Structured Review

Promega dde i
Diagrams representing restriction patterns of 16S rRNA gene digested with <t>Dde</t> I ( a ), Hha I ( b ) or <t>Rsa</t> I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder
Dde I, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/dde i/product/Promega
Average 90 stars, based on 1 article reviews
Price from $9.99 to $1999.99
dde i - by Bioz Stars, 2020-10
90/100 stars

Images

1) Product Images from "Characterization of the Bacterial Diversity in Indo-West Pacific Loliginid and Sepiolid Squid Light Organs"

Article Title: Characterization of the Bacterial Diversity in Indo-West Pacific Loliginid and Sepiolid Squid Light Organs

Journal: Microbial ecology

doi: 10.1007/s00248-012-0099-6

Diagrams representing restriction patterns of 16S rRNA gene digested with Dde I ( a ), Hha I ( b ) or Rsa I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder
Figure Legend Snippet: Diagrams representing restriction patterns of 16S rRNA gene digested with Dde I ( a ), Hha I ( b ) or Rsa I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder

Techniques Used:

2) Product Images from "High Rates of Homologous Recombination in the Mite Endosymbiont and Opportunistic Human Pathogen Orientia tsutsugamushi"

Article Title: High Rates of Homologous Recombination in the Mite Endosymbiont and Opportunistic Human Pathogen Orientia tsutsugamushi

Journal: PLoS Neglected Tropical Diseases

doi: 10.1371/journal.pntd.0000752

The restriction enzyme analysis on a predicted multiple infection O. tsutsugamushi strain. The DNA pattern on O. tsutsugamushi strain no. 37 undigested PCR product (1) and products after digestion with Dde I enzyme (2). M represents a 100 bp-DNA ladder marker.
Figure Legend Snippet: The restriction enzyme analysis on a predicted multiple infection O. tsutsugamushi strain. The DNA pattern on O. tsutsugamushi strain no. 37 undigested PCR product (1) and products after digestion with Dde I enzyme (2). M represents a 100 bp-DNA ladder marker.

Techniques Used: Infection, Polymerase Chain Reaction, Marker

Related Articles

Amplification:

Article Title: Development and Application of a New Scheme for Typing Campylobacter jejuni and Campylobacter coli by PCR-Based Restriction Fragment Length Polymorphism Analysis
Article Snippet: .. After amplification, 10 μl of PCR product was digested with 10 U of restriction enzymes ( Hha I and Nla III [New England Biolabs] and Dde I and Hin dIII [Promega]) in a total volume of 20 μl with 2 μg of bovine serum albumin for more than 3 h at 37°C. .. The digest was analyzed by electrophoresis by using a 1.5% agarose gel and stained with ethidium bromide.

Article Title: A survey of the mycobiota associated with larvae of the black soldier fly (Hermetia illucens) reared for feed production
Article Snippet: .. PCR was performed in 30μl of reaction mixture containing 1X Green GoTaq Reaction Buffer, 0.2mM dNTPs, 0.5μM of each primer, 1.25U GoTaq G2 (Promega Corp., Madison, WI, U.S.A.) and 50ng of template DNA extracted as above, under the following cycling conditions: 94°C for 7 min, 35 cycles at 94°C for 45 sec, 55°C for 45 sec and 72°C for 1 min with a final extension at 72°C for 10 min. Aliquots of 5μl of each amplified product were electrophoretically separated on 1.5% agarose gels in 1X TAE buffer at 90V constant voltage for 30 min. PCR products of the 5.8S-ITS region were digested with the restriction endonucleases Hae III (10U/μl), Dpn I (10U/μl) and Dde I (10U/μl) (Promega Corp., Madison, WI, U.S.A.), in 20μl of reaction volume according to manufacturer instructions and conditions. .. Restriction fragments (ITS-5.8 RFLP’s) were separated on 2% agarose gel in 0.5X TBE buffer for 2 h. Band sizes were estimated by comparison against Bench Top 100bp DNA ladder (Promega Corp., Madison, WI, U.S.A.).

Article Title: Induced Pluripotent Stem Cells from Familial Alzheimer's Disease Patients Differentiate into Mature Neurons with Amyloidogenic Properties
Article Snippet: .. To check the presence of the mutant PSEN1 transcript in iPSCAD, the PSEN1 RT-PCR fragments around mutation area were amplified by Taq polymerase (Invitrogen), purified with the Qiagen gel extraction kit (Qiagen), digested with Dde I (Promega, Madison, WI), and analyzed on 3% agarose gels. .. To identify the point mutation, the RT-PCR fragments was subcloned to TA cloning vector (Invitrogen) and the plasmids DNA was subjected to DNA sequencing.

Mutagenesis:

Article Title: Induced Pluripotent Stem Cells from Familial Alzheimer's Disease Patients Differentiate into Mature Neurons with Amyloidogenic Properties
Article Snippet: .. To check the presence of the mutant PSEN1 transcript in iPSCAD, the PSEN1 RT-PCR fragments around mutation area were amplified by Taq polymerase (Invitrogen), purified with the Qiagen gel extraction kit (Qiagen), digested with Dde I (Promega, Madison, WI), and analyzed on 3% agarose gels. .. To identify the point mutation, the RT-PCR fragments was subcloned to TA cloning vector (Invitrogen) and the plasmids DNA was subjected to DNA sequencing.

Size-exclusion Chromatography:

Article Title: A survey of the mycobiota associated with larvae of the black soldier fly (Hermetia illucens) reared for feed production
Article Snippet: .. PCR was performed in 30μl of reaction mixture containing 1X Green GoTaq Reaction Buffer, 0.2mM dNTPs, 0.5μM of each primer, 1.25U GoTaq G2 (Promega Corp., Madison, WI, U.S.A.) and 50ng of template DNA extracted as above, under the following cycling conditions: 94°C for 7 min, 35 cycles at 94°C for 45 sec, 55°C for 45 sec and 72°C for 1 min with a final extension at 72°C for 10 min. Aliquots of 5μl of each amplified product were electrophoretically separated on 1.5% agarose gels in 1X TAE buffer at 90V constant voltage for 30 min. PCR products of the 5.8S-ITS region were digested with the restriction endonucleases Hae III (10U/μl), Dpn I (10U/μl) and Dde I (10U/μl) (Promega Corp., Madison, WI, U.S.A.), in 20μl of reaction volume according to manufacturer instructions and conditions. .. Restriction fragments (ITS-5.8 RFLP’s) were separated on 2% agarose gel in 0.5X TBE buffer for 2 h. Band sizes were estimated by comparison against Bench Top 100bp DNA ladder (Promega Corp., Madison, WI, U.S.A.).

Terminal Restriction Fragment Length Polymorphism:

Article Title: Community terminal restriction fragment length polymorphisms reveal insights into the diversity and dynamics of leaf endophytic bacteria
Article Snippet: .. Therefore, we chose Dde I (Promega) to perform the mono-digestion T-RFLP to generate T-RFLP profiles from five species of plants. ..

Purification:

Article Title: Induced Pluripotent Stem Cells from Familial Alzheimer's Disease Patients Differentiate into Mature Neurons with Amyloidogenic Properties
Article Snippet: .. To check the presence of the mutant PSEN1 transcript in iPSCAD, the PSEN1 RT-PCR fragments around mutation area were amplified by Taq polymerase (Invitrogen), purified with the Qiagen gel extraction kit (Qiagen), digested with Dde I (Promega, Madison, WI), and analyzed on 3% agarose gels. .. To identify the point mutation, the RT-PCR fragments was subcloned to TA cloning vector (Invitrogen) and the plasmids DNA was subjected to DNA sequencing.

Polymerase Chain Reaction:

Article Title: Development and Application of a New Scheme for Typing Campylobacter jejuni and Campylobacter coli by PCR-Based Restriction Fragment Length Polymorphism Analysis
Article Snippet: .. After amplification, 10 μl of PCR product was digested with 10 U of restriction enzymes ( Hha I and Nla III [New England Biolabs] and Dde I and Hin dIII [Promega]) in a total volume of 20 μl with 2 μg of bovine serum albumin for more than 3 h at 37°C. .. The digest was analyzed by electrophoresis by using a 1.5% agarose gel and stained with ethidium bromide.

Article Title: Lipid peroxidation and glutathione peroxidase activity relationship in breast cancer depends on functional polymorphism of GPX1
Article Snippet: .. Particular genotypes for GPX1 and SEP15 were identified on the basis of PCR-RFLP method, using following restriction enzymes: DDe I (Promega, Madison, WI, USA) fo GPX1 and FspB I (Fermentas, Waltham, MA, USA) for SEP15 . .. Oligonucleotide sequences for PCR primers were: GPX1 forward 5′-ACCCTCTCTTCGCCTTCC-3′, GPX1 reverse 5′AGGACCAGCACCCATCTC-3′, SEP15 forward 5′– GCCTGCTCCTCAGAGTCTC –3′ and SEP15 reverse 5′–AAACATGAAAGAACAAACCAGAAG–3′.

Article Title: Modeling the differential phenotypes of spinal muscular atrophy with high-yield generation of motor neurons from human induced pluripotent stem cells
Article Snippet: .. The PCR products were separately digested with enzyme Dra I and Dde I (Promega, USA) at 37°C overnight. ..

Article Title: High Rates of Homologous Recombination in the Mite Endosymbiont and Opportunistic Human Pathogen Orientia tsutsugamushi
Article Snippet: .. PCR products of locus gpsA from 2 strains (no. 37 and 70) were digested with Dde I (Promega, USA) and Nco I (NEB, England) respectively, as recommended by the manufacturer. .. The restriction enzyme pattern was analysed by gel electrophoresis.

Article Title: A survey of the mycobiota associated with larvae of the black soldier fly (Hermetia illucens) reared for feed production
Article Snippet: .. PCR was performed in 30μl of reaction mixture containing 1X Green GoTaq Reaction Buffer, 0.2mM dNTPs, 0.5μM of each primer, 1.25U GoTaq G2 (Promega Corp., Madison, WI, U.S.A.) and 50ng of template DNA extracted as above, under the following cycling conditions: 94°C for 7 min, 35 cycles at 94°C for 45 sec, 55°C for 45 sec and 72°C for 1 min with a final extension at 72°C for 10 min. Aliquots of 5μl of each amplified product were electrophoretically separated on 1.5% agarose gels in 1X TAE buffer at 90V constant voltage for 30 min. PCR products of the 5.8S-ITS region were digested with the restriction endonucleases Hae III (10U/μl), Dpn I (10U/μl) and Dde I (10U/μl) (Promega Corp., Madison, WI, U.S.A.), in 20μl of reaction volume according to manufacturer instructions and conditions. .. Restriction fragments (ITS-5.8 RFLP’s) were separated on 2% agarose gel in 0.5X TBE buffer for 2 h. Band sizes were estimated by comparison against Bench Top 100bp DNA ladder (Promega Corp., Madison, WI, U.S.A.).

Reverse Transcription Polymerase Chain Reaction:

Article Title: Induced Pluripotent Stem Cells from Familial Alzheimer's Disease Patients Differentiate into Mature Neurons with Amyloidogenic Properties
Article Snippet: .. To check the presence of the mutant PSEN1 transcript in iPSCAD, the PSEN1 RT-PCR fragments around mutation area were amplified by Taq polymerase (Invitrogen), purified with the Qiagen gel extraction kit (Qiagen), digested with Dde I (Promega, Madison, WI), and analyzed on 3% agarose gels. .. To identify the point mutation, the RT-PCR fragments was subcloned to TA cloning vector (Invitrogen) and the plasmids DNA was subjected to DNA sequencing.

Gel Extraction:

Article Title: Induced Pluripotent Stem Cells from Familial Alzheimer's Disease Patients Differentiate into Mature Neurons with Amyloidogenic Properties
Article Snippet: .. To check the presence of the mutant PSEN1 transcript in iPSCAD, the PSEN1 RT-PCR fragments around mutation area were amplified by Taq polymerase (Invitrogen), purified with the Qiagen gel extraction kit (Qiagen), digested with Dde I (Promega, Madison, WI), and analyzed on 3% agarose gels. .. To identify the point mutation, the RT-PCR fragments was subcloned to TA cloning vector (Invitrogen) and the plasmids DNA was subjected to DNA sequencing.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Promega dde i
    Diagrams representing restriction patterns of 16S rRNA gene digested with <t>Dde</t> I ( a ), Hha I ( b ) or <t>Rsa</t> I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder
    Dde I, supplied by Promega, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/dde i/product/Promega
    Average 90 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    dde i - by Bioz Stars, 2020-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Diagrams representing restriction patterns of 16S rRNA gene digested with Dde I ( a ), Hha I ( b ) or Rsa I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder

    Journal: Microbial ecology

    Article Title: Characterization of the Bacterial Diversity in Indo-West Pacific Loliginid and Sepiolid Squid Light Organs

    doi: 10.1007/s00248-012-0099-6

    Figure Lengend Snippet: Diagrams representing restriction patterns of 16S rRNA gene digested with Dde I ( a ), Hha I ( b ) or Rsa I ( c ). First column in each diagram corresponds to the banding pattern for the 1 Kb ladder

    Article Snippet: RFLP analysis was completed as described by Urakawa et al. [ , ] using three restriction endonucleases: Rsa I (5′GTAC3′), Hha I (5′GCGC3′) and Dde I (5′CTNAG3′; Promega Corporation, Madison, WI).

    Techniques:

    The restriction enzyme analysis on a predicted multiple infection O. tsutsugamushi strain. The DNA pattern on O. tsutsugamushi strain no. 37 undigested PCR product (1) and products after digestion with Dde I enzyme (2). M represents a 100 bp-DNA ladder marker.

    Journal: PLoS Neglected Tropical Diseases

    Article Title: High Rates of Homologous Recombination in the Mite Endosymbiont and Opportunistic Human Pathogen Orientia tsutsugamushi

    doi: 10.1371/journal.pntd.0000752

    Figure Lengend Snippet: The restriction enzyme analysis on a predicted multiple infection O. tsutsugamushi strain. The DNA pattern on O. tsutsugamushi strain no. 37 undigested PCR product (1) and products after digestion with Dde I enzyme (2). M represents a 100 bp-DNA ladder marker.

    Article Snippet: PCR products of locus gpsA from 2 strains (no. 37 and 70) were digested with Dde I (Promega, USA) and Nco I (NEB, England) respectively, as recommended by the manufacturer.

    Techniques: Infection, Polymerase Chain Reaction, Marker