Review



crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc  (ATCC)


Bioz Verified Symbol ATCC is a verified supplier
Bioz Manufacturer Symbol ATCC manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    ATCC crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc
    Crl 1573 Rrid Cvcl 0045 Oligonucleotides Probe Lv Atctctctccttctagcctc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc - by Bioz Stars, 2025-01
    99/100 stars

    Images



    Similar Products

    crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc  (ATCC)
    99
    ATCC crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc
    Crl 1573 Rrid Cvcl 0045 Oligonucleotides Probe Lv Atctctctccttctagcctc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 oligonucleotides probe lv atctctctccttctagcctc - by Bioz Stars, 2025-01
    99/100 stars
    		  Buy from Supplier
    crl 1573 rrid cvcl 0045  (ATCC)
    86
    ATCC crl 1573 rrid cvcl 0045
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    Crl 1573 Rrid Cvcl 0045, supplied by ATCC, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045/product/ATCC
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 - by Bioz Stars, 2025-01
    86/100 stars
    		  Buy from Supplier
    1573 rrid cvcl 0045  (ATCC)
    99
    ATCC 1573 rrid cvcl 0045
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    1573 Rrid Cvcl 0045, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/1573 rrid cvcl 0045/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    1573 rrid cvcl 0045 - by Bioz Stars, 2025-01
    99/100 stars
    		  Buy from Supplier
    crl 1573 rrid cvcl 0045  (Thermo Fisher)
    86
    Thermo Fisher crl 1573 rrid cvcl 0045
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    Crl 1573 Rrid Cvcl 0045, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 - by Bioz Stars, 2025-01
    86/100 stars
    		  Buy from Supplier
    crl 1573 rrid cvcl 0045 rat  (ATCC)
    99
    ATCC crl 1573 rrid cvcl 0045 rat
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    Crl 1573 Rrid Cvcl 0045 Rat, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045 rat/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 rat - by Bioz Stars, 2025-01
    99/100 stars
    		  Buy from Supplier
    crl 1573 rrid cvcl 0045 molt 4  (ATCC)
    99
    ATCC crl 1573 rrid cvcl 0045 molt 4
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    Crl 1573 Rrid Cvcl 0045 Molt 4, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045 molt 4/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 molt 4 - by Bioz Stars, 2025-01
    99/100 stars
    		  Buy from Supplier
    crl 1573 rrid cvcl 0045 hek293t atcc  (ATCC)
    99
    ATCC crl 1573 rrid cvcl 0045 hek293t atcc
    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.
    Crl 1573 Rrid Cvcl 0045 Hek293t Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/crl 1573 rrid cvcl 0045 hek293t atcc/product/ATCC
    Average 99 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    crl 1573 rrid cvcl 0045 hek293t atcc - by Bioz Stars, 2025-01
    99/100 stars
    		  Buy from Supplier

    Image Search Results


    Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.

    Journal: Science Advances

    Article Title: Mitochondrial pyruvate transport regulates presynaptic metabolism and neurotransmission

    doi: 10.1126/sciadv.adp7423

    Figure Lengend Snippet: Key resource table. ATCC, American Type Culture Collection; IgG, immunoglobulin G; N/A, not applicable.

    Article Snippet: HEK293 cell line , ATCC , ATCC code: CRL-1573 RRID: CVCL_0045.

    Techniques: Western Blot, shRNA, Inhibition, Magnetic Beads, Plasmid Preparation, Sequencing, CRISPR, Software