pH 8.0), 50 mM KCl, 2.5 mM MgCl2 , 40 nM each deoxynucleoside triphosphate, 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, Conn.), 200 nM each oligonucleotide primer encompassing the entire CD89 coding region (sense: 5′-ATG GAC CCC AAA CAG ACC-3′; anti-sense: 5′-TCC AGG TGT TTA CTT GCA GAC AC-3′) , and β-actin-specific primers (forward: 5′-GCG AGA AGA TGA CCC AGA TCA TGT T-3′; reverse: 5′-GCT TCT CCT TAA TGT CAC GCA CGA T-3′) ( ) in a 50-μl reaction volume. .. PCR conditions were as follows: 95°C for 10 min, followed by 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min, with an extension step at 72°C for 10 min. PCR products were electrophoresed on 2% agarose gels and visualized by ethidium bromide staining.

Polymerase Chain Reaction:

Article Title: Microbial Community Diversity Associated with Carbon and Nitrogen Cycling in Permeable Shelf Sediments †
Article Snippet: .. The standard PCR mix included 1× PCR buffer containing 1.5 mM MgCl2 (Takara Bio Inc., Japan), 250 μM of each deoxynucleoside triphosphate (Takara Bio Inc., Japan), 1 pmol each of forward and reverse primers, 0.025 U μl−1 rTaq enzyme (Takara Bio Inc., Japan), and distilled H2 O. ..

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template viral DNA (with HaV01 DNA serving as a positive control) or the H. akashiwo DNA genome uninfected by viruses (as a negative control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers IT-F and IT-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 1% (wt/vol) agarose S gels to verify if a single band was obtained from each sample.

Article Title: Prevalence of Cardinium Bacteria in Planthoppers and Spider Mites and Taxonomic Revision of "Candidatus Cardinium hertigii" Based on Detection of a New Cardinium Group from Biting Midges ▿ Group from Biting Midges ▿ † Group from Biting Midges ▿ † ‡
Article Snippet: .. PCR amplification was performed in 20 μl of reaction buffer containing 1× buffer, 0.16 mM of each deoxynucleoside triphosphate, 0.5 mM of each primer, 0.5 U of Taq DNA polymerase (Takara Bio Inc., Tokyo, Japan), and 2 μl of template DNA. .. DNA of Cardinium from Ixodes scapularis ( ) was used as a positive control.

Article Title: Effective In Vitro Clearance of Porphyromonas gingivalis by Fc? Receptor I (CD89) on Gingival Crevicular Neutrophils
Article Snippet: .. Briefly, 0.5 μg of total RNA was reverse transcribed in 40-μl reaction mixtures containing 20 U of Moloney murine leukemia virus reverse transcriptase (RT; Toyobo, Osaka, Japan), 25 mM each deoxynucleoside triphosphate (Takara Shuzo, Shiga, Japan), 80 U of RNase inhibitor (Stratagene, La Jolla, Calif.), 50 mM Tris-HCl (pH 8.3), 75 mM KCl, 3 mM MgCl2 , and 1 μg of oligo(dT)18 (Stratagene) by incubation at 37°C for 60 min, followed by heating at 95°C for 5 min. PCR amplifications were performed with 10 μl of cDNA, 15 mM Tris-HCl (pH 8.0), 50 mM KCl, 2.5 mM MgCl2 , 40 nM each deoxynucleoside triphosphate, 2.5 U of AmpliTaq Gold DNA polymerase (Perkin-Elmer, Norwalk, Conn.), 200 nM each oligonucleotide primer encompassing the entire CD89 coding region (sense: 5′-ATG GAC CCC AAA CAG ACC-3′; anti-sense: 5′-TCC AGG TGT TTA CTT GCA GAC AC-3′) , and β-actin-specific primers (forward: 5′-GCG AGA AGA TGA CCC AGA TCA TGT T-3′; reverse: 5′-GCT TCT CCT TAA TGT CAC GCA CGA T-3′) ( ) in a 50-μl reaction volume. .. PCR conditions were as follows: 95°C for 10 min, followed by 35 cycles of 95°C for 1 min, 55°C for 1 min, and 72°C for 1.5 min, with an extension step at 72°C for 10 min. PCR products were electrophoresed on 2% agarose gels and visualized by ethidium bromide staining.

Article Title: Respiratory Syncytial Virus Infection of Human Alveolar Epithelial Cells Enhances Interferon Regulatory Factor 1 and Interleukin-1?-Converting Enzyme Gene Expression but Does Not Cause Apoptosis
Article Snippet: .. After the addition of a solution of 17 μl of 5× first-strand buffer (250 mM Tris-HCl, 375 mM KCl, 15 mM MgCl2 ), 9 μl of 0.1 mM dithiothreitol (GIBCO BRL), 17 μl of 2.5 mM (each) deoxynucleoside triphosphate (Takara), and 200 U of Maloney murine leukemia virus RT (GIBCO BRL), the mixture was stored at 37°C for 1 h. Sequences of the PCR primer pairs are as follows: for β-actin, CCTTCCTGGGCATGGAGTCCTG and GGAGCAATGATCTTGATCTTC; for IRF-1, AAGCATGCTGCCAAGCATGGCTGG and ATCAGGCAGAGTGGAGCTGCT; for ICE, GCTATTAAGAAAGCCCA and TCAGTGGTGGGCATCTG; and for CPP32, AGCACTGGAATGACATCTCGGT and CAGCATGGCACAAAGCGAC. .. PCR primers and specific probes for ICE were chosen from the nucleotide sequence for ICE p10 ( ).

Article Title: Respiratory Syncytial Virus Infection of Human Alveolar Epithelial Cells Enhances Interferon Regulatory Factor 1 and Interleukin-1?-Converting Enzyme Gene Expression but Does Not Cause Apoptosis
Article Snippet: .. The PCR mixture contained 50 ng of cDNA, 10 μl of PCR buffer (500 mM KCl, 10 mM Tris, 1% Triton X-100), 8 μl of 2.5 mM each deoxynucleoside triphosphate (Takara), 6 μl of 25 mM MgCl2 , 100 pM 5′ and 3′ primers, and distilled water for a total volume of 100 μl. .. After being denatured at 94°C for 10 min and cooled to 80°C, the mixture was seeded with 2.5 μl of thermostable Taq polymerase (Promega, Madison, Wis.).

Article Title: Algal Viruses with Distinct Intraspecies Host Specificities Include Identical Intein Elements
Article Snippet: .. PCR amplification was performed with 20-μl mixtures containing ∼500 ng of template cDNA prepared as described above (the sample from time zero served as a negative control) or HaV01 genomic DNA (positive control), 1× EX Taq buffer (Takara Bio Inc.), each deoxynucleoside triphosphate at a concentration of 200 μM, 20 pmol (each) of the primers DPC-F and DPC-R, and 1 U of EX Taq DNA polymerase (Takara Bio Inc.) by use of the GeneAmp PCR system 9700 (Applied Biosystems) according to the following cycle parameters: denaturation at 95°C (40 s), annealing at 53°C (30 s), and extension at 72°C (1 min). .. Following 30 rounds of amplification, the PCR products were electrophoresed in 2% (wt/vol) agarose S (Nippon Gene Co., Ltd.) gels, and the nucleic acids were visualized by ethidium bromide staining.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 93
    TaKaRa deoxynucleotide triphosphate
    Deoxynucleotide Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 81 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate/product/TaKaRa
    Average 93 stars, based on 81 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    93
    TaKaRa deoxynucleoside triphosphate dntp
    Deoxynucleoside Triphosphate Dntp, supplied by TaKaRa, used in various techniques. Bioz Stars score: 93/100, based on 79 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate dntp/product/TaKaRa
    Average 93 stars, based on 79 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate dntp - by Bioz Stars, 2020-07
    93/100 stars
      Buy from Supplier

    94
    TaKaRa deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 315 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/TaKaRa
    Average 94 stars, based on 315 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-07
    94/100 stars
      Buy from Supplier

    Image Search Results