Structured Review

Agilent technologies competent escherichia coli cells
Competent Escherichia Coli Cells, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 90/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/competent escherichia coli cells/product/Agilent technologies
Average 90 stars, based on 3 article reviews
Price from $9.99 to $1999.99
competent escherichia coli cells - by Bioz Stars, 2020-08
90/100 stars

Images

Related Articles

Clone Assay:

Article Title: Effects of Dietary Yogurt on the Healthy Human Gastrointestinal (GI) Microbiome
Article Snippet: .. PCR products were purified using Wizard ® SV and PCR Clean-Up System (Promega, Madison, WI, USA) and cloned into competent Escherichia coli cells using the Strataclone PCR cloning Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturers’ protocols. .. Transformed cells were plated on LB medium, containing 0.1 mg/mL of ampicillin and 4 μL of X-gal and incubated overnight at 37 °C.

Article Title: A neurotoxin that specifically targets Anopheles mosquitoes
Article Snippet: .. BL21(DE3) pLysS chemically competent E. coli cells (Agilent) were transformed with genes cloned in vectors pGEX-6P, pET Duet 1, and RSF Duet 1 according to the manufacturer’s protocol. .. Chemically competent M15 cells (Qiagen) were used for transformation of genes cloned in pQE-30.

Positron Emission Tomography:

Article Title: A neurotoxin that specifically targets Anopheles mosquitoes
Article Snippet: .. BL21(DE3) pLysS chemically competent E. coli cells (Agilent) were transformed with genes cloned in vectors pGEX-6P, pET Duet 1, and RSF Duet 1 according to the manufacturer’s protocol. .. Chemically competent M15 cells (Qiagen) were used for transformation of genes cloned in pQE-30.

Ligation:

Article Title: Nanobody-Displaying Flagellar Nanotubes
Article Snippet: .. XL10 Gold chemically competent E.coli cells (Agilent Technologies) were transformed by the ligation mixture. .. A small portion of the transformants was spread on agar plates, while the rest were grown in 150 ml LB for plasmid preparation.

Article Title: The Listeria monocytogenes transposon Tn6188 provides increased tolerance to various quaternary ammonium compounds and ethidium bromide.
Article Snippet: .. The ligation product (pNZ44-qacH) was transformed into competent E. coli cells (StrataClone SoloPack, Agilent Technologies) and transformants were selected on BHI agar containing 10 lg mL 1 chloramphenicol (BHI-Cm; Sigma-Aldrich). pNZ44-qacH was then transformed into the competent L. monocytogenes 4423 qacH deletion mutant (an isogenic mutant generated in our previous study) and R479a using the following parameters: voltage 2 kV, resistance 400 O, capacity 25 lF (Mueller et al., 2013). .. After electroporation, 1 mL of BHI with 0.5 M sucrose was added and incubated for 1 h at 30 °C.

Mutagenesis:

Article Title: The Listeria monocytogenes transposon Tn6188 provides increased tolerance to various quaternary ammonium compounds and ethidium bromide.
Article Snippet: .. The ligation product (pNZ44-qacH) was transformed into competent E. coli cells (StrataClone SoloPack, Agilent Technologies) and transformants were selected on BHI agar containing 10 lg mL 1 chloramphenicol (BHI-Cm; Sigma-Aldrich). pNZ44-qacH was then transformed into the competent L. monocytogenes 4423 qacH deletion mutant (an isogenic mutant generated in our previous study) and R479a using the following parameters: voltage 2 kV, resistance 400 O, capacity 25 lF (Mueller et al., 2013). .. After electroporation, 1 mL of BHI with 0.5 M sucrose was added and incubated for 1 h at 30 °C.

Article Title: Effect of a K72A Mutation on the Structure, Stability, Dynamics and Peroxidase Activity of Human Cytochrome c
Article Snippet: .. Double-stranded pBTR(HumanCc) DNA was prepared using BL21-Gold(DE3) (Agilent Technologies) competent Escherichia coli cells and used as a template for site-directed mutagenesis with the Agilent Technologies QuikChange Lightning Site-Directed Mutagenesis Kit. .. The oligonucleotide, K72A: d(GGAATACCTCGAGAACCCGGCGAAATACATCCCGGGCACG) and its reverse complement, K72A-r were used for mutagenesis.

Purification:

Article Title: Effects of Dietary Yogurt on the Healthy Human Gastrointestinal (GI) Microbiome
Article Snippet: .. PCR products were purified using Wizard ® SV and PCR Clean-Up System (Promega, Madison, WI, USA) and cloned into competent Escherichia coli cells using the Strataclone PCR cloning Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturers’ protocols. .. Transformed cells were plated on LB medium, containing 0.1 mg/mL of ampicillin and 4 μL of X-gal and incubated overnight at 37 °C.

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Generated:

Article Title: The Listeria monocytogenes transposon Tn6188 provides increased tolerance to various quaternary ammonium compounds and ethidium bromide.
Article Snippet: .. The ligation product (pNZ44-qacH) was transformed into competent E. coli cells (StrataClone SoloPack, Agilent Technologies) and transformants were selected on BHI agar containing 10 lg mL 1 chloramphenicol (BHI-Cm; Sigma-Aldrich). pNZ44-qacH was then transformed into the competent L. monocytogenes 4423 qacH deletion mutant (an isogenic mutant generated in our previous study) and R479a using the following parameters: voltage 2 kV, resistance 400 O, capacity 25 lF (Mueller et al., 2013). .. After electroporation, 1 mL of BHI with 0.5 M sucrose was added and incubated for 1 h at 30 °C.

Amplification:

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Expressing:

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Polymerase Chain Reaction:

Article Title: Effects of Dietary Yogurt on the Healthy Human Gastrointestinal (GI) Microbiome
Article Snippet: .. PCR products were purified using Wizard ® SV and PCR Clean-Up System (Promega, Madison, WI, USA) and cloned into competent Escherichia coli cells using the Strataclone PCR cloning Kit (Agilent Technologies, Santa Clara, CA, USA) according to manufacturers’ protocols. .. Transformed cells were plated on LB medium, containing 0.1 mg/mL of ampicillin and 4 μL of X-gal and incubated overnight at 37 °C.

Recombinant:

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Transformation Assay:

Article Title: Origin Replication Complex Binding, Nucleosome Depletion Patterns, and a Primary Sequence Motif Can Predict Origins of Replication in a Genome with Epigenetic Centromeres
Article Snippet: .. Competent E. coli cells (Agilent XL2-Blue ultracompetent cells) were transformed with the ligated library DNA, and individual E. coli colonies carrying pLN-mini-ARS plasmids were randomly selected and transformed into C. albicans . .. Individual mini-ARSs were tested for transformation efficiency, and the most efficient ones were analyzed by Sanger sequencing.

Article Title: Nanobody-Displaying Flagellar Nanotubes
Article Snippet: .. XL10 Gold chemically competent E.coli cells (Agilent Technologies) were transformed by the ligation mixture. .. A small portion of the transformants was spread on agar plates, while the rest were grown in 150 ml LB for plasmid preparation.

Article Title: A Novel Human-Infection-Derived Bacterium Provides Insights into the Evolutionary Origins of Mutualistic Insect-Bacterial Symbioses
Article Snippet: .. Two ml aliquots of the annealed vector/insert were transformed into 100 ml of XL-10 chemically competent E. coli cells (Agilent Technologies, Santa Lara, CA) and plated on LB agar plates containing 20 µg/ml ampicillin. ..

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Article Title: A neurotoxin that specifically targets Anopheles mosquitoes
Article Snippet: .. BL21(DE3) pLysS chemically competent E. coli cells (Agilent) were transformed with genes cloned in vectors pGEX-6P, pET Duet 1, and RSF Duet 1 according to the manufacturer’s protocol. .. Chemically competent M15 cells (Qiagen) were used for transformation of genes cloned in pQE-30.

Article Title: The Listeria monocytogenes transposon Tn6188 provides increased tolerance to various quaternary ammonium compounds and ethidium bromide.
Article Snippet: .. The ligation product (pNZ44-qacH) was transformed into competent E. coli cells (StrataClone SoloPack, Agilent Technologies) and transformants were selected on BHI agar containing 10 lg mL 1 chloramphenicol (BHI-Cm; Sigma-Aldrich). pNZ44-qacH was then transformed into the competent L. monocytogenes 4423 qacH deletion mutant (an isogenic mutant generated in our previous study) and R479a using the following parameters: voltage 2 kV, resistance 400 O, capacity 25 lF (Mueller et al., 2013). .. After electroporation, 1 mL of BHI with 0.5 M sucrose was added and incubated for 1 h at 30 °C.

Variant Assay:

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Plasmid Preparation:

Article Title: A Novel Human-Infection-Derived Bacterium Provides Insights into the Evolutionary Origins of Mutualistic Insect-Bacterial Symbioses
Article Snippet: .. Two ml aliquots of the annealed vector/insert were transformed into 100 ml of XL-10 chemically competent E. coli cells (Agilent Technologies, Santa Lara, CA) and plated on LB agar plates containing 20 µg/ml ampicillin. ..

Article Title: H55N polymorphism is associated with low citrate synthase activity which regulates lipid metabolism in mouse muscle cells
Article Snippet: .. Purification of recombinant citrate synthase (CS) protein For B6 protein, the cDNA corresponding to the B6 strain variant of Cs was obtained in an expression vector EX-Mm01963-B01 (p-Receiver-B01 vector, T7 promoter, N-His tag, GeneCopoeia) and amplified by transformation into competent E. coli cells of XL1-blue strain (Agilent). .. DNA was then extracted using Endo-free plasmid purification kit (Qiagen, Crawley, UK).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Agilent technologies escherichia coli xl blue competent cells
    Escherichia Coli Xl Blue Competent Cells, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 94/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli xl blue competent cells/product/Agilent technologies
    Average 94 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli xl blue competent cells - by Bioz Stars, 2020-08
    94/100 stars
      Buy from Supplier

    92
    Agilent technologies escherichia coli bl21 codonplus de3 ril competent cells
    Escherichia Coli Bl21 Codonplus De3 Ril Competent Cells, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 92/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli bl21 codonplus de3 ril competent cells/product/Agilent technologies
    Average 92 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    escherichia coli bl21 codonplus de3 ril competent cells - by Bioz Stars, 2020-08
    92/100 stars
      Buy from Supplier

    93
    Agilent technologies escherichia coli
    Escherichia Coli, supplied by Agilent technologies, used in various techniques. Bioz Stars score: 93/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/escherichia coli/product/Agilent technologies
    Average 93 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    escherichia coli - by Bioz Stars, 2020-08
    93/100 stars
      Buy from Supplier

    Image Search Results