Structured Review

GE Healthcare deoxynucleoside triphosphate
Deoxynucleoside Triphosphate, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/deoxynucleoside triphosphate/product/GE Healthcare
Average 92 stars, based on 15 article reviews
Price from $9.99 to $1999.99
deoxynucleoside triphosphate - by Bioz Stars, 2020-07
92/100 stars

Images

Related Articles

Polymerase Chain Reaction:

Article Title: Relative Neurotoxin Gene Expression in Clostridium botulinum Type B, Determined Using Quantitative Reverse Transcription-PCR
Article Snippet: .. The PCR mixture specific for cntB consisted of 1× PCR buffer (Roche Diagnostics GmbH), each deoxynucleoside triphosphate (dATP, dTTP, dCTP, and dGTP; Amersham Pharmacia Biotech, Inc.) at a concentration of 0.2 mM, 4 mM MgCl2 (Roche Diagnostics GmbH), each primer (Scandinavian Gene Synthesis AB) at a concentration of 0.5 μM, 0.3 μM fluorogenic probe (Scandinavian Gene Synthesis AB), and 0.05 U of Tth DNA polymerase (Roche Diagnostics GmbH). .. The water used in the PCR assays was autoclaved Millipore-filtered water.

Article Title: Involvement of Domain 3 in Oligomerization by the Protective Antigen Moiety of Anthrax Toxin
Article Snippet: .. A 100-μl PCR mixture containing 1× Taq DNA polymerase buffer, 1 ng of pET22b-PAKC DNA/μl, 2.5 ng of GAGTGAAGTGGTACCGCAAATTCA DNA/μl, 2.5 ng of CTACTGACTCATCGATCCCAACTGCTATG DNA/μl, 100 μM deoxynucleoside triphosphate, 1μM 6-(2-deoxy-β- d -ribo- furanosyl)-3,4-dihydro-8H-pyrimido-[4,5-c][1,2]oxazin-7-one triphosphate (dPTP) (Amersham Life Science), and 0.05 U of Taq DNA polymerase (Stratagene)/μl was used to amplify a DNA fragment encoding domain 3 of PA. .. Five microliters of this first reaction mixture was used in a second reaction mixture that lacked pET22b-PAKC DNA and dPTP (incubation temperatures and times were the same as described above).

Article Title: Detection by PCR and Isolation Assays of the Anaerobic Intestinal Spirochete Brachyspira aalborgi from the Feces of Captive Nonhuman Primates
Article Snippet: .. The amplification mixtures (25 μl) contained 1× PCR buffer, 0.55 U of Tth Plus DNA polymerase, 1.5 mM MgCl2 , 5 nmol of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech AB, Uppsala, Sweden), and 12.5 pmol of each primer. ..

Article Title: Monitoring of Antibiotic-Induced Alterations in the Human Intestinal Microflora and Detection of Probiotic Strains by Use of Terminal Restriction Fragment Length Polymorphism
Article Snippet: .. Each PCR was performed with a 50-μl reaction mixture containing 2.5 U of Taq polymerase (Amersham Pharmacia Biotech, Little Chalfont, United Kingdom), 1× PCR buffer, 10 nmol of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech), 2.5 μl of dimethyl sulfoxide, 1 μl of template DNA, and 35 pmol of each primer. .. The cycling program was performed by using a Perkin-Elmer GeneAmp PCR system 2400 thermocycler with the following program: an initial hot start at 95°C for 5 min, followed by 30 cycles of denaturation at 95°C for 40 s, annealing at 55°C for 40 s, and elongation at 72°C for 1 min.

Article Title: Extracts containing CLPs of Bacillus amyloliquefaciens JN68 isolated from chicken intestines exert antimicrobial effects, particularly on methicillin-resistant Staphylococcus aureus and Listeria monocytogenes
Article Snippet: .. The amplification of the 16S rRNA and gyrB gene region of candidate strain was conducted in a 50 µl reaction mixture containing 1 µl genomic DNA template, 5 µl PCR reaction buffer [10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 , 50 mM KCl and 0.1% Triton X-100] containing 200 µM of each deoxynucleoside triphosphate (GE Healthcare Life Sciences, Chalfont, UK), 4 µl MgCl2 (52 mM), 1 µM each primer , 1 unit of Taq polymerase (GE Healthcare Life Sciences) and 39 µl autoclaved Milli-Q water (Merck Millipore). .. The PCR was conducted in a Robocycler® temperature thermal cycler (Agilent Technologies, Inc., Santa Clara, CA, USA).

Article Title: PCR-Based Detection, Restriction Endonuclease Analysis, and Transcription of tonB in Haemophilus influenzae and Haemophilus parainfluenzae Isolates Obtained from Children Undergoing Tonsillectomy and Adenoidectomy
Article Snippet: .. PCR amplifications were carried out in 100-μl reaction mixtures consisting of 10 μl of DNA (2 ng/μl) and 90 μl of the amplification mix, which contained the following components: 20 pmol each of the G1 and G2 primers (for the amplification of the 813-bp amplicon) or the T1 and T2 primers (for the nested PCR that amplifies a 250-bp amplicon), 0.5 mM MgCl2 , 200 μm concentrations of each deoxynucleoside triphosphate, 10 μl of PCR buffer (Amersham Pharmacia Biotech), and 2.5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). .. PCR amplification was performed in a minicycler (M.J. Research, Watertown, Mass.) for 34 cycles.

Concentration Assay:

Article Title: Relative Neurotoxin Gene Expression in Clostridium botulinum Type B, Determined Using Quantitative Reverse Transcription-PCR
Article Snippet: .. The PCR mixture specific for cntB consisted of 1× PCR buffer (Roche Diagnostics GmbH), each deoxynucleoside triphosphate (dATP, dTTP, dCTP, and dGTP; Amersham Pharmacia Biotech, Inc.) at a concentration of 0.2 mM, 4 mM MgCl2 (Roche Diagnostics GmbH), each primer (Scandinavian Gene Synthesis AB) at a concentration of 0.5 μM, 0.3 μM fluorogenic probe (Scandinavian Gene Synthesis AB), and 0.05 U of Tth DNA polymerase (Roche Diagnostics GmbH). .. The water used in the PCR assays was autoclaved Millipore-filtered water.

Article Title: Low Rates of Pseudomonas aeruginosa Misidentification in Isolates from Cystic Fibrosis Patients ▿
Article Snippet: .. Ltd.), 1.5 mM MgCl2 , a 20 mM concentration of each deoxynucleoside triphosphate (GE Healthcare, Australia), 1 U of Taq DNA polymerase (Qiagen Pty. .. Ltd.), 11.8 μl of H2 O, and 20 pmol (each) of the oligonucleotide primers fD1 and rD1 (GeneWorks Pty.

Amplification:

Article Title: Detection by PCR and Isolation Assays of the Anaerobic Intestinal Spirochete Brachyspira aalborgi from the Feces of Captive Nonhuman Primates
Article Snippet: .. The amplification mixtures (25 μl) contained 1× PCR buffer, 0.55 U of Tth Plus DNA polymerase, 1.5 mM MgCl2 , 5 nmol of each deoxynucleoside triphosphate (Amersham Pharmacia Biotech AB, Uppsala, Sweden), and 12.5 pmol of each primer. ..

Article Title: Extracts containing CLPs of Bacillus amyloliquefaciens JN68 isolated from chicken intestines exert antimicrobial effects, particularly on methicillin-resistant Staphylococcus aureus and Listeria monocytogenes
Article Snippet: .. The amplification of the 16S rRNA and gyrB gene region of candidate strain was conducted in a 50 µl reaction mixture containing 1 µl genomic DNA template, 5 µl PCR reaction buffer [10 mM Tris-HCl (pH 8.8), 1.5 mM MgCl2 , 50 mM KCl and 0.1% Triton X-100] containing 200 µM of each deoxynucleoside triphosphate (GE Healthcare Life Sciences, Chalfont, UK), 4 µl MgCl2 (52 mM), 1 µM each primer , 1 unit of Taq polymerase (GE Healthcare Life Sciences) and 39 µl autoclaved Milli-Q water (Merck Millipore). .. The PCR was conducted in a Robocycler® temperature thermal cycler (Agilent Technologies, Inc., Santa Clara, CA, USA).

Article Title: PCR-Based Detection, Restriction Endonuclease Analysis, and Transcription of tonB in Haemophilus influenzae and Haemophilus parainfluenzae Isolates Obtained from Children Undergoing Tonsillectomy and Adenoidectomy
Article Snippet: .. PCR amplifications were carried out in 100-μl reaction mixtures consisting of 10 μl of DNA (2 ng/μl) and 90 μl of the amplification mix, which contained the following components: 20 pmol each of the G1 and G2 primers (for the amplification of the 813-bp amplicon) or the T1 and T2 primers (for the nested PCR that amplifies a 250-bp amplicon), 0.5 mM MgCl2 , 200 μm concentrations of each deoxynucleoside triphosphate, 10 μl of PCR buffer (Amersham Pharmacia Biotech), and 2.5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). .. PCR amplification was performed in a minicycler (M.J. Research, Watertown, Mass.) for 34 cycles.

Nested PCR:

Article Title: PCR-Based Detection, Restriction Endonuclease Analysis, and Transcription of tonB in Haemophilus influenzae and Haemophilus parainfluenzae Isolates Obtained from Children Undergoing Tonsillectomy and Adenoidectomy
Article Snippet: .. PCR amplifications were carried out in 100-μl reaction mixtures consisting of 10 μl of DNA (2 ng/μl) and 90 μl of the amplification mix, which contained the following components: 20 pmol each of the G1 and G2 primers (for the amplification of the 813-bp amplicon) or the T1 and T2 primers (for the nested PCR that amplifies a 250-bp amplicon), 0.5 mM MgCl2 , 200 μm concentrations of each deoxynucleoside triphosphate, 10 μl of PCR buffer (Amersham Pharmacia Biotech), and 2.5 U of Taq DNA polymerase (Amersham Pharmacia Biotech). .. PCR amplification was performed in a minicycler (M.J. Research, Watertown, Mass.) for 34 cycles.

Immunoprecipitation:

Article Title: A Multiplicity of Coactivators Is Required by Gcn4p at Individual Promoters In Vivo
Article Snippet: .. Quantitative PCRs contained 1× Platinum Taq polymerase buffer (Invitrogen), 1.5 mM Mg2 Cl2 , 0.2 mM deoxynucleoside triphosphate, 1.6 μCi of [33 P]dATP (Amersham), 0.5 μM POL1 primer pair, 0.15 μM ARG1UAS primer pair, 1.5 U of Platinum Taq polymerase (Invitrogen), and 1/10 of the immunoprecipitated chromatin sample or 1,000-fold diluted input DNA in 15-μl reaction volumes. .. PCR parameters were 94°C for 4 min; 94°C for 30 s, 52°C for 30 s, and 65°C for 1 min for 26 cycles; and then 65°C for 5 min. PCR products were resolved on 6% polyacrylamide gels and quantified by phosphorimaging analysis.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    GE Healthcare deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 23 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/GE Healthcare
    Average 92 stars, based on 23 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    92
    GE Healthcare deoxynucleotide triphosphate
    Deoxynucleotide Triphosphate, supplied by GE Healthcare, used in various techniques. Bioz Stars score: 92/100, based on 25 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleotide triphosphate/product/GE Healthcare
    Average 92 stars, based on 25 article reviews
    Price from $9.99 to $1999.99
    deoxynucleotide triphosphate - by Bioz Stars, 2020-07
    92/100 stars
      Buy from Supplier

    Image Search Results