deoxynucleoside triphosphate dntp mixture  (TaKaRa)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    TaKaRa deoxynucleoside triphosphate dntp mixture
    Deoxynucleoside Triphosphate Dntp Mixture, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 8 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate dntp mixture/product/TaKaRa
    Average 90 stars, based on 8 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate dntp mixture - by Bioz Stars, 2019-10
    90/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The amplicons were confirmed by electrophoresis in an ethidium bromide-stained 3% Tris-borate-EDTA agarose gel.

    Centrifugation:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: As described above, some bacteria (live and dead cells) treated with Pd compounds (or with none) followed by centrifugation underwent three types of DNA extraction, while other samples were directly subjected to qPCR without laborious DNA extraction (direct-qPCR) for comparison with the typical PMA treatment for routine use. .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: Cell pellets obtained by centrifugation of either BAL fluid or oral wash samples were resuspended in RLT Plus buffer (provided by the kit) with beta-mercaptoethanol according to the manufacturer's instructions, and resuspended material was transferred to a lysing matrix B tube (Qbiogene, Carlsbad, CA). .. Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer.

    Amplification:

    Article Title: Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR
    Article Snippet: One representative colony was then selected for each morphotype, and the 16S rRNA gene was amplified using primers pA and pH ( ). .. Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan).

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The gene encoding the IgH region of interest was amplified using the following primer pairs: VH primer, 5′-AGC TCG AGA TGA ACC CAC TGT G-3′, and JH primer, 5′-AGA CTA GTG AAG ACT CTC GGG TGT G-3′, for the first-cycle PCR and CDR3 fw2 primer, 5′-C(G/T)G AGG AC(A/T) CGG CCA CAT A-3′, and JH primer for the second-cycle PCR ( ). .. The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The PCR condition of the first or second cycle was as follows: one cycle at 96°C for 2 min, followed by a three-step procedure consisting of 20 s at 96°C, 30 s at 61°C, and 45 s at 72°C for 35 cycles (first-cycle PCR) or 20 s at 96°C, 30 s at 56°C, and 20 s at 72°C for 35 cycles (second-cycle PCR).

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: Paragraph title: PCR Amplification for Pyrosequencing ... Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan).

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: Paragraph title: DNA extraction, 16S rRNA gene amplification, and PhyloChip processing. ... Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer.

    Article Title: Clinical Bovine Piroplasmosis Caused by Babesia occultans in Italy
    Article Snippet: Reactions were performed using the LA PCR kit version 2.1 (TaKaRa Bio Inc., Shiga, Japan) in 25-μl volumes containing 1 μmol liter−1 of primers, 1× LA PCR buffer (Mg2+ plus), 4 μl of a deoxynucleoside triphosphate (dNTP) mixture (corresponding to 400 μmol liter−1 of each dNTP), 1.25 units of TaKaRa LA Taq , and 5 μl of template DNA. .. Reactions were performed using the LA PCR kit version 2.1 (TaKaRa Bio Inc., Shiga, Japan) in 25-μl volumes containing 1 μmol liter−1 of primers, 1× LA PCR buffer (Mg2+ plus), 4 μl of a deoxynucleoside triphosphate (dNTP) mixture (corresponding to 400 μmol liter−1 of each dNTP), 1.25 units of TaKaRa LA Taq , and 5 μl of template DNA.

    Electrophoresis:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The PCR condition of the first or second cycle was as follows: one cycle at 96°C for 2 min, followed by a three-step procedure consisting of 20 s at 96°C, 30 s at 61°C, and 45 s at 72°C for 35 cycles (first-cycle PCR) or 20 s at 96°C, 30 s at 56°C, and 20 s at 72°C for 35 cycles (second-cycle PCR).

    Article Title: Limitations of the BP26 Protein-Based Indirect Enzyme-Linked Immunosorbent Assay for Diagnosis of Brucellosis
    Article Snippet: PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water. .. PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water.

    Incubation:

    Article Title: Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR
    Article Snippet: Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan). .. Genomic DNA was added to the PCR mixture at a concentration of 0.1 ng/μl.

    Real-time Polymerase Chain Reaction:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: As described above, some bacteria (live and dead cells) treated with Pd compounds (or with none) followed by centrifugation underwent three types of DNA extraction, while other samples were directly subjected to qPCR without laborious DNA extraction (direct-qPCR) for comparison with the typical PMA treatment for routine use. .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The gene encoding the IgH region of interest was amplified using the following primer pairs: VH primer, 5′-AGC TCG AGA TGA ACC CAC TGT G-3′, and JH primer, 5′-AGA CTA GTG AAG ACT CTC GGG TGT G-3′, for the first-cycle PCR and CDR3 fw2 primer, 5′-C(G/T)G AGG AC(A/T) CGG CCA CAT A-3′, and JH primer for the second-cycle PCR ( ). .. The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water.

    Infection:

    Article Title: Limitations of the BP26 Protein-Based Indirect Enzyme-Linked Immunosorbent Assay for Diagnosis of Brucellosis
    Article Snippet: PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water. .. PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water.

    Sequencing:

    Article Title: Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR
    Article Snippet: Paragraph title: Sequencing of the 16S rRNA gene and the variable D1/D2 domain of the 26S rRNA gene from selected colony morphotypes. ... Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan).

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan). .. The second round of PCR was performed by using the primers Pyro-27f (5′- CCATCTCATCCCTGCGTGTCTCCGAC tcagN10 AGRGTTTGATYMTGGCTCAG -3′) and Pyro-338r (5′- CCTATCCCCTGTGTGCCTTGGCAGTC tcagTGCTGCCTCCCGTAGGAGT -3′).

    Article Title: Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192
    Article Snippet: Paragraph title: SNV confirmation by Sanger sequencing. ... Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.).

    DNA Extraction:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Paragraph title: Direct-qPCR without the need for DNA extraction from bacteria (live and dead cells) and with or without Pd compounds for comparison with the currently used PMA method. ... Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW.

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: Paragraph title: DNA extraction, 16S rRNA gene amplification, and PhyloChip processing. ... Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer.

    Fluorescence:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer. .. Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer.

    Isolation:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Direct-qPCR master mix was used to facilitate PCR elongation following direct addition to bacterial cells ( , ). .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Purification:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The amplicons were confirmed by electrophoresis in an ethidium bromide-stained 3% Tris-borate-EDTA agarose gel.

    Article Title: Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192
    Article Snippet: Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.). .. Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.).

    Article Title: Limitations of the BP26 Protein-Based Indirect Enzyme-Linked Immunosorbent Assay for Diagnosis of Brucellosis
    Article Snippet: PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water. .. PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water.

    Polymerase Chain Reaction:

    Article Title: Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR
    Article Snippet: Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan). .. Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan).

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The gene encoding the IgH region of interest was amplified using the following primer pairs: VH primer, 5′-AGC TCG AGA TGA ACC CAC TGT G-3′, and JH primer, 5′-AGA CTA GTG AAG ACT CTC GGG TGT G-3′, for the first-cycle PCR and CDR3 fw2 primer, 5′-C(G/T)G AGG AC(A/T) CGG CCA CAT A-3′, and JH primer for the second-cycle PCR ( ). .. The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water.

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Direct-qPCR master mix was used to facilitate PCR elongation following direct addition to bacterial cells ( , ). .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: Paragraph title: PCR Amplification for Pyrosequencing ... Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan).

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: The universal 16S rRNA primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) ( ) were used to amplify the 16S rRNA gene using 12 PCRs per sample run across a gradient of annealing temperatures (47°C to 58°C) to maximize the diversity recovered ( , , , ). .. Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer. .. PCR conditions were 1 cycle of 3 min at 95°C followed by 30 cycles of 95°C for 30 s, the gradient annealing temperature for 30 s, and 72°C for 1 min and a final extension at 72°C for 7 min. PCR products for each sample were pooled and gel purified, and 500 ng of purified product was processed for PhyloChip analysis as previously described ( , ).

    Article Title: Clinical Bovine Piroplasmosis Caused by Babesia occultans in Italy
    Article Snippet: Blood samples were also submitted to a PCR assay for the detection of bovine piroplasms using the generic primers RLB-F2 (5′-GACACAGGGAGGTAGTGACAAG-3′) ( ) and 18STBR (5′-GATCCTTCYGCAGGTTCACC-3′) as described elsewhere ( ). .. Reactions were performed using the LA PCR kit version 2.1 (TaKaRa Bio Inc., Shiga, Japan) in 25-μl volumes containing 1 μmol liter−1 of primers, 1× LA PCR buffer (Mg2+ plus), 4 μl of a deoxynucleoside triphosphate (dNTP) mixture (corresponding to 400 μmol liter−1 of each dNTP), 1.25 units of TaKaRa LA Taq , and 5 μl of template DNA. .. The cycling protocol consisted of preheating at 94°C for 3 min followed by 40 cycles of 94°C for 30 s, 60°C for 30 s, and 72°C for 1 min, with a final extension at 72°C for 10 min. To rule out other pathogens responsible for anemia and/or fever in cattle, molecular analyses were carried out to detect Anaplasma marginale , Anaplasma centrale , bovine pestiviruses , bovine coronavirus , Schmallenberg virus , and bluetongue virus ( ).

    Article Title: Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192
    Article Snippet: Primers were designed to amplify the regions flanking SNVs of interest (Table S1) by PCR, using genomic DNA from the mutants. .. Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.).

    Article Title: Limitations of the BP26 Protein-Based Indirect Enzyme-Linked Immunosorbent Assay for Diagnosis of Brucellosis
    Article Snippet: The isolates were identified by AMOS-PCR as previously established in our lab. .. PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water. .. The PCRs were initiated with a 10-min 95°C denaturation, followed by 29 cycles of denaturation (94°C, 1 min), annealing (60°C, 1.5 min), extension (72°C, 1.5 min), and a final extension (72°C, 10 min).

    Nested PCR:

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: The V1–V2 hypervariable regions of the 16S rRNA genes of bacteria present at each sampling point were amplified individually by using nested PCR as previously described . .. Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan).

    Activated Clotting Time Assay:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The gene encoding the IgH region of interest was amplified using the following primer pairs: VH primer, 5′-AGC TCG AGA TGA ACC CAC TGT G-3′, and JH primer, 5′-AGA CTA GTG AAG ACT CTC GGG TGT G-3′, for the first-cycle PCR and CDR3 fw2 primer, 5′-C(G/T)G AGG AC(A/T) CGG CCA CAT A-3′, and JH primer for the second-cycle PCR ( ). .. The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water.

    Plasmid Preparation:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The amplicons were confirmed by electrophoresis in an ethidium bromide-stained 3% Tris-borate-EDTA agarose gel.

    SYBR Green Assay:

    Article Title: Innovative Use of Palladium Compounds To Selectively Detect Live Enterobacteriaceae in Milk by PCR
    Article Snippet: Direct-qPCR master mix was used to facilitate PCR elongation following direct addition to bacterial cells ( , ). .. Specifically, the direct-qPCR master mix consisted of the following: 0.5 μl of Taq DNA polymerase (with standard Taq buffer [5 U/μl]; New England BioLabs, Japan, Inc., Tokyo, Japan); 2.5 μl of 10× standard Taq reaction buffer (New England BioLabs); 2.0 μl of a 2 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa-Bio, Ohtsu, Japan); 0.75 μl of 10 μM forward primer (5′-GTTGTAAAGCACTTTCAGTGGTGAGGAAGG-3′) and 10 μM reverse primer (5′-GCCTCAAGGGCACAACCTCCAAG-3′); 5 μl of 2× SYBR green (Invitrogen, CA, USA) (10,000× stock); 2.5 μl of mixed reagent solution stored at −20°C before use (8.3% Brij 58 from Sigma; 1.9% bovine serum albumin from Sigma; 10 mM trisodium citrate dehydrate from Kanto-Kagaku, Tokyo, Japan; 30 mM MgCl2 from Nakalai-Tesque, Kyoto, Japan; 100 μg/ml lysozyme from egg white purchased from Wako Pure Chemicals Industries, Ltd., Osaka, Japan); 5 μl of PCR template (bacterial cells or isolated DNA); and 6.75 μl of SW. .. The forward and reverse primers, which target a specific region of the 16S rRNA gene in Enterobacteriaceae cells, produced an amplicon of 424 bp ( ).

    Multiplex Assay:

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan). .. The second round of PCR was performed by using the primers Pyro-27f (5′- CCATCTCATCCCTGCGTGTCTCCGAC tcagN10 AGRGTTTGATYMTGGCTCAG -3′) and Pyro-338r (5′- CCTATCCCCTGTGTGCCTTGGCAGTC tcagTGCTGCCTCCCGTAGGAGT -3′).

    Agarose Gel Electrophoresis:

    Article Title: Identification of an Atypical Enzootic Bovine Leukosis in Japan by Using a Novel Classification of Bovine Leukemia Based on Immunophenotypic Analysis
    Article Snippet: The amplification was performed in a reaction mixture containing 3 μl of 10× Ex Taq Buffer (TaKaRa Bio, Otsu, Japan), 2.4 μl of a 2.5 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 0.15 μl of TaKaRa Ex Taq (TaKaRa Bio), and 1 μl each of primers in ≤30 μl in double-distilled water. .. The PCR condition of the first or second cycle was as follows: one cycle at 96°C for 2 min, followed by a three-step procedure consisting of 20 s at 96°C, 30 s at 61°C, and 45 s at 72°C for 35 cycles (first-cycle PCR) or 20 s at 96°C, 30 s at 56°C, and 20 s at 72°C for 35 cycles (second-cycle PCR).

    Article Title: Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192
    Article Snippet: Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.). .. Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.).

    Sampling:

    Article Title: Microbial Diversity Analysis of Fermented Mung Beans (Lu-Doh-Huang) by Using Pyrosequencing and Culture Methods
    Article Snippet: The V1–V2 hypervariable regions of the 16S rRNA genes of bacteria present at each sampling point were amplified individually by using nested PCR as previously described . .. Each reaction (volume, 25 µL) contained 10 ng of extracted DNA, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl2 , 200 µM deoxynucleoside triphosphate (dNTP) mixture, 5 pmol of each primer, and 0.625 U ExTaq HS (Takara Bio, Shiga, Japan).

    Concentration Assay:

    Article Title: Quantification of Yeast and Bacterial Gene Transcripts in Retail Cheeses by Reverse Transcription-Quantitative PCR
    Article Snippet: Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan). .. Thermostable Taq DNA polymerase, buffer, and deoxynucleoside triphosphate (dNTP) mixture were purchased from TaKaRa Biomedicals (Shiga, Japan).

    Article Title: Oral and Airway Microbiota in HIV-Infected Pneumonia Patients
    Article Snippet: The universal 16S rRNA primers 27F (5′-AGAGTTTGATCCTGGCTCAG-3′) and 1492R (5′-GGTTACCTTGTTACGACTT-3′) ( ) were used to amplify the 16S rRNA gene using 12 PCRs per sample run across a gradient of annealing temperatures (47°C to 58°C) to maximize the diversity recovered ( , , , ). .. Each PCR mixture contained 100 ng of template DNA, 0.025 U/μl of Ex Taq (TaKaRa Bio, Shiga, Japan), 1× buffer, 0.8 mM deoxynucleoside triphosphate (dNTP) mixture (TaKaRa Bio), 1 μg/μl of bovine serum albumin (Roche, Basel, Switzerland), and a 0.3 μM concentration of each primer. .. PCR conditions were 1 cycle of 3 min at 95°C followed by 30 cycles of 95°C for 30 s, the gradient annealing temperature for 30 s, and 72°C for 1 min and a final extension at 72°C for 7 min. PCR products for each sample were pooled and gel purified, and 500 ng of purified product was processed for PhyloChip analysis as previously described ( , ).

    Gel Extraction:

    Article Title: Mechanistic Study of Utilization of Water-Insoluble Saccharomyces cerevisiae Glucans by Bifidobacterium breve Strain JCM1192
    Article Snippet: Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.). .. Briefly, a 50-μl reaction mixture contained 1 μl of 10 μM forward and reverse primers, 10 μl 5× PrimeSTAR GXL buffers (TaKaRa Bio Inc., Otsu, Shiga, Japan), 4 μl 2.5 mM deoxynucleoside triphosphate (dNTP) mixture, 0.1 μl genomic DNA, and 2.5 U PrimeSTAR GXL polymerase (TaKaRa Bio Inc.).

    Article Title: Limitations of the BP26 Protein-Based Indirect Enzyme-Linked Immunosorbent Assay for Diagnosis of Brucellosis
    Article Snippet: PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water. .. PCR mixture containing 0.1 μM FAbortus , Fsuis , RIS711 , Feri, and Reri, 0.2 μM Fmelitensis , 1 μl DNA, 4 mM deoxynucleoside triphosphate (dNTP) mixture, 5 μl 10× buffer (TaKaRa, Dalian, China), and 1.25 U Taq DNA polymerase (TaKaRa) was brought to a final volume of 50 μl with double-distilled water.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    TaKaRa deoxynucleoside triphosphate dntp mix
    Deoxynucleoside Triphosphate Dntp Mix, supplied by TaKaRa, used in various techniques. Bioz Stars score: 90/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate dntp mix/product/TaKaRa
    Average 90 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate dntp mix - by Bioz Stars, 2019-10
    90/100 stars
      Buy from Supplier

    95
    TaKaRa deoxynucleoside triphosphate
    Deoxynucleoside Triphosphate, supplied by TaKaRa, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/deoxynucleoside triphosphate/product/TaKaRa
    Average 95 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    deoxynucleoside triphosphate - by Bioz Stars, 2019-10
    95/100 stars
      Buy from Supplier

    Image Search Results