mrna expression  (Zymo Research)


Bioz Verified Symbol Zymo Research is a verified supplier
Bioz Manufacturer Symbol Zymo Research manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 92
    Name:
    RNA Clean Concentrator 25
    Description:
    The RNA Clean Concentrator kits provide a simple and reliable method for the rapid preparation of high quality RT PCR ready DNA free R1013 R1014 RNA This simple procedure is based on the use of a unique single buffer system and Zymo Spin column technology that allows for selective recovery of total RNA 17 nt large RNAs 200 nt and or small RNAs 17 200 nt The procedure is easy Add binding buffer and ethanol to your sample then bind wash and elute ultra pure RNA The RNA can be eluted from the Zymo Spin IC Column in as little as 6 µl of RNase free water The highly concentrated purified RNA is suitable for all subsequent analyses and molecular manipulations
    Catalog Number:
    r1017
    Price:
    None
    Applications:
    RNA Purification
    Size:
    50 units
    Category:
    Life Science Reagents and Media
    Buy from Supplier


    Structured Review

    Zymo Research mrna expression
    Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of <t>RNA-seq</t> (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. <t>mRNA</t> with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value
    The RNA Clean Concentrator kits provide a simple and reliable method for the rapid preparation of high quality RT PCR ready DNA free R1013 R1014 RNA This simple procedure is based on the use of a unique single buffer system and Zymo Spin column technology that allows for selective recovery of total RNA 17 nt large RNAs 200 nt and or small RNAs 17 200 nt The procedure is easy Add binding buffer and ethanol to your sample then bind wash and elute ultra pure RNA The RNA can be eluted from the Zymo Spin IC Column in as little as 6 µl of RNase free water The highly concentrated purified RNA is suitable for all subsequent analyses and molecular manipulations
    https://www.bioz.com/result/mrna expression/product/Zymo Research
    Average 92 stars, based on 917 article reviews
    Price from $9.99 to $1999.99
    mrna expression - by Bioz Stars, 2020-05
    92/100 stars

    Images

    1) Product Images from "Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications"

    Article Title: Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150705

    Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value
    Figure Legend Snippet: Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value

    Techniques Used: Expressing, RNA Sequencing Assay, Microarray, Transformation Assay, Mouse Assay, Transgenic Assay

    2) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    3) Product Images from "Combining Comprehensive Analysis of Off-Site Lambda Phage Integration with a CRISPR-Based Means of Characterizing Downstream Physiology"

    Article Title: Combining Comprehensive Analysis of Off-Site Lambda Phage Integration with a CRISPR-Based Means of Characterizing Downstream Physiology

    Journal: mBio

    doi: 10.1128/mBio.01038-17

    NGS analysis of phage integration sites. (A) A schematic diagram of NGS library preparation. Genomic DNA extracted from phage-infected E. coli (input DNA) is first enzymatically fragmented (step 1) and then ligated with adaptors (step 2). The fragments are PCR amplified with an adaptor-specific primer (gray) and a biotinylated primer specific to phage sequence (red) (PCR1) (step 3). The biotinylated PCR fragments are pulled down by magnetic streptavidin beads (step 4). Another round of PCR is performed using an adaptor-specific primer (gray) and phage-specific primer (red) containing the sequences necessary for Illumina sequencing. The phage-specific primer is internal to the primer used in PCR1, making this PCR seminested for increased specificity. (B) A genome-wide landscape of detected integration sites. On the outer ring, the positions of integration sites are shown. The color code indicates that the site was found in 1 (black), 2 to 4 (green), or > 4 (red) replicate samples. For those that were found in multiple (i.e., green and red) replicate samples, the names of the genes closest to each integration site are shown. *, sites that were also found in the work described in references 7 and 9 . The inner ring shows the motif scores of each integration site relative to the average score for all integration sites found. The dashed line indicates the average score of all possible 29-base genomic sequences. (C) A summary of the locations of the detected secondary integration sites. The secondary integration sites were categorized by strandness (left) or by their position with respect to host genes (top). The upstream and downstream positions are defined with respect to the gene closest to the integration site. (D) The sequence motif of integration sites. A total of 29 bases around each of the integration sites were inputted into the WebLogo program ( http://weblogo.berkeley.edu/ ) to generate the motif. For comparison, the corresponding attB sequence is also shown (top); bold letters indicate bases that match the motif.
    Figure Legend Snippet: NGS analysis of phage integration sites. (A) A schematic diagram of NGS library preparation. Genomic DNA extracted from phage-infected E. coli (input DNA) is first enzymatically fragmented (step 1) and then ligated with adaptors (step 2). The fragments are PCR amplified with an adaptor-specific primer (gray) and a biotinylated primer specific to phage sequence (red) (PCR1) (step 3). The biotinylated PCR fragments are pulled down by magnetic streptavidin beads (step 4). Another round of PCR is performed using an adaptor-specific primer (gray) and phage-specific primer (red) containing the sequences necessary for Illumina sequencing. The phage-specific primer is internal to the primer used in PCR1, making this PCR seminested for increased specificity. (B) A genome-wide landscape of detected integration sites. On the outer ring, the positions of integration sites are shown. The color code indicates that the site was found in 1 (black), 2 to 4 (green), or > 4 (red) replicate samples. For those that were found in multiple (i.e., green and red) replicate samples, the names of the genes closest to each integration site are shown. *, sites that were also found in the work described in references 7 and 9 . The inner ring shows the motif scores of each integration site relative to the average score for all integration sites found. The dashed line indicates the average score of all possible 29-base genomic sequences. (C) A summary of the locations of the detected secondary integration sites. The secondary integration sites were categorized by strandness (left) or by their position with respect to host genes (top). The upstream and downstream positions are defined with respect to the gene closest to the integration site. (D) The sequence motif of integration sites. A total of 29 bases around each of the integration sites were inputted into the WebLogo program ( http://weblogo.berkeley.edu/ ) to generate the motif. For comparison, the corresponding attB sequence is also shown (top); bold letters indicate bases that match the motif.

    Techniques Used: Next-Generation Sequencing, Infection, Polymerase Chain Reaction, Amplification, Sequencing, Genome Wide, Genomic Sequencing

    4) Product Images from "Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications"

    Article Title: Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150705

    Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value
    Figure Legend Snippet: Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value

    Techniques Used: Expressing, RNA Sequencing Assay, Microarray, Transformation Assay, Mouse Assay, Transgenic Assay

    5) Product Images from "The Janus transcription factor HapX controls fungal adaptation to both iron starvation and iron excess"

    Article Title: The Janus transcription factor HapX controls fungal adaptation to both iron starvation and iron excess

    Journal: The EMBO Journal

    doi: 10.15252/embj.201489468

    HapX production decreases during ambient and high-iron availability A qRT-PCR revealing iron-dependent sreA and hapX transcript abundance. Transcript levels of hapX and sreA were determined during iron starvation (−Fe), iron sufficiency (+Fe, 0.03 mM), iron excess (hFe, 3 mM) and after a 1-h shift from iron starvation to iron sufficiency (sFe) and normalized to that of γ-actin (AFUA_6G04740) using the method. Data represent the mean ± SD of two biological and three PCR technical replicates and are presented relative to the transcript levels during iron sufficiency. All differences found are statistically significant with exception of the hapX transcript level during iron sufficiency compared to high-iron conditions (two-tailed, unpaired t -test; P
    Figure Legend Snippet: HapX production decreases during ambient and high-iron availability A qRT-PCR revealing iron-dependent sreA and hapX transcript abundance. Transcript levels of hapX and sreA were determined during iron starvation (−Fe), iron sufficiency (+Fe, 0.03 mM), iron excess (hFe, 3 mM) and after a 1-h shift from iron starvation to iron sufficiency (sFe) and normalized to that of γ-actin (AFUA_6G04740) using the method. Data represent the mean ± SD of two biological and three PCR technical replicates and are presented relative to the transcript levels during iron sufficiency. All differences found are statistically significant with exception of the hapX transcript level during iron sufficiency compared to high-iron conditions (two-tailed, unpaired t -test; P

    Techniques Used: Quantitative RT-PCR, Polymerase Chain Reaction, Two Tailed Test

    6) Product Images from "Direct Quantitative Monitoring of Homology-Directed DNA Repair of Damaged Telomeres"

    Article Title: Direct Quantitative Monitoring of Homology-Directed DNA Repair of Damaged Telomeres

    Journal: Methods in enzymology

    doi: 10.1016/bs.mie.2017.11.010

    (A) Chemical structure of BrdU. (B) Schematic of BrdU incorporation into nascent telomeres after TRF1–FokI breaks. (C) Sample ethidium bromide-stained agarose gel of sonicated gDNA from U2OS cells induced with TRF1–FokI for 2 h. (D) Sample BrdU IP dot blot for telomere content using a 32 P-labeled telomere oligonucleotide from U2OS cells induced with TRF1–FokI for 2 h. BrdU , 5-bromo-2ʹ-deoxyuridine; IP , immunoprecipitation; gDNA , genomic DNA; Ind , induction of TRF1–FokI; WT , wild-type TRF1–FokI; D450A , nuclease-deficient TRF1–FokI.
    Figure Legend Snippet: (A) Chemical structure of BrdU. (B) Schematic of BrdU incorporation into nascent telomeres after TRF1–FokI breaks. (C) Sample ethidium bromide-stained agarose gel of sonicated gDNA from U2OS cells induced with TRF1–FokI for 2 h. (D) Sample BrdU IP dot blot for telomere content using a 32 P-labeled telomere oligonucleotide from U2OS cells induced with TRF1–FokI for 2 h. BrdU , 5-bromo-2ʹ-deoxyuridine; IP , immunoprecipitation; gDNA , genomic DNA; Ind , induction of TRF1–FokI; WT , wild-type TRF1–FokI; D450A , nuclease-deficient TRF1–FokI.

    Techniques Used: BrdU Incorporation Assay, Staining, Agarose Gel Electrophoresis, Sonication, Dot Blot, Labeling, Immunoprecipitation

    7) Product Images from "CRISPR-Cas9 ribonucleoprotein-mediated co-editing and counterselection in the rice blast fungus"

    Article Title: CRISPR-Cas9 ribonucleoprotein-mediated co-editing and counterselection in the rice blast fungus

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-32702-w

    Oligonucleotide-mediated RNP-CRISPR-Cas9 genome editing of SDI1 to confer carboxin resistance. ( a ) Illustration of the substitution required to give a carboxin resistant form of the succinate dehydrogenase subunit product of MGG_00167 and the oligonucleotide donor DNAs capable of introducing the required one nucleotide change necessary tested. Also indicated is the genomic target sequence of the SDI1 -targeting RNP-CRISPR-Cas9 complex employed. ( b ) Diagram showing the RNP used and the predicted DSB at the SDI1 -targeting RNP-CRISPR-Cas9 genomic target sequence. ( c ) Graph showing the number of transformants obtained using the different donor DNAs indicated in a. in combination with the RNP illustrated in b. ( d ) Transformants from the 80 bp long donor DNA shown in panel a. transformed together with the RNP complex illustrated in panel b. and also showing control plates where only the donor DNA without RNP was transformed (although no transformants are visible on the control plates, using the RNP+ the 30 bp donor one carboxin resistant transformant was obtained which may indicate that very rarely the short oligos can recombine in the absence of the RNP complex; no other carboxin resistant transformants were obtained in the other controls).
    Figure Legend Snippet: Oligonucleotide-mediated RNP-CRISPR-Cas9 genome editing of SDI1 to confer carboxin resistance. ( a ) Illustration of the substitution required to give a carboxin resistant form of the succinate dehydrogenase subunit product of MGG_00167 and the oligonucleotide donor DNAs capable of introducing the required one nucleotide change necessary tested. Also indicated is the genomic target sequence of the SDI1 -targeting RNP-CRISPR-Cas9 complex employed. ( b ) Diagram showing the RNP used and the predicted DSB at the SDI1 -targeting RNP-CRISPR-Cas9 genomic target sequence. ( c ) Graph showing the number of transformants obtained using the different donor DNAs indicated in a. in combination with the RNP illustrated in b. ( d ) Transformants from the 80 bp long donor DNA shown in panel a. transformed together with the RNP complex illustrated in panel b. and also showing control plates where only the donor DNA without RNP was transformed (although no transformants are visible on the control plates, using the RNP+ the 30 bp donor one carboxin resistant transformant was obtained which may indicate that very rarely the short oligos can recombine in the absence of the RNP complex; no other carboxin resistant transformants were obtained in the other controls).

    Techniques Used: CRISPR, Sequencing, Transformation Assay

    CRISPR-Cas9 genome editing using purified Cas9 and sgRNAs. ( a ) Illustration of the genomic target sequence for the ALB1 -targeting RNP-CRISPR-Cas9 complex used showing a typical double stranded break in relation to the PAM site. ( b ) An illustration of the donor DNA sequences used to repair DSBs created by RNP-CRISPR-Cas9 complexes and showing the position of break point relative to the selection marker hygromycin -phosphotransferase (HPH) used. ( c ) Transformants picked from ALB1 -targeting RNP-CRISPR-Cas9 + donor DNA transformation plates (before pigmentation was normally apparent) and growing on CM + hygromycin showing albino mutants and also (top right) transformants picked from a donor only control plate. ( d ) Transformants picked RSY1 -targeting RNP-CRISPR-Cas9 + donor DNA transformation plates (before pigmentation was apparent) and growing on CM + hygromycin showing the rsy phenotype (rosy or normally orange-red) pigmentation (one wild-type pigmented transformant is also indicated (WT) in the bottom left hand side of the plate).
    Figure Legend Snippet: CRISPR-Cas9 genome editing using purified Cas9 and sgRNAs. ( a ) Illustration of the genomic target sequence for the ALB1 -targeting RNP-CRISPR-Cas9 complex used showing a typical double stranded break in relation to the PAM site. ( b ) An illustration of the donor DNA sequences used to repair DSBs created by RNP-CRISPR-Cas9 complexes and showing the position of break point relative to the selection marker hygromycin -phosphotransferase (HPH) used. ( c ) Transformants picked from ALB1 -targeting RNP-CRISPR-Cas9 + donor DNA transformation plates (before pigmentation was normally apparent) and growing on CM + hygromycin showing albino mutants and also (top right) transformants picked from a donor only control plate. ( d ) Transformants picked RSY1 -targeting RNP-CRISPR-Cas9 + donor DNA transformation plates (before pigmentation was apparent) and growing on CM + hygromycin showing the rsy phenotype (rosy or normally orange-red) pigmentation (one wild-type pigmented transformant is also indicated (WT) in the bottom left hand side of the plate).

    Techniques Used: CRISPR, Purification, Sequencing, Selection, Marker, Transformation Assay

    Marker-less RNP-CRISPR-Cas9 gene targeting of ALB1 without donor DNA. ( a ) Transformation plates from ALB1 -targeting RNP-CRISPR-Cas9 without donor DNA showing rare albino patches ( b ) Primary colonies obtained by picking from the white patches shown in a. ( c ) Purified regenerants following a combination of subculture (hyphal tip isolation) and single spore isolation in most cases gave pure albino colonies. ( d ) Gel electrophoresis of the PCR products generated using the genomic DNA of the purified albino regenerants and primers PKS-ck-F and PKS-ck-R which flank the ALB1 -targeting RNP-CRISPR-Cas9 genomic target sequence showing visible variation in product size. The gel image shown here was cropped, but no other bands were present. The full gel is given in Fig. S1 . ( e ) Sequences of the amplicons shown in ( d ), showing a range of mutations and indels.
    Figure Legend Snippet: Marker-less RNP-CRISPR-Cas9 gene targeting of ALB1 without donor DNA. ( a ) Transformation plates from ALB1 -targeting RNP-CRISPR-Cas9 without donor DNA showing rare albino patches ( b ) Primary colonies obtained by picking from the white patches shown in a. ( c ) Purified regenerants following a combination of subculture (hyphal tip isolation) and single spore isolation in most cases gave pure albino colonies. ( d ) Gel electrophoresis of the PCR products generated using the genomic DNA of the purified albino regenerants and primers PKS-ck-F and PKS-ck-R which flank the ALB1 -targeting RNP-CRISPR-Cas9 genomic target sequence showing visible variation in product size. The gel image shown here was cropped, but no other bands were present. The full gel is given in Fig. S1 . ( e ) Sequences of the amplicons shown in ( d ), showing a range of mutations and indels.

    Techniques Used: Marker, CRISPR, Transformation Assay, Purification, Isolation, Nucleic Acid Electrophoresis, Polymerase Chain Reaction, Generated, Sequencing

    RNP-CRISPR-Cas9 gene co-editing to introduce a N-terminal GFP tag to Sep5 and a temperature sensitive mutation in Sep6. ( a ) An illustration of the genomic target sequence and donor DNAs employed for generation of a temperature sensitive (ts)-encoding allele of SEP6 by co-editing at the native locus. ( b ) Leaf sections showing the infection of rice cultivar Co-39 with conidia of a strain (T-4-2) with the ts allele of SEP6 . ( c ) Confirmation of the introduction of the desired mutation in T-4-2 by sequencing of a 472 bp amplicon generated using the primers SEP6ts?-f CACACCCTGAAGCCCCTTGATATC and SEP6ts?-R CTCCTCGGTTGTGTGGATGAG (relevant section only shown; other regions of the amplicon corresponded to the WT sequence exactly). ( d ) An illustration of the genomic target sequence for the RNP and PCR-generated donor DNA used for generation of a strain where the GFP-encoding gene is inserted after the START codon of the Sep5-encoding gene potentially giving rise to a SEP5-GFP expressing strain with an in locus replacement of the native SEP5 gene. ( e ) Micrographs showing the appressorial Sep5-Gfp containing septin ring in a strain where SEP5 was replaced by the Sep5-Gfp-encoding gene in locus by RNP-CRISPR-Cas9 co-editing and the corresponding septin ring in the ectopically integrated SEP5-GFP -expressing strain constructed by Dagdas and co-workers 26 . The bar is 5 μm. The linescan graphs show the Sep5-GFP fluorescence in a transverse section of the individual appressoria shown in the micrographs.
    Figure Legend Snippet: RNP-CRISPR-Cas9 gene co-editing to introduce a N-terminal GFP tag to Sep5 and a temperature sensitive mutation in Sep6. ( a ) An illustration of the genomic target sequence and donor DNAs employed for generation of a temperature sensitive (ts)-encoding allele of SEP6 by co-editing at the native locus. ( b ) Leaf sections showing the infection of rice cultivar Co-39 with conidia of a strain (T-4-2) with the ts allele of SEP6 . ( c ) Confirmation of the introduction of the desired mutation in T-4-2 by sequencing of a 472 bp amplicon generated using the primers SEP6ts?-f CACACCCTGAAGCCCCTTGATATC and SEP6ts?-R CTCCTCGGTTGTGTGGATGAG (relevant section only shown; other regions of the amplicon corresponded to the WT sequence exactly). ( d ) An illustration of the genomic target sequence for the RNP and PCR-generated donor DNA used for generation of a strain where the GFP-encoding gene is inserted after the START codon of the Sep5-encoding gene potentially giving rise to a SEP5-GFP expressing strain with an in locus replacement of the native SEP5 gene. ( e ) Micrographs showing the appressorial Sep5-Gfp containing septin ring in a strain where SEP5 was replaced by the Sep5-Gfp-encoding gene in locus by RNP-CRISPR-Cas9 co-editing and the corresponding septin ring in the ectopically integrated SEP5-GFP -expressing strain constructed by Dagdas and co-workers 26 . The bar is 5 μm. The linescan graphs show the Sep5-GFP fluorescence in a transverse section of the individual appressoria shown in the micrographs.

    Techniques Used: CRISPR, Introduce, Mutagenesis, Sequencing, Infection, Amplification, Generated, Polymerase Chain Reaction, Expressing, Construct, Fluorescence

    Toxicity of stably expressed Cas9. Binary vectors containing the gene encoding Cas9-NLS under the control of the TrpC promoter and terminator were introduced into Guy 11 using Agrobacterium -mediated transformation. Transformant numbers were assessed after 7 days on selective medium (transformants were subsequently sub-cultured for assessment of pigmentation after growth on CM).
    Figure Legend Snippet: Toxicity of stably expressed Cas9. Binary vectors containing the gene encoding Cas9-NLS under the control of the TrpC promoter and terminator were introduced into Guy 11 using Agrobacterium -mediated transformation. Transformant numbers were assessed after 7 days on selective medium (transformants were subsequently sub-cultured for assessment of pigmentation after growth on CM).

    Techniques Used: Stable Transfection, Transformation Assay, Cell Culture

    Counterselection exploiting the diethofencarb sensitivity of strains expressing E198A beta-tubulin. ( a ) Plates illustrating the negative cross resistance of benomyl resistant transformants to diethofencarb. benR-1, benR-2 and benR-3 are three different benomyl resistant strains generated using RNP-CRISPR while the WT (wild type) is the strain Guy 11 which is benomyl sensitive/diethofencarb resistant control. ( b ) Illustration of the genomic target sequence for the RNP used and the oligonucleotide donors used to make the sequence edit for reversion to a WT TUB2 sequence as well as the donor DNA used for the creation of the benomyl resistant strains shown in a. ( c ) Plates showing the transformation of the benomyl resistant strain number 2 with the TUB2 -targeting RNP-CRISPR-Cas9 and a donor DNA (shown in b) conferring the reversion to the wild type TUB2 sequence and diethofencarb resistance.
    Figure Legend Snippet: Counterselection exploiting the diethofencarb sensitivity of strains expressing E198A beta-tubulin. ( a ) Plates illustrating the negative cross resistance of benomyl resistant transformants to diethofencarb. benR-1, benR-2 and benR-3 are three different benomyl resistant strains generated using RNP-CRISPR while the WT (wild type) is the strain Guy 11 which is benomyl sensitive/diethofencarb resistant control. ( b ) Illustration of the genomic target sequence for the RNP used and the oligonucleotide donors used to make the sequence edit for reversion to a WT TUB2 sequence as well as the donor DNA used for the creation of the benomyl resistant strains shown in a. ( c ) Plates showing the transformation of the benomyl resistant strain number 2 with the TUB2 -targeting RNP-CRISPR-Cas9 and a donor DNA (shown in b) conferring the reversion to the wild type TUB2 sequence and diethofencarb resistance.

    Techniques Used: Expressing, Generated, CRISPR, Sequencing, Transformation Assay

    8) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Macrophage infiltration into tumor spheroids. (A) 7.5 x 10 3 MCF7 cells were seeded in agarose-coated 96-well plates to form three-dimensional spheroids. Picture is representative for 5 days old MCF7 tumor spheroids. (B) 7.5 x 10 4 CD14 + cells were added to 5 days old spheroids. Cellular composition of the spheroids subsequently cultured for 2 days in the absence ( left panel ) or presence ( right panel ) of CD14 + cells was determined by FACS analysis of EpCAM + tumor cells and CD45 + immune cells. Graphs are representative for 3 independent experiments. (C) MΦ infiltration was determined as the proportion of CD45 + cells relative to all cells and is represented as mean ± SEM (n = 3). (D) CFSE-labeled CD14 + cells were added to 5 days old spheroids and co-cultured for 2 days. Infiltration was visualized via fluorescence microscopy.
    Figure Legend Snippet: Macrophage infiltration into tumor spheroids. (A) 7.5 x 10 3 MCF7 cells were seeded in agarose-coated 96-well plates to form three-dimensional spheroids. Picture is representative for 5 days old MCF7 tumor spheroids. (B) 7.5 x 10 4 CD14 + cells were added to 5 days old spheroids. Cellular composition of the spheroids subsequently cultured for 2 days in the absence ( left panel ) or presence ( right panel ) of CD14 + cells was determined by FACS analysis of EpCAM + tumor cells and CD45 + immune cells. Graphs are representative for 3 independent experiments. (C) MΦ infiltration was determined as the proportion of CD45 + cells relative to all cells and is represented as mean ± SEM (n = 3). (D) CFSE-labeled CD14 + cells were added to 5 days old spheroids and co-cultured for 2 days. Infiltration was visualized via fluorescence microscopy.

    Techniques Used: Cell Culture, FACS, Labeling, Fluorescence, Microscopy

    CYP1A1 mRNA stability. MCF7 cells were incubated with supernatants of MCF7 cells or MΦs for 48 hours. De novo mRNA synthesis was blocked by addition of the transcription inhibitor actinomycin D (act D, 4 μg/ml) for the last 2 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . mRNA stability is given as mean expression ± SEM after 2 h act D relative to cells incubated with the respective supernatants without addition of act D (n = 3, * p
    Figure Legend Snippet: CYP1A1 mRNA stability. MCF7 cells were incubated with supernatants of MCF7 cells or MΦs for 48 hours. De novo mRNA synthesis was blocked by addition of the transcription inhibitor actinomycin D (act D, 4 μg/ml) for the last 2 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . mRNA stability is given as mean expression ± SEM after 2 h act D relative to cells incubated with the respective supernatants without addition of act D (n = 3, * p

    Techniques Used: Incubation, Activated Clotting Time Assay, Expressing, Quantitative RT-PCR

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Macrophages suppress CYP1A1 expression in breast tumor cells. (A) MCF7 cells grown as tumor spheroids were cultured for 48 hours in the absence or presence of CD14 + cells. (B) Monolayer MCF7 cells were co-cultured with MΦs. (C-D) Monolayer MCF7 cells were incubated with supernatants of MCF7 cells (Sup MCF7), (C) supernatants of MCF7-MΦ co-cultures (Sup CoCul), or (D) supernatants of MΦs alone (Sup MФ) for 48 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . Data are presented as means ± SEM (n ≥ 3, * p
    Figure Legend Snippet: Macrophages suppress CYP1A1 expression in breast tumor cells. (A) MCF7 cells grown as tumor spheroids were cultured for 48 hours in the absence or presence of CD14 + cells. (B) Monolayer MCF7 cells were co-cultured with MΦs. (C-D) Monolayer MCF7 cells were incubated with supernatants of MCF7 cells (Sup MCF7), (C) supernatants of MCF7-MΦ co-cultures (Sup CoCul), or (D) supernatants of MΦs alone (Sup MФ) for 48 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . Data are presented as means ± SEM (n ≥ 3, * p

    Techniques Used: Expressing, Cell Culture, Incubation, Quantitative RT-PCR

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    9) Product Images from "Chemotherapy drugs derived nanoparticles encapsulating mRNA encoding tumor suppressor proteins to treat triple-negative breast cancer"

    Article Title: Chemotherapy drugs derived nanoparticles encapsulating mRNA encoding tumor suppressor proteins to treat triple-negative breast cancer

    Journal: Nano research

    doi: 10.1007/s12274-019-2308-9

    Formulation optimization of PAL mRNA NPs. (a) Four levels of each mRNA NPs’ components. Highlighted numbers are the molar ratio of the four components in the optimized formulation. (b) PAL, (c) DOPE, (d) Chol, and (e) DMG-PEG 2000 (PEG) are the impact trend of each formulation component on GFP mRNA delivery. (f) Size distribution of the optimized PAL P53 mRNA NPs formulation. (g) Cryo-EM image of the optimized PAL P53 mRNA NPs formulation. Scale bar = 50 nm. (h) Imaging of FLAG tagged P53 protein in vitro . The FLAG tag was stained by anti-FLAG primary antibody and FITC-labeled secondary antibody 6 h after incubation with P53 mRNA NPs. Nucleus was stained by Hoechst 33342. Scale bar = 20 μm.
    Figure Legend Snippet: Formulation optimization of PAL mRNA NPs. (a) Four levels of each mRNA NPs’ components. Highlighted numbers are the molar ratio of the four components in the optimized formulation. (b) PAL, (c) DOPE, (d) Chol, and (e) DMG-PEG 2000 (PEG) are the impact trend of each formulation component on GFP mRNA delivery. (f) Size distribution of the optimized PAL P53 mRNA NPs formulation. (g) Cryo-EM image of the optimized PAL P53 mRNA NPs formulation. Scale bar = 50 nm. (h) Imaging of FLAG tagged P53 protein in vitro . The FLAG tag was stained by anti-FLAG primary antibody and FITC-labeled secondary antibody 6 h after incubation with P53 mRNA NPs. Nucleus was stained by Hoechst 33342. Scale bar = 20 μm.

    Techniques Used: Imaging, In Vitro, FLAG-tag, Staining, Labeling, Incubation

    In vitro cytotoxicity of PAL P53 mRNA NPs. (a) Cytotoxicity of PAL P53 mRNA NPs was determined by the MTT assay. Data were presented as mean ± SD ( n = 3) (Students t -test, ****, p
    Figure Legend Snippet: In vitro cytotoxicity of PAL P53 mRNA NPs. (a) Cytotoxicity of PAL P53 mRNA NPs was determined by the MTT assay. Data were presented as mean ± SD ( n = 3) (Students t -test, ****, p

    Techniques Used: In Vitro, MTT Assay

    In vivo anti-tumor activity of PAL P53 mRNA NPs. (a) Tumor size. Inhibition of tumor growth by i.v. injection of PAL P53 mRNA NPs was significantly stronger than other groups. Data were presented as mean ± SD ( n = 7 or 8) (two-way ANOVA with repeated measurements, ***, p
    Figure Legend Snippet: In vivo anti-tumor activity of PAL P53 mRNA NPs. (a) Tumor size. Inhibition of tumor growth by i.v. injection of PAL P53 mRNA NPs was significantly stronger than other groups. Data were presented as mean ± SD ( n = 7 or 8) (two-way ANOVA with repeated measurements, ***, p

    Techniques Used: In Vivo, Activity Assay, Inhibition, Injection

    10) Product Images from "Evidence for feasibility of fetal trophoblastic cell‐based noninvasive prenatal testing †) Evidence for feasibility of fetal trophoblastic cell‐based noninvasive prenatal testing"

    Article Title: Evidence for feasibility of fetal trophoblastic cell‐based noninvasive prenatal testing †) Evidence for feasibility of fetal trophoblastic cell‐based noninvasive prenatal testing

    Journal: Prenatal Diagnosis

    doi: 10.1002/pd.4924

    Multiple fetal trophoblastic cells isolated from one patient. A. Eight fetal cells (confirmed by STR analysis) from a single patient (subject 365) showing the range of nuclear (DAPI; blue) and cytokeratin (CK; green) staining morphology. B. Two of the fetal cells from subject 365 demonstrating uniform (top right) and fragmented (bottom right) DAPI staining. C. Hemi‐nested Y‐chromosome specific PCR performed on the eight fetal cells isolated from subject 365 (male fetus), showing positive amplification of one or more targeted regions on the Y chromosome (SRY, DYS14, DAZ). Numbers correspond to the number prefix for each individual cell in A. D. Ampli 1 STR analysis comparing WGA product from a single fetal cell (G648, subject 365) and genomic DNA from each parent. The three loci shown here demonstrate the expected paternal inheritance (arrows) from the Y chromosome (SRY; left panel) and bi‐parental inheritance from chromosomes 5 (D5S818; center panel) and 18 (D18S535; right panel)
    Figure Legend Snippet: Multiple fetal trophoblastic cells isolated from one patient. A. Eight fetal cells (confirmed by STR analysis) from a single patient (subject 365) showing the range of nuclear (DAPI; blue) and cytokeratin (CK; green) staining morphology. B. Two of the fetal cells from subject 365 demonstrating uniform (top right) and fragmented (bottom right) DAPI staining. C. Hemi‐nested Y‐chromosome specific PCR performed on the eight fetal cells isolated from subject 365 (male fetus), showing positive amplification of one or more targeted regions on the Y chromosome (SRY, DYS14, DAZ). Numbers correspond to the number prefix for each individual cell in A. D. Ampli 1 STR analysis comparing WGA product from a single fetal cell (G648, subject 365) and genomic DNA from each parent. The three loci shown here demonstrate the expected paternal inheritance (arrows) from the Y chromosome (SRY; left panel) and bi‐parental inheritance from chromosomes 5 (D5S818; center panel) and 18 (D18S535; right panel)

    Techniques Used: Isolation, Staining, Polymerase Chain Reaction, Amplification, Whole Genome Amplification

    11) Product Images from "Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae"

    Article Title: Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002965

    PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.
    Figure Legend Snippet: PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Selection, Sequencing, Generated, Electrophoretic Mobility Shift Assay

    12) Product Images from "Base modifications affecting RNA polymerase and reverse transcriptase fidelity"

    Article Title: Base modifications affecting RNA polymerase and reverse transcriptase fidelity

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky341

    Measuring combined transcription and reverse transcription fidelity with PacBio sequencing. ( A ) Workflow. DNA templates are transcribed by T7 RNA polymerase with unmodified and modified NTPs to produce RNA. RNA is replicated by a reverse transcriptase to produce cDNA, then the first strand is replicated by the same reverse transcriptase to produce double-stranded DNA, which is then prepared for sequencing by ligating SMRTbell adaptors. ( B ) Identical first strand errors can arise by misincorporation from either the RNA polymerase or the reverse transcriptase (error types 1 and 2 in the figure, respectively). Only first strand errors confirmed in the second strand are counted. Second strand errors produce a mismatch between the first and second strand and represent misincorporation by the reverse transcriptase on DNA templates (error type 3 in the figure). ( C ) Substitution errors arising from misincorporation events. The first base is the expected, while the second is the observed base.
    Figure Legend Snippet: Measuring combined transcription and reverse transcription fidelity with PacBio sequencing. ( A ) Workflow. DNA templates are transcribed by T7 RNA polymerase with unmodified and modified NTPs to produce RNA. RNA is replicated by a reverse transcriptase to produce cDNA, then the first strand is replicated by the same reverse transcriptase to produce double-stranded DNA, which is then prepared for sequencing by ligating SMRTbell adaptors. ( B ) Identical first strand errors can arise by misincorporation from either the RNA polymerase or the reverse transcriptase (error types 1 and 2 in the figure, respectively). Only first strand errors confirmed in the second strand are counted. Second strand errors produce a mismatch between the first and second strand and represent misincorporation by the reverse transcriptase on DNA templates (error type 3 in the figure). ( C ) Substitution errors arising from misincorporation events. The first base is the expected, while the second is the observed base.

    Techniques Used: Sequencing, Modification

    First strand (cDNA) synthesis error rates and error spectrum for unmodified and modified RNA. The RNA template is synthesized by T7 RNA polymerase, and then reverse transcribed by the reverse transcriptases shown in the figure. For comparison, also shown are the first strand error rate of Bst 2.0 and 3.0 DNA polymerases, DNA polymerases which can be used to reverse transcribe RNA. Polymerase substitution errors are written as the equivalent RNA polymerase substitution (top substitution; RNAP in the figure) or reverse transcriptase substitution (bottom substitution; RT in the figure).
    Figure Legend Snippet: First strand (cDNA) synthesis error rates and error spectrum for unmodified and modified RNA. The RNA template is synthesized by T7 RNA polymerase, and then reverse transcribed by the reverse transcriptases shown in the figure. For comparison, also shown are the first strand error rate of Bst 2.0 and 3.0 DNA polymerases, DNA polymerases which can be used to reverse transcribe RNA. Polymerase substitution errors are written as the equivalent RNA polymerase substitution (top substitution; RNAP in the figure) or reverse transcriptase substitution (bottom substitution; RT in the figure).

    Techniques Used: Modification, Synthesized

    13) Product Images from "Base modifications affecting RNA polymerase and reverse transcriptase fidelity"

    Article Title: Base modifications affecting RNA polymerase and reverse transcriptase fidelity

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gky341

    Measuring combined transcription and reverse transcription fidelity with PacBio sequencing. ( A ) Workflow. DNA templates are transcribed by T7 RNA polymerase with unmodified and modified NTPs to produce RNA. RNA is replicated by a reverse transcriptase to produce cDNA, then the first strand is replicated by the same reverse transcriptase to produce double-stranded DNA, which is then prepared for sequencing by ligating SMRTbell adaptors. ( B ) Identical first strand errors can arise by misincorporation from either the RNA polymerase or the reverse transcriptase (error types 1 and 2 in the figure, respectively). Only first strand errors confirmed in the second strand are counted. Second strand errors produce a mismatch between the first and second strand and represent misincorporation by the reverse transcriptase on DNA templates (error type 3 in the figure). ( C ) Substitution errors arising from misincorporation events. The first base is the expected, while the second is the observed base.
    Figure Legend Snippet: Measuring combined transcription and reverse transcription fidelity with PacBio sequencing. ( A ) Workflow. DNA templates are transcribed by T7 RNA polymerase with unmodified and modified NTPs to produce RNA. RNA is replicated by a reverse transcriptase to produce cDNA, then the first strand is replicated by the same reverse transcriptase to produce double-stranded DNA, which is then prepared for sequencing by ligating SMRTbell adaptors. ( B ) Identical first strand errors can arise by misincorporation from either the RNA polymerase or the reverse transcriptase (error types 1 and 2 in the figure, respectively). Only first strand errors confirmed in the second strand are counted. Second strand errors produce a mismatch between the first and second strand and represent misincorporation by the reverse transcriptase on DNA templates (error type 3 in the figure). ( C ) Substitution errors arising from misincorporation events. The first base is the expected, while the second is the observed base.

    Techniques Used: Sequencing, Modification

    14) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    15) Product Images from "YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA"

    Article Title: YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA

    Journal: Cell Research

    doi: 10.1038/cr.2017.15

    YTHDF3 promotes translation efficiency of its mRNA targets and facilitates the function of YTHDF1. (A - B , D) Cumulative distribution of log 2 -fold changes of translation efficiency (ratio between ribosome-bound fragments and input RNA) between siControl and siYTHDF3, biological replicate 1 (A) , siYTHDF3, biological replicate 2 (B) , and siMETTL3 (D) . Three groups of genes were plotted: non-targets (neither targets of YTHDF1 nor targets of YTHDF3, black), YTHDF3 CLIP+IP (high-confidence YTHDF3 targets, red), and YTHDF1 unique (YTHDF1 targets that are not targets of YTHDF3, blue). Number of genes in each group was indicated in parentheses. P values were calculated from a two-sided Mann-Whitney test compared to non-targets. (C) Redistribution of representative targets in non-ribosome and polysome portions of mRNPs upon depletion of YTHDF3 measured by RT-qPCR. APC , a YTHDF3 target; TSC1 and DST , YTHDF1 unique targets; and RPL30 , a non-target. Error bars, mean ± sd, n = 2, technical replicates. (E) Construct of the double tethering assay. A sequence of two BoxB followed by two MS2 stem loops was inserted at the 3′UTR of F-Luc (firefly luciferase) mRNA. The C-terminal YTH domains of YTHDF1 and YTHDF3 were respectively replaced with λ peptide (binding BoxB motif) and MS2 binding protein (binding MS2 motif). R-Luc (renilla luciferase) mRNA was used as an internal control for normalizing luciferase signals from different samples. (F) Translation efficiency of F-Luc normalized with R-Luc 4-hour post F-Luc induction, with the expression of effectors indicated at x-axis. The ratio between YTHDF1N-λ (yellow) and the corresponding control sample (grey) was calculated. Error bars, mean ± sd, n = 3. P = 0.05 (paired two-sided Student's t -test).
    Figure Legend Snippet: YTHDF3 promotes translation efficiency of its mRNA targets and facilitates the function of YTHDF1. (A - B , D) Cumulative distribution of log 2 -fold changes of translation efficiency (ratio between ribosome-bound fragments and input RNA) between siControl and siYTHDF3, biological replicate 1 (A) , siYTHDF3, biological replicate 2 (B) , and siMETTL3 (D) . Three groups of genes were plotted: non-targets (neither targets of YTHDF1 nor targets of YTHDF3, black), YTHDF3 CLIP+IP (high-confidence YTHDF3 targets, red), and YTHDF1 unique (YTHDF1 targets that are not targets of YTHDF3, blue). Number of genes in each group was indicated in parentheses. P values were calculated from a two-sided Mann-Whitney test compared to non-targets. (C) Redistribution of representative targets in non-ribosome and polysome portions of mRNPs upon depletion of YTHDF3 measured by RT-qPCR. APC , a YTHDF3 target; TSC1 and DST , YTHDF1 unique targets; and RPL30 , a non-target. Error bars, mean ± sd, n = 2, technical replicates. (E) Construct of the double tethering assay. A sequence of two BoxB followed by two MS2 stem loops was inserted at the 3′UTR of F-Luc (firefly luciferase) mRNA. The C-terminal YTH domains of YTHDF1 and YTHDF3 were respectively replaced with λ peptide (binding BoxB motif) and MS2 binding protein (binding MS2 motif). R-Luc (renilla luciferase) mRNA was used as an internal control for normalizing luciferase signals from different samples. (F) Translation efficiency of F-Luc normalized with R-Luc 4-hour post F-Luc induction, with the expression of effectors indicated at x-axis. The ratio between YTHDF1N-λ (yellow) and the corresponding control sample (grey) was calculated. Error bars, mean ± sd, n = 3. P = 0.05 (paired two-sided Student's t -test).

    Techniques Used: Cross-linking Immunoprecipitation, MANN-WHITNEY, Quantitative RT-PCR, Construct, Sequencing, Luciferase, Binding Assay, Protein Binding, Expressing

    16) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Macrophage infiltration into tumor spheroids. (A) 7.5 x 10 3 MCF7 cells were seeded in agarose-coated 96-well plates to form three-dimensional spheroids. Picture is representative for 5 days old MCF7 tumor spheroids. (B) 7.5 x 10 4 CD14 + cells were added to 5 days old spheroids. Cellular composition of the spheroids subsequently cultured for 2 days in the absence ( left panel ) or presence ( right panel ) of CD14 + cells was determined by FACS analysis of EpCAM + tumor cells and CD45 + immune cells. Graphs are representative for 3 independent experiments. (C) MΦ infiltration was determined as the proportion of CD45 + cells relative to all cells and is represented as mean ± SEM (n = 3). (D) CFSE-labeled CD14 + cells were added to 5 days old spheroids and co-cultured for 2 days. Infiltration was visualized via fluorescence microscopy.
    Figure Legend Snippet: Macrophage infiltration into tumor spheroids. (A) 7.5 x 10 3 MCF7 cells were seeded in agarose-coated 96-well plates to form three-dimensional spheroids. Picture is representative for 5 days old MCF7 tumor spheroids. (B) 7.5 x 10 4 CD14 + cells were added to 5 days old spheroids. Cellular composition of the spheroids subsequently cultured for 2 days in the absence ( left panel ) or presence ( right panel ) of CD14 + cells was determined by FACS analysis of EpCAM + tumor cells and CD45 + immune cells. Graphs are representative for 3 independent experiments. (C) MΦ infiltration was determined as the proportion of CD45 + cells relative to all cells and is represented as mean ± SEM (n = 3). (D) CFSE-labeled CD14 + cells were added to 5 days old spheroids and co-cultured for 2 days. Infiltration was visualized via fluorescence microscopy.

    Techniques Used: Cell Culture, FACS, Labeling, Fluorescence, Microscopy

    CYP1A1 mRNA stability. MCF7 cells were incubated with supernatants of MCF7 cells or MΦs for 48 hours. De novo mRNA synthesis was blocked by addition of the transcription inhibitor actinomycin D (act D, 4 μg/ml) for the last 2 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . mRNA stability is given as mean expression ± SEM after 2 h act D relative to cells incubated with the respective supernatants without addition of act D (n = 3, * p
    Figure Legend Snippet: CYP1A1 mRNA stability. MCF7 cells were incubated with supernatants of MCF7 cells or MΦs for 48 hours. De novo mRNA synthesis was blocked by addition of the transcription inhibitor actinomycin D (act D, 4 μg/ml) for the last 2 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . mRNA stability is given as mean expression ± SEM after 2 h act D relative to cells incubated with the respective supernatants without addition of act D (n = 3, * p

    Techniques Used: Incubation, Activated Clotting Time Assay, Expressing, Quantitative RT-PCR

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Macrophages suppress CYP1A1 expression in breast tumor cells. (A) MCF7 cells grown as tumor spheroids were cultured for 48 hours in the absence or presence of CD14 + cells. (B) Monolayer MCF7 cells were co-cultured with MΦs. (C-D) Monolayer MCF7 cells were incubated with supernatants of MCF7 cells (Sup MCF7), (C) supernatants of MCF7-MΦ co-cultures (Sup CoCul), or (D) supernatants of MΦs alone (Sup MФ) for 48 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . Data are presented as means ± SEM (n ≥ 3, * p
    Figure Legend Snippet: Macrophages suppress CYP1A1 expression in breast tumor cells. (A) MCF7 cells grown as tumor spheroids were cultured for 48 hours in the absence or presence of CD14 + cells. (B) Monolayer MCF7 cells were co-cultured with MΦs. (C-D) Monolayer MCF7 cells were incubated with supernatants of MCF7 cells (Sup MCF7), (C) supernatants of MCF7-MΦ co-cultures (Sup CoCul), or (D) supernatants of MΦs alone (Sup MФ) for 48 hours. CYP1A1 mRNA expression was determined by RT-qPCR analysis and normalized to ACTB . Data are presented as means ± SEM (n ≥ 3, * p

    Techniques Used: Expressing, Cell Culture, Incubation, Quantitative RT-PCR

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    17) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    18) Product Images from "Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications"

    Article Title: Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150705

    Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value
    Figure Legend Snippet: Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value

    Techniques Used: Expressing, RNA Sequencing Assay, Microarray, Transformation Assay, Mouse Assay, Transgenic Assay

    19) Product Images from "Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae"

    Article Title: Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002965

    PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.
    Figure Legend Snippet: PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Selection, Sequencing, Generated, Electrophoretic Mobility Shift Assay

    20) Product Images from "Rapid identification and recovery of ENU-induced mutations with next-generation sequencing and Paired-End Low-Error analysis"

    Article Title: Rapid identification and recovery of ENU-induced mutations with next-generation sequencing and Paired-End Low-Error analysis

    Journal: BMC Genomics

    doi: 10.1186/s12864-015-1263-4

    NGS-TILLING process. A : A long-term resource for many TILLING screens consisting of a genomic DNA sample and a corresponding cryopreserved sperm sample was prepared from 9,024 F1 ENU-mutagenized male zebrafish. B : Library Pooling. Normalized genomic DNA (gDNA) was pooled twice: first, gDNA from 6 fish was pooled together to make 1,504 6-fish pools in 16 96-well plates. These six-fish pools will be used for HRM identification of carrier fish (step F ). Second, groups of 48 6-fish pools were pooled together into 288-fish pools (a total of 32 288-fish pools). C : Target Preparation. gDNA from 288-fish pools was used as a template for PCR amplification of ~250 bp fragments corresponding to exons of genes of interest using gene-specific primers with P5/P7 SEQ tails (green). After normalization, amplicons from each 288-fish pool were combined and used as template for a brief second PCR that added Nextera index sequences (blue) and Illumina P5/P7 sequences (yellow). D : Sequencing: All amplicons from the entire library were combined and sequenced (Illumina MiSeq platform), generating fully overlapping 250 bp paired-end sequences. E : Data Analysis. Sequence analysis using PELE and PoDATA identified rare deleterious variants (occurring in 1/100 to 1/1000 reads) in single 288-fish pools. F : Deconvolution. A fragment centered on a putative variant call was amplified from each of the 48-six-fish pools used to make up the 288-fish pool in which that variant was detected, and was subjected to High Resolution Melt (HRM) Analysis. Then HRM of the six individual fish in the six-fish pool that showed distinct melting kinetics identified the individual carrier. G : Mutant Recovery. Finally, the presence of the variant identified by PELE and PoDATA was confirmed in that fish by Sanger sequencing. F2 heterozygotes were generated by in vitro fertilization of WT eggs with the corresponding cryopreserved sperm sample.
    Figure Legend Snippet: NGS-TILLING process. A : A long-term resource for many TILLING screens consisting of a genomic DNA sample and a corresponding cryopreserved sperm sample was prepared from 9,024 F1 ENU-mutagenized male zebrafish. B : Library Pooling. Normalized genomic DNA (gDNA) was pooled twice: first, gDNA from 6 fish was pooled together to make 1,504 6-fish pools in 16 96-well plates. These six-fish pools will be used for HRM identification of carrier fish (step F ). Second, groups of 48 6-fish pools were pooled together into 288-fish pools (a total of 32 288-fish pools). C : Target Preparation. gDNA from 288-fish pools was used as a template for PCR amplification of ~250 bp fragments corresponding to exons of genes of interest using gene-specific primers with P5/P7 SEQ tails (green). After normalization, amplicons from each 288-fish pool were combined and used as template for a brief second PCR that added Nextera index sequences (blue) and Illumina P5/P7 sequences (yellow). D : Sequencing: All amplicons from the entire library were combined and sequenced (Illumina MiSeq platform), generating fully overlapping 250 bp paired-end sequences. E : Data Analysis. Sequence analysis using PELE and PoDATA identified rare deleterious variants (occurring in 1/100 to 1/1000 reads) in single 288-fish pools. F : Deconvolution. A fragment centered on a putative variant call was amplified from each of the 48-six-fish pools used to make up the 288-fish pool in which that variant was detected, and was subjected to High Resolution Melt (HRM) Analysis. Then HRM of the six individual fish in the six-fish pool that showed distinct melting kinetics identified the individual carrier. G : Mutant Recovery. Finally, the presence of the variant identified by PELE and PoDATA was confirmed in that fish by Sanger sequencing. F2 heterozygotes were generated by in vitro fertilization of WT eggs with the corresponding cryopreserved sperm sample.

    Techniques Used: Next-Generation Sequencing, Fluorescence In Situ Hybridization, Polymerase Chain Reaction, Amplification, Sequencing, Variant Assay, Mutagenesis, Generated, In Vitro

    21) Product Images from "YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA"

    Article Title: YTHDF3 facilitates translation and decay of N6-methyladenosine-modified RNA

    Journal: Cell Research

    doi: 10.1038/cr.2017.15

    YTHDF3 promotes translation efficiency of its mRNA targets and facilitates the function of YTHDF1. (A - B , D) Cumulative distribution of log 2 -fold changes of translation efficiency (ratio between ribosome-bound fragments and input RNA) between siControl and siYTHDF3, biological replicate 1 (A) , siYTHDF3, biological replicate 2 (B) , and siMETTL3 (D) . Three groups of genes were plotted: non-targets (neither targets of YTHDF1 nor targets of YTHDF3, black), YTHDF3 CLIP+IP (high-confidence YTHDF3 targets, red), and YTHDF1 unique (YTHDF1 targets that are not targets of YTHDF3, blue). Number of genes in each group was indicated in parentheses. P values were calculated from a two-sided Mann-Whitney test compared to non-targets. (C) Redistribution of representative targets in non-ribosome and polysome portions of mRNPs upon depletion of YTHDF3 measured by RT-qPCR. APC , a YTHDF3 target; TSC1 and DST , YTHDF1 unique targets; and RPL30 , a non-target. Error bars, mean ± sd, n = 2, technical replicates. (E) Construct of the double tethering assay. A sequence of two BoxB followed by two MS2 stem loops was inserted at the 3′UTR of F-Luc (firefly luciferase) mRNA. The C-terminal YTH domains of YTHDF1 and YTHDF3 were respectively replaced with λ peptide (binding BoxB motif) and MS2 binding protein (binding MS2 motif). R-Luc (renilla luciferase) mRNA was used as an internal control for normalizing luciferase signals from different samples. (F) Translation efficiency of F-Luc normalized with R-Luc 4-hour post F-Luc induction, with the expression of effectors indicated at x-axis. The ratio between YTHDF1N-λ (yellow) and the corresponding control sample (grey) was calculated. Error bars, mean ± sd, n = 3. P = 0.05 (paired two-sided Student's t -test).
    Figure Legend Snippet: YTHDF3 promotes translation efficiency of its mRNA targets and facilitates the function of YTHDF1. (A - B , D) Cumulative distribution of log 2 -fold changes of translation efficiency (ratio between ribosome-bound fragments and input RNA) between siControl and siYTHDF3, biological replicate 1 (A) , siYTHDF3, biological replicate 2 (B) , and siMETTL3 (D) . Three groups of genes were plotted: non-targets (neither targets of YTHDF1 nor targets of YTHDF3, black), YTHDF3 CLIP+IP (high-confidence YTHDF3 targets, red), and YTHDF1 unique (YTHDF1 targets that are not targets of YTHDF3, blue). Number of genes in each group was indicated in parentheses. P values were calculated from a two-sided Mann-Whitney test compared to non-targets. (C) Redistribution of representative targets in non-ribosome and polysome portions of mRNPs upon depletion of YTHDF3 measured by RT-qPCR. APC , a YTHDF3 target; TSC1 and DST , YTHDF1 unique targets; and RPL30 , a non-target. Error bars, mean ± sd, n = 2, technical replicates. (E) Construct of the double tethering assay. A sequence of two BoxB followed by two MS2 stem loops was inserted at the 3′UTR of F-Luc (firefly luciferase) mRNA. The C-terminal YTH domains of YTHDF1 and YTHDF3 were respectively replaced with λ peptide (binding BoxB motif) and MS2 binding protein (binding MS2 motif). R-Luc (renilla luciferase) mRNA was used as an internal control for normalizing luciferase signals from different samples. (F) Translation efficiency of F-Luc normalized with R-Luc 4-hour post F-Luc induction, with the expression of effectors indicated at x-axis. The ratio between YTHDF1N-λ (yellow) and the corresponding control sample (grey) was calculated. Error bars, mean ± sd, n = 3. P = 0.05 (paired two-sided Student's t -test).

    Techniques Used: Cross-linking Immunoprecipitation, MANN-WHITNEY, Quantitative RT-PCR, Construct, Sequencing, Luciferase, Binding Assay, Protein Binding, Expressing

    22) Product Images from "Chromatin accessibility identifies diversity in mesenchymal stem cells from different tissue origins"

    Article Title: Chromatin accessibility identifies diversity in mesenchymal stem cells from different tissue origins

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-36057-0

    Chromatin accessibility analysis of the mesenchymal stem cells (MSCs) with different tissue origins. ( a ) Principle component analysis using assay for transposase-accessible chromatin using sequencing (ATAC-seq) data from MSCs. Each dot represents the chromatin accessibility profile of a biological replicate. ( b ) Pearson correlation of ATAC-seq data. ( c ) Dendrogram from unsupervised clustering using ATAC-seq data. The height indicates the distance between clusters. ( d ) Clustering using peaks that were dynamically accessible among cells. The variation in chromatin accessibility was assessed by cisTopic. ( e ) Pathway analysis of the differentially accessible regions using Ingenuity Pathway Analysis (IPA). The peaks in each topic that were differentially accessible among the mesenchymal stem cells (MSCs) were assigned to the nearest genes. The resulting gene list was analysed by IPA. The top five canonical pathways identified are shown.
    Figure Legend Snippet: Chromatin accessibility analysis of the mesenchymal stem cells (MSCs) with different tissue origins. ( a ) Principle component analysis using assay for transposase-accessible chromatin using sequencing (ATAC-seq) data from MSCs. Each dot represents the chromatin accessibility profile of a biological replicate. ( b ) Pearson correlation of ATAC-seq data. ( c ) Dendrogram from unsupervised clustering using ATAC-seq data. The height indicates the distance between clusters. ( d ) Clustering using peaks that were dynamically accessible among cells. The variation in chromatin accessibility was assessed by cisTopic. ( e ) Pathway analysis of the differentially accessible regions using Ingenuity Pathway Analysis (IPA). The peaks in each topic that were differentially accessible among the mesenchymal stem cells (MSCs) were assigned to the nearest genes. The resulting gene list was analysed by IPA. The top five canonical pathways identified are shown.

    Techniques Used: Sequencing, Indirect Immunoperoxidase Assay

    23) Product Images from "Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation"

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0209694

    Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p
    Figure Legend Snippet: Functional impact of macrophages on breast tumor cells. (A) Enriched biological processes as determined by GO term analysis of the RNA seq data from MΦ-infiltrated and non-infiltrated tumor spheroids. (B) 1 x 10 4 MCF7 cells were seeded in a 96-well plate and incubated with supernatants from MCF7 cells or MΦs. Proliferation was assessed using an IncuCyte S3 system and is presented as relative increase in confluency. Data are presented as means ± SEM (n > 3, * p

    Techniques Used: Functional Assay, RNA Sequencing Assay, Incubation

    Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.
    Figure Legend Snippet: Tumor cell-specific gene expression changes after macrophage infiltration. (A) Schematic overview of the experimental setup of tumor cell isolation for RNA seq. (B) Purity of tumor cells after removal of CD14 + cells from dissociated tumor spheroids was determined by FACS analysis of tumor cells (EpCAM + ) and immune cells (CD45 + ). Graph is representative of 3 independent experiments. The proportion of immune cells (CD45 + ) was quantified relative to all cells and is given as mean ± SEM (n = 3). (C) Top differentially expressed genes identified by RNA seq analysis of tumor cells from infiltrated relative to non-infiltrated MCF7 tumor spheroids.

    Techniques Used: Expressing, Cell Isolation, RNA Sequencing Assay, FACS

    24) Product Images from "Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications"

    Article Title: Changes in the miRNA-mRNA Regulatory Network Precede Motor Symptoms in a Mouse Model of Multiple System Atrophy: Clinical Implications

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0150705

    Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value
    Figure Legend Snippet: Differential expression of mRNAs in a mouse model of pre-motor stage MSA. (A) Heatmaps represent significantly differentially expressed genes of RNA-seq (striatum, SN) and microarray (SN) analyses. For each gene (row), the log2-transformed change of the expression value in each sample to the average expression value over all samples is shown. Columns represent individual replicates grouped into MSA and control (WT) samples indicated by the blue (MSA) and grey (WT) bars at the top of the heatmaps. The color gradient indicates the expression change from negative to positive. The asterisks following gene names indicate overlapping genes between microarray and RNA-seq analyses in SN. (B) Venn diagram illustrating the number of overlapping differentially expressed mRNAs between SN and striatum tissue in MSA mice. (C) Heatmap highlights log 2 -transformed fold changes of mRNAs overlapping between striatum und SN. Down-regulated mRNAs are indicated by a blue color gradient, whereas up-regulated miRNAs are indicated by an orange color gradient. mRNA with expression signals below background in the microarray experiment are highlighted in gray. From left to right, microarray and RNA-seq analysis results of SN and RNA-seq analysis of striatum are shown. Differential expression analysis of control versus transgenic MSA mice of both, striatum and SN samples, was performed by employing the DESeq2 package with predefined parameters [ 37 ]. Genes with an adjusted p-value below 0.1 after multiple testing corrections were considered statistically significant [ 38 ]. For microarray data differential gene expression was tested by a moderated t-test using the limma package [ 39 ]. For both methods genes with an adjusted p-value

    Techniques Used: Expressing, RNA Sequencing Assay, Microarray, Transformation Assay, Mouse Assay, Transgenic Assay

    25) Product Images from "Chemotherapy drugs derived nanoparticles encapsulating mRNA encoding tumor suppressor proteins to treat triple-negative breast cancer"

    Article Title: Chemotherapy drugs derived nanoparticles encapsulating mRNA encoding tumor suppressor proteins to treat triple-negative breast cancer

    Journal: Nano research

    doi: 10.1007/s12274-019-2308-9

    Formulation optimization of PAL mRNA NPs. (a) Four levels of each mRNA NPs’ components. Highlighted numbers are the molar ratio of the four components in the optimized formulation. (b) PAL, (c) DOPE, (d) Chol, and (e) DMG-PEG 2000 (PEG) are the impact trend of each formulation component on GFP mRNA delivery. (f) Size distribution of the optimized PAL P53 mRNA NPs formulation. (g) Cryo-EM image of the optimized PAL P53 mRNA NPs formulation. Scale bar = 50 nm. (h) Imaging of FLAG tagged P53 protein in vitro . The FLAG tag was stained by anti-FLAG primary antibody and FITC-labeled secondary antibody 6 h after incubation with P53 mRNA NPs. Nucleus was stained by Hoechst 33342. Scale bar = 20 μm.
    Figure Legend Snippet: Formulation optimization of PAL mRNA NPs. (a) Four levels of each mRNA NPs’ components. Highlighted numbers are the molar ratio of the four components in the optimized formulation. (b) PAL, (c) DOPE, (d) Chol, and (e) DMG-PEG 2000 (PEG) are the impact trend of each formulation component on GFP mRNA delivery. (f) Size distribution of the optimized PAL P53 mRNA NPs formulation. (g) Cryo-EM image of the optimized PAL P53 mRNA NPs formulation. Scale bar = 50 nm. (h) Imaging of FLAG tagged P53 protein in vitro . The FLAG tag was stained by anti-FLAG primary antibody and FITC-labeled secondary antibody 6 h after incubation with P53 mRNA NPs. Nucleus was stained by Hoechst 33342. Scale bar = 20 μm.

    Techniques Used: Imaging, In Vitro, FLAG-tag, Staining, Labeling, Incubation

    In vitro cytotoxicity of PAL P53 mRNA NPs. (a) Cytotoxicity of PAL P53 mRNA NPs was determined by the MTT assay. Data were presented as mean ± SD ( n = 3) (Students t -test, ****, p
    Figure Legend Snippet: In vitro cytotoxicity of PAL P53 mRNA NPs. (a) Cytotoxicity of PAL P53 mRNA NPs was determined by the MTT assay. Data were presented as mean ± SD ( n = 3) (Students t -test, ****, p

    Techniques Used: In Vitro, MTT Assay

    In vivo anti-tumor activity of PAL P53 mRNA NPs. (a) Tumor size. Inhibition of tumor growth by i.v. injection of PAL P53 mRNA NPs was significantly stronger than other groups. Data were presented as mean ± SD ( n = 7 or 8) (two-way ANOVA with repeated measurements, ***, p
    Figure Legend Snippet: In vivo anti-tumor activity of PAL P53 mRNA NPs. (a) Tumor size. Inhibition of tumor growth by i.v. injection of PAL P53 mRNA NPs was significantly stronger than other groups. Data were presented as mean ± SD ( n = 7 or 8) (two-way ANOVA with repeated measurements, ***, p

    Techniques Used: In Vivo, Activity Assay, Inhibition, Injection

    26) Product Images from "Chromatin accessibility identifies diversity in mesenchymal stem cells from different tissue origins"

    Article Title: Chromatin accessibility identifies diversity in mesenchymal stem cells from different tissue origins

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-36057-0

    Chromatin accessibility analysis of the mesenchymal stem cells (MSCs) with different tissue origins. ( a ) Principle component analysis using assay for transposase-accessible chromatin using sequencing (ATAC-seq) data from MSCs. Each dot represents the chromatin accessibility profile of a biological replicate. ( b ) Pearson correlation of ATAC-seq data. ( c ) Dendrogram from unsupervised clustering using ATAC-seq data. The height indicates the distance between clusters. ( d ) Clustering using peaks that were dynamically accessible among cells. The variation in chromatin accessibility was assessed by cisTopic. ( e ) Pathway analysis of the differentially accessible regions using Ingenuity Pathway Analysis (IPA). The peaks in each topic that were differentially accessible among the mesenchymal stem cells (MSCs) were assigned to the nearest genes. The resulting gene list was analysed by IPA. The top five canonical pathways identified are shown.
    Figure Legend Snippet: Chromatin accessibility analysis of the mesenchymal stem cells (MSCs) with different tissue origins. ( a ) Principle component analysis using assay for transposase-accessible chromatin using sequencing (ATAC-seq) data from MSCs. Each dot represents the chromatin accessibility profile of a biological replicate. ( b ) Pearson correlation of ATAC-seq data. ( c ) Dendrogram from unsupervised clustering using ATAC-seq data. The height indicates the distance between clusters. ( d ) Clustering using peaks that were dynamically accessible among cells. The variation in chromatin accessibility was assessed by cisTopic. ( e ) Pathway analysis of the differentially accessible regions using Ingenuity Pathway Analysis (IPA). The peaks in each topic that were differentially accessible among the mesenchymal stem cells (MSCs) were assigned to the nearest genes. The resulting gene list was analysed by IPA. The top five canonical pathways identified are shown.

    Techniques Used: Sequencing, Indirect Immunoperoxidase Assay

    27) Product Images from "High density Huh7.5 cell hollow fiber bioreactor culture for high-yield production of hepatitis C virus and studies of antivirals"

    Article Title: High density Huh7.5 cell hollow fiber bioreactor culture for high-yield production of hepatitis C virus and studies of antivirals

    Journal: Scientific Reports

    doi: 10.1038/s41598-018-35010-5

    Induction of HCV escape from a direct acting antiviral in HFBR. ( a ) Timeline of Huh7.5 cell cultivation in DMEM + 10%FBS and serum-free AEM, indicating infection with HCV and initiation of treatment with different concentrations of the NS5A inhibitor daclatasvir (DCV). HCV from HFBR harvests (1000 μL, 50 μL or 5 μL) were used for infection of 10 6 Huh7.5 cells plated the previous day in T25 cell culture flasks (derived cultures). Peak infectivity titers in derived cultures are reported. Amino acid at NS5A position 93 according to the H77 reference sequence (GenBank accession no AF009606) was determined by Sanger sequencing for selected harvests and derived cultures. *, H at position 93 was present in ~50% of viral genomes. ( b ) 8 × 10 7 Huh7.5 cells were seeded in a hollow fiber bioreactor in DMEM + 10% FBS and infected with 1.25 × 10 6 FFU of HCV third passage stock on day 5 post cell seeding, when glucose consumption was 590 mg/day (arrow). At day 9 post cell seeding DMEM was replaced with serum-free AEM. Treatment with daclatasvir at 7.8 nM (corresponding to 64 x EC50 29 ) was initiated at day 27 post cell seeding; at day 45 the concentration was increased to 124.2 nM (corresponding to 1024 x EC50). On day 59 the treatment was terminated. ( c and d ) Determination of HCV infectivity titers and HCV RNA titers were carried out as described in Fig. 2 . *, indicates HCV infectivity titers below assay detection level. ( e ) HCV from harvest 9, 12 and 16 were loaded on 10–40% iodixanol gradients. Following ultracentrifugation 18 fractions were collected as in Fig. 5 . HCV infectivity and HCV RNA titers of each fraction were determined as described for Fig. 2 . ( f ) RNA extracted from harvest 9, 12 and 14 at 1-, 10-, 100- and 1000-fold dilution was used for RT-PCR for generation of a full-length amplicon spanning the complete HCV ORF. PCR products were visualized on a 1% agarose gel including a 1 kb DNA ladder; expected positions of full-length amplicons are indicated by arrows. Gel image was cropped as indicated by boxes; full-length gel is presented in Supplementary Fig. S4 .
    Figure Legend Snippet: Induction of HCV escape from a direct acting antiviral in HFBR. ( a ) Timeline of Huh7.5 cell cultivation in DMEM + 10%FBS and serum-free AEM, indicating infection with HCV and initiation of treatment with different concentrations of the NS5A inhibitor daclatasvir (DCV). HCV from HFBR harvests (1000 μL, 50 μL or 5 μL) were used for infection of 10 6 Huh7.5 cells plated the previous day in T25 cell culture flasks (derived cultures). Peak infectivity titers in derived cultures are reported. Amino acid at NS5A position 93 according to the H77 reference sequence (GenBank accession no AF009606) was determined by Sanger sequencing for selected harvests and derived cultures. *, H at position 93 was present in ~50% of viral genomes. ( b ) 8 × 10 7 Huh7.5 cells were seeded in a hollow fiber bioreactor in DMEM + 10% FBS and infected with 1.25 × 10 6 FFU of HCV third passage stock on day 5 post cell seeding, when glucose consumption was 590 mg/day (arrow). At day 9 post cell seeding DMEM was replaced with serum-free AEM. Treatment with daclatasvir at 7.8 nM (corresponding to 64 x EC50 29 ) was initiated at day 27 post cell seeding; at day 45 the concentration was increased to 124.2 nM (corresponding to 1024 x EC50). On day 59 the treatment was terminated. ( c and d ) Determination of HCV infectivity titers and HCV RNA titers were carried out as described in Fig. 2 . *, indicates HCV infectivity titers below assay detection level. ( e ) HCV from harvest 9, 12 and 16 were loaded on 10–40% iodixanol gradients. Following ultracentrifugation 18 fractions were collected as in Fig. 5 . HCV infectivity and HCV RNA titers of each fraction were determined as described for Fig. 2 . ( f ) RNA extracted from harvest 9, 12 and 14 at 1-, 10-, 100- and 1000-fold dilution was used for RT-PCR for generation of a full-length amplicon spanning the complete HCV ORF. PCR products were visualized on a 1% agarose gel including a 1 kb DNA ladder; expected positions of full-length amplicons are indicated by arrows. Gel image was cropped as indicated by boxes; full-length gel is presented in Supplementary Fig. S4 .

    Techniques Used: Infection, Cell Culture, Derivative Assay, Sequencing, Concentration Assay, Reverse Transcription Polymerase Chain Reaction, Amplification, Polymerase Chain Reaction, Agarose Gel Electrophoresis

    28) Product Images from "Microbial Diversity of Emalahleni Mine Water in South Africa and Tolerance Ability of the Predominant Organism to Vanadium and Nickel"

    Article Title: Microbial Diversity of Emalahleni Mine Water in South Africa and Tolerance Ability of the Predominant Organism to Vanadium and Nickel

    Journal: PLoS ONE

    doi: 10.1371/journal.pone.0086189

    Agarose gel electrophoresis of PCR products of total genomic DNAs with primers targeting gene nccA (Lane: 4), van2 (lane: 3), smtAB (lane: 2) and cnrB2 (lane: 1). Lanes: M: DNA ladder (Marker) and B: Negative (No template DNA).
    Figure Legend Snippet: Agarose gel electrophoresis of PCR products of total genomic DNAs with primers targeting gene nccA (Lane: 4), van2 (lane: 3), smtAB (lane: 2) and cnrB2 (lane: 1). Lanes: M: DNA ladder (Marker) and B: Negative (No template DNA).

    Techniques Used: Agarose Gel Electrophoresis, Polymerase Chain Reaction, Marker

    29) Product Images from "Broccoli Fluorets: Split Aptamers as a User-Friendly Fluorescent Toolkit for Dynamic RNA Nanotechnology"

    Article Title: Broccoli Fluorets: Split Aptamers as a User-Friendly Fluorescent Toolkit for Dynamic RNA Nanotechnology

    Journal: Molecules

    doi: 10.3390/molecules23123178

    Enzyme-assisted activation and deactivation of fluorescent responses. ( a ) Co-transcriptional assembly of fluorets in the presence of DFHBI-1T. ( b ) DNase-assisted production of active fluorets from RNA/DNA duplexes, and their further deactivation with RNases.
    Figure Legend Snippet: Enzyme-assisted activation and deactivation of fluorescent responses. ( a ) Co-transcriptional assembly of fluorets in the presence of DFHBI-1T. ( b ) DNase-assisted production of active fluorets from RNA/DNA duplexes, and their further deactivation with RNases.

    Techniques Used: Activation Assay

    30) Product Images from "CRISPR-engineered mosaicism rapidly reveals that loss of Kcnj13 function in mice mimics human disease phenotypes"

    Article Title: CRISPR-engineered mosaicism rapidly reveals that loss of Kcnj13 function in mice mimics human disease phenotypes

    Journal: Scientific Reports

    doi: 10.1038/srep08366

    CRISPR-Cas9-induced mutations in Kcnj13 F0 mice. E1, E2 and E3 in the schematic of the Kcnj13 gene structure indicate three known exons. P1 and P2 are genotyping primers for the CRISPR-Cas9 targeting site. The blue ATG is the putative start codon of Kcnj13 . The red arrowhead indicates the potential Cas9 cleavage site. PAM: the protospacer-adjacent motif required for the binding and cleavage of DNA by CRISPR-Cas9. The underlined sequence is the sgRNA target we selected to delete the start codon. Small deletions (1–14 bp), small insertions (1 and 7 bp), and one large deletion (216 bp) were detected. All ATG-deleted alleles are defined as candidate Kcnj13 null alleles (N, named N2-15); alleles that leave the ATG intact are defined as wild-type alleles (W, named W1, W4 and W9). The wild-type reference allele is abbreviated as “WT”. Seven F0 mutant mice were selected to intercross or cross with wild-type C57BL/6 mice to test if their mutant alleles could be transmitted to F1 animals; transmitted alleles are labeled in green.
    Figure Legend Snippet: CRISPR-Cas9-induced mutations in Kcnj13 F0 mice. E1, E2 and E3 in the schematic of the Kcnj13 gene structure indicate three known exons. P1 and P2 are genotyping primers for the CRISPR-Cas9 targeting site. The blue ATG is the putative start codon of Kcnj13 . The red arrowhead indicates the potential Cas9 cleavage site. PAM: the protospacer-adjacent motif required for the binding and cleavage of DNA by CRISPR-Cas9. The underlined sequence is the sgRNA target we selected to delete the start codon. Small deletions (1–14 bp), small insertions (1 and 7 bp), and one large deletion (216 bp) were detected. All ATG-deleted alleles are defined as candidate Kcnj13 null alleles (N, named N2-15); alleles that leave the ATG intact are defined as wild-type alleles (W, named W1, W4 and W9). The wild-type reference allele is abbreviated as “WT”. Seven F0 mutant mice were selected to intercross or cross with wild-type C57BL/6 mice to test if their mutant alleles could be transmitted to F1 animals; transmitted alleles are labeled in green.

    Techniques Used: CRISPR, Mouse Assay, Binding Assay, Sequencing, Mutagenesis, Labeling

    31) Product Images from "Ribosome-controlled transcription termination is essential for the production of antibiotic microcin C"

    Article Title: Ribosome-controlled transcription termination is essential for the production of antibiotic microcin C

    Journal: Nucleic Acids Research

    doi: 10.1093/nar/gku880

    Ribosomes stimulate transcription termination in the mccA–mccB intergenic region in vitro . ( A ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Transcription elongation was allowed to resume by the addition of NTPs (lane 1), or NTPs with PURExpress ΔRibosome (lane 2), Δ(aa, tRNA) (lane 3) or full system (lane 4). An autoradiograph of a denaturing gel showing reaction product separation is shown. ( B ) In vitro transcribed mccA RNA was combined with PURExpress ΔRibosome (lane 2), Δ(aa, tRNA) (lane 3) or full system (lanes 4 and 5) at conditions identical to those used in panel A experiment, and toeprinting was performed. In lane 5, reaction contained 50 μM thiostrepton. The products of toeprinting reactions were resolved by denaturing gel-electrophoresis and revealed by autoradiography. The 3′ end of the cDNA products synthesized in the toeprint experiment and labeled +17/20 correspond to bound ribosomes with the first (+17) or second (+20) codons of mccA located in the ribosomal P site ( 27 ). ( C ) Transcription complexes were formed as described in A on wild-type or mutant transcription templates with mutated first codon of the mccA gene (ATG 1 - > TAA) or substitutions in the mccA SD sequence and transcription elongation was allowed to proceed. ( D ) In vitro transcribed wild-type mccA RNA or RNAs harboring mccA (ATG 1 - > TAA) or SD sequence substitutions were subjected to toeprinting reaction in the presence or in the absence of PURExpress Δ(aa, tRNA) system. All designations are as in panel B.
    Figure Legend Snippet: Ribosomes stimulate transcription termination in the mccA–mccB intergenic region in vitro . ( A ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Transcription elongation was allowed to resume by the addition of NTPs (lane 1), or NTPs with PURExpress ΔRibosome (lane 2), Δ(aa, tRNA) (lane 3) or full system (lane 4). An autoradiograph of a denaturing gel showing reaction product separation is shown. ( B ) In vitro transcribed mccA RNA was combined with PURExpress ΔRibosome (lane 2), Δ(aa, tRNA) (lane 3) or full system (lanes 4 and 5) at conditions identical to those used in panel A experiment, and toeprinting was performed. In lane 5, reaction contained 50 μM thiostrepton. The products of toeprinting reactions were resolved by denaturing gel-electrophoresis and revealed by autoradiography. The 3′ end of the cDNA products synthesized in the toeprint experiment and labeled +17/20 correspond to bound ribosomes with the first (+17) or second (+20) codons of mccA located in the ribosomal P site ( 27 ). ( C ) Transcription complexes were formed as described in A on wild-type or mutant transcription templates with mutated first codon of the mccA gene (ATG 1 - > TAA) or substitutions in the mccA SD sequence and transcription elongation was allowed to proceed. ( D ) In vitro transcribed wild-type mccA RNA or RNAs harboring mccA (ATG 1 - > TAA) or SD sequence substitutions were subjected to toeprinting reaction in the presence or in the absence of PURExpress Δ(aa, tRNA) system. All designations are as in panel B.

    Techniques Used: In Vitro, Labeling, Autoradiography, Nucleic Acid Electrophoresis, Synthesized, Mutagenesis, Sequencing

    Mapping an element of the mccA transcript that suppresses transcription termination in the mccA–mccB intergenic region. ( A ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Transcription elongation was allowed to resume by the addition of NTPs (lane 1), NTPs with PURExpress ΔRibosome (lane 2) or NTPs with PURExpress ΔRibosome in the presence of oligonucleotide oligo 1 (lane 3, see also panel D). An autoradiograph of a denaturing gel showing reaction product separation is shown. ( B ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Elongation was resumed by the addition of NTPs in the presence or in the absence of DNA oligonucleotides oligo 2 or oligo3. ( C ) Single-round in vitro transcription reactions were performed on a DNA containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154 (lane 1) and derivative templates that contained deletions extending from position +1 to a position, indicated in the template name (i.e. template labeled +15 lacked nucleotides +1/+14). The sites of termination are indicated by arrows. ( D ) The monocistronic mccA transcript. The SD sequence is shown in green, the mccA ORF in red. The area covered by a ribosome bound to the SD sequence, annealed oligos 1, 2 and 3, and the termination hairpin positions are indicated.
    Figure Legend Snippet: Mapping an element of the mccA transcript that suppresses transcription termination in the mccA–mccB intergenic region. ( A ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Transcription elongation was allowed to resume by the addition of NTPs (lane 1), NTPs with PURExpress ΔRibosome (lane 2) or NTPs with PURExpress ΔRibosome in the presence of oligonucleotide oligo 1 (lane 3, see also panel D). An autoradiograph of a denaturing gel showing reaction product separation is shown. ( B ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 34-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154. Elongation was resumed by the addition of NTPs in the presence or in the absence of DNA oligonucleotides oligo 2 or oligo3. ( C ) Single-round in vitro transcription reactions were performed on a DNA containing the T7 A1 promoter fused to a fragment of mcc operon extending from position +1 to position +154 (lane 1) and derivative templates that contained deletions extending from position +1 to a position, indicated in the template name (i.e. template labeled +15 lacked nucleotides +1/+14). The sites of termination are indicated by arrows. ( D ) The monocistronic mccA transcript. The SD sequence is shown in green, the mccA ORF in red. The area covered by a ribosome bound to the SD sequence, annealed oligos 1, 2 and 3, and the termination hairpin positions are indicated.

    Techniques Used: Labeling, Autoradiography, In Vitro, Sequencing

    In vivo analysis of the mcc operon transcripts. ( A ) Analysis of the mccABCDE operon of E. coli using differential RNA-Seq. RNA was extracted from E. coli cells harboring the McC-production plasmid pp70 and grown to late exponential phase in LB medium. Half of RNA was treated with Terminator™ 5′-phosphate-dependent exonuclease (TEX) (+TEX), while another half was left untreated (−TEX) and then converted into a cDNA library, which was subjected to high-throughput Illumina sequencing. cDNA sequencing reads were aligned to the mcc operon and visualized as coverage plots representing the number of reads per nucleotide (‘k’ for thousands of reads) in the IGB (Affymetrix). In the IGB screenshot shown plasmid coordinates are indicated in the middle; gray arrow represent annotated ORFs, black arrow denotes P mcc and the ORF of the small peptide mccA is shown as a red arrow. ( B ) At the left-hand side, results of detection of mcc transcripts in cells harboring the wild-type McC-production plasmid pp70 and its derivative pp70Δ51 harboring a deletion in the mccA–mccB region are shown: top—Northern blotting with an mccA -specific probe. Positions of Decade™ RNA Markers are indicated on the right. Middle—primer extension using a primer annealing at the beginning of the mccB gene. Bottom—primer extension using a primer annealing to plasmid-borne bla gene. At the right-hand side, the levels of McC production by cells harboring the wild-type or mutant McC-production plasmids and used for transcript analysis are shown. ( C ) Summary of mccA transcript mapping. A fragment of the mccABCDE operon DNA (in black) and the short mccA transcript (in blue) are schematically shown, arrows in the end of mccA transcript indicate results of 3′ end mapping by 3′-RACE. SD sequences of mccA and mccB ORFs are shown in green.
    Figure Legend Snippet: In vivo analysis of the mcc operon transcripts. ( A ) Analysis of the mccABCDE operon of E. coli using differential RNA-Seq. RNA was extracted from E. coli cells harboring the McC-production plasmid pp70 and grown to late exponential phase in LB medium. Half of RNA was treated with Terminator™ 5′-phosphate-dependent exonuclease (TEX) (+TEX), while another half was left untreated (−TEX) and then converted into a cDNA library, which was subjected to high-throughput Illumina sequencing. cDNA sequencing reads were aligned to the mcc operon and visualized as coverage plots representing the number of reads per nucleotide (‘k’ for thousands of reads) in the IGB (Affymetrix). In the IGB screenshot shown plasmid coordinates are indicated in the middle; gray arrow represent annotated ORFs, black arrow denotes P mcc and the ORF of the small peptide mccA is shown as a red arrow. ( B ) At the left-hand side, results of detection of mcc transcripts in cells harboring the wild-type McC-production plasmid pp70 and its derivative pp70Δ51 harboring a deletion in the mccA–mccB region are shown: top—Northern blotting with an mccA -specific probe. Positions of Decade™ RNA Markers are indicated on the right. Middle—primer extension using a primer annealing at the beginning of the mccB gene. Bottom—primer extension using a primer annealing to plasmid-borne bla gene. At the right-hand side, the levels of McC production by cells harboring the wild-type or mutant McC-production plasmids and used for transcript analysis are shown. ( C ) Summary of mccA transcript mapping. A fragment of the mccABCDE operon DNA (in black) and the short mccA transcript (in blue) are schematically shown, arrows in the end of mccA transcript indicate results of 3′ end mapping by 3′-RACE. SD sequences of mccA and mccB ORFs are shown in green.

    Techniques Used: In Vivo, RNA Sequencing Assay, Plasmid Preparation, cDNA Library Assay, High Throughput Screening Assay, Sequencing, Northern Blot, Mutagenesis

    H. pylori mcc operon analysis. ( A ) Schematic representations of E. coli and H. pylori mcc operons (drawn not to scale). All designations are as in Figure 1C . The mccA–mccB intergenic region of H. pylori is expanded below with the stop codon of mccA , the start codon of mccB and the location of inverted repeat that may form a transcription terminator indicated. ( B ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 32-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of H. pylori mcc operon extending from position +1 to position +137. Transcription elongation was allowed to resume by the addition of NTPs in the presence of PURExpress ΔRibosome (lane 1), Δ(aa, tRNA) (lane 2) or full (lane 3) translation systems. An autoradiograph of a denaturing gel showing reaction product separation is shown.
    Figure Legend Snippet: H. pylori mcc operon analysis. ( A ) Schematic representations of E. coli and H. pylori mcc operons (drawn not to scale). All designations are as in Figure 1C . The mccA–mccB intergenic region of H. pylori is expanded below with the stop codon of mccA , the start codon of mccB and the location of inverted repeat that may form a transcription terminator indicated. ( B ) Stalled E. coli RNA polymerase transcription elongation complexes containing a 32-nt long radioactively labeled RNA were formed on a DNA template containing the T7 A1 promoter fused to a fragment of H. pylori mcc operon extending from position +1 to position +137. Transcription elongation was allowed to resume by the addition of NTPs in the presence of PURExpress ΔRibosome (lane 1), Δ(aa, tRNA) (lane 2) or full (lane 3) translation systems. An autoradiograph of a denaturing gel showing reaction product separation is shown.

    Techniques Used: Labeling, Autoradiography

    Structural and functional probing of mccA transcript. ( A ) 32 P-5′-end labeled in vitro synthesized wild-type or mutant mccA RNA was digested with RNase T1 or RNase T2. Reaction products were resolved by denaturing PAGE and revealed by autoradiography. Lanes labeled ‘control’ show material that was not treated with RNAses. Lanes labeled ‘SEQ T1’ are marker lanes, showing digestion pattern obtained with RNase T1 under denaturing conditions (cleavages at every G). In lanes labeled ‘RNase T1’ and ‘RNase T2’ transcripts were re-folded in the presence of 10 mM MgCl 2 and then digested with RNases. In lanes labeled ‘PURExpress’ wild-type mccA RNA was folded in the presence of PURExpress full system in the presence of thiostrepton. ( B ) A secondary structure of mccA RNA produced by RNAfold software ( http://rna.tbi.univie.ac.at/ ) and consistent with RNase probing results. Cleavage positions by RNase T1 and RNase T2 are shown, respectively, with black and white asterisks. Elements of the structure (loops, L, and hairpins, H) are also marked on the gel shown in panel A. A fragment of mccA tested for in vivo termination activity is indicated. ( C ) A DNA fragment coding for a hairpin structure and adjacent sequences shown in panel C was cloned in direct (pFD_mcc_dir) and inverted (pFD_mcc_inv) orientations between the galK reporter and the lac UV5 promoter of plasmid pFD100. The resulting plasmids, as well as control pFD51 plasmid lacking the promoter, were transformed into galK − E. coli cells and transformants were then tested for GalK activity on McConkey indicator agar plates. Overnight growth of cells is shown.
    Figure Legend Snippet: Structural and functional probing of mccA transcript. ( A ) 32 P-5′-end labeled in vitro synthesized wild-type or mutant mccA RNA was digested with RNase T1 or RNase T2. Reaction products were resolved by denaturing PAGE and revealed by autoradiography. Lanes labeled ‘control’ show material that was not treated with RNAses. Lanes labeled ‘SEQ T1’ are marker lanes, showing digestion pattern obtained with RNase T1 under denaturing conditions (cleavages at every G). In lanes labeled ‘RNase T1’ and ‘RNase T2’ transcripts were re-folded in the presence of 10 mM MgCl 2 and then digested with RNases. In lanes labeled ‘PURExpress’ wild-type mccA RNA was folded in the presence of PURExpress full system in the presence of thiostrepton. ( B ) A secondary structure of mccA RNA produced by RNAfold software ( http://rna.tbi.univie.ac.at/ ) and consistent with RNase probing results. Cleavage positions by RNase T1 and RNase T2 are shown, respectively, with black and white asterisks. Elements of the structure (loops, L, and hairpins, H) are also marked on the gel shown in panel A. A fragment of mccA tested for in vivo termination activity is indicated. ( C ) A DNA fragment coding for a hairpin structure and adjacent sequences shown in panel C was cloned in direct (pFD_mcc_dir) and inverted (pFD_mcc_inv) orientations between the galK reporter and the lac UV5 promoter of plasmid pFD100. The resulting plasmids, as well as control pFD51 plasmid lacking the promoter, were transformed into galK − E. coli cells and transformants were then tested for GalK activity on McConkey indicator agar plates. Overnight growth of cells is shown.

    Techniques Used: Functional Assay, Labeling, In Vitro, Synthesized, Mutagenesis, Polyacrylamide Gel Electrophoresis, Autoradiography, Marker, Produced, Software, In Vivo, Activity Assay, Clone Assay, Plasmid Preparation, Transformation Assay

    32) Product Images from "Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae"

    Article Title: Regulation of Anti-Plasmodium Immunity by a LITAF-like Transcription Factor in the Malaria Vector Anopheles gambiae

    Journal: PLoS Pathogens

    doi: 10.1371/journal.ppat.1002965

    PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.
    Figure Legend Snippet: PCR-assisted DNA-binding site selection reveals consensus LL3 DNA-binding motifs. (A) Experimental outline of the two methods [“cold” (non-radioactive) or “hot” (radioactive)] used to obtain consensus DNA binding sites for rLL3 by PCR-assisted DNA-binding site selection. Consensus motifs obtained from the “cold” method using a 10 bp degenerate sequence (B) or from the 20 bp degenerate sequences recovered using the “hot” method (C) are shown to the right. All recovered sequences used as input to generate the consensus motifs are listed in Table S2 and all motifs generated by the MEME program are displayed in Figure S4 . EMSA: Electrophoretic Mobility-Shift Assay.

    Techniques Used: Polymerase Chain Reaction, Binding Assay, Selection, Sequencing, Generated, Electrophoretic Mobility Shift Assay

    33) Product Images from "Identification of piRNA binding sites reveals the Argonaute regulatory landscape of the C. elegans germline"

    Article Title: Identification of piRNA binding sites reveals the Argonaute regulatory landscape of the C. elegans germline

    Journal: Cell

    doi: 10.1016/j.cell.2018.02.002

    22G-RNAs peak at the center and ends of piRNA binding sites ( A–H ) 22G-RNA 5’ ends cloned from wild-type (red) or prg-1 .
    Figure Legend Snippet: 22G-RNAs peak at the center and ends of piRNA binding sites ( A–H ) 22G-RNA 5’ ends cloned from wild-type (red) or prg-1 .

    Techniques Used: Binding Assay, Clone Assay

    34) Product Images from "Broccoli Fluorets: Split Aptamers as a User-Friendly Fluorescent Toolkit for Dynamic RNA Nanotechnology"

    Article Title: Broccoli Fluorets: Split Aptamers as a User-Friendly Fluorescent Toolkit for Dynamic RNA Nanotechnology

    Journal: Molecules

    doi: 10.3390/molecules23123178

    Enzyme-assisted activation and deactivation of fluorescent responses. ( a ) Co-transcriptional assembly of fluorets in the presence of DFHBI-1T. ( b ) DNase-assisted production of active fluorets from RNA/DNA duplexes, and their further deactivation with RNases.
    Figure Legend Snippet: Enzyme-assisted activation and deactivation of fluorescent responses. ( a ) Co-transcriptional assembly of fluorets in the presence of DFHBI-1T. ( b ) DNase-assisted production of active fluorets from RNA/DNA duplexes, and their further deactivation with RNases.

    Techniques Used: Activation Assay

    Related Articles

    Clone Assay:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Synthesized:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Mutagenesis:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Isolation:

    Article Title: Macrophages attenuate the transcription of CYP1A1 in breast tumor cells and enhance their proliferation
    Article Snippet: .. Briefly, RNA was isolated out of 100 μl MCF7 tumor cell lysates using the RNA Clean and Concentrator-25 kit (Zymo Research). rRNA was removed using the RiboZero Gold rRNA Removal kit (Human/Mouse/Rat, Illumina). .. After heat fragmentation, end repair, and ligation of 3’ adapters, the RNA was reverse transcribed.

    Labeling:

    Article Title: Dissection of specific binding of HIV-1 Gag to the 'packaging signal' in viral RNA
    Article Snippet: .. To purify the RNAs the samples were run through three consecutive illustra microspin G-50 columns (GE Healthcare Life Sciences, Pittsburgh, PA USA) per 35 μL of labeling reaction, concentrated with an RNA clean and concentrator-25 kit (Zymo Research, Irvine, CA USA) and eluted with double-autoclaved double deionized water (dd-Water). .. The labeling yield was determined according to the manufacturer’s instructions with a UV-Vis NanoDrop 1000 and the integrity of the RNAs was determined by gel electrophoresis (6% polyacrylamide/TBE-UREA).

    Purification:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Chloramphenicol Acetyltransferase Assay:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, CatT111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Plasmid Preparation:

    Article Title: Kif18a regulates Sirt2-mediated tubulin acetylation for spindle organization during mouse oocyte meiosis
    Article Snippet: .. Vector (pcDNA3.1) cloning with Flag-tubulin substitution mutants (K40R) was conducted by the StarMut site-directed mutagenesis kit (GenStar, Cat#T111-01). mRNA was synthesized from linearized plasmid using the HiScribe T7 high yield RNA synthesis kit (NEB), then capped with m7G(5′)ppp(5′)G (NEB), tailed with a poly(A) polymerase tailing kit (Epicentre), and purified with the RNA clean & concentrator-25 kit (Zymo Research). .. Kif18a siRNA injection Kif18a siRNA microinjection was used to knock down Kif18a in mouse oocytes.

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 97
    Zymo Research concentratortm 25 kit
    Concentratortm 25 Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 97/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/concentratortm 25 kit/product/Zymo Research
    Average 97 stars, based on 2 article reviews
    Price from $9.99 to $1999.99
    concentratortm 25 kit - by Bioz Stars, 2020-05
    97/100 stars
      Buy from Supplier

    84
    Zymo Research genomic dna clean concentratorã¢â„â¢ã¢âˆâ’25 kit
    Genomic Dna Clean Concentratorã¢â„â¢ã¢âˆâ’25 Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/genomic dna clean concentratorã¢â„â¢ã¢âˆâ’25 kit/product/Zymo Research
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    genomic dna clean concentratorã¢â„â¢ã¢âˆâ’25 kit - by Bioz Stars, 2020-05
    84/100 stars
      Buy from Supplier

    84
    Zymo Research concentratorã cents ⠄ â cents 25 kit
    Concentratorã Cents ⠄ â Cents 25 Kit, supplied by Zymo Research, used in various techniques. Bioz Stars score: 84/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/concentratorã cents ⠄ â cents 25 kit/product/Zymo Research
    Average 84 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    concentratorã cents ⠄ â cents 25 kit - by Bioz Stars, 2020-05
    84/100 stars
      Buy from Supplier

    Image Search Results