coli bl21 al  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 86

    Structured Review

    Thermo Fisher coli bl21 al
    Coli Bl21 Al, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/coli bl21 al/product/Thermo Fisher
    Average 86 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    coli bl21 al - by Bioz Stars, 2020-02
    86/100 stars

    Images

    Related Articles

    Infection:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA). .. To assess invasion-related secretion of endogenous CT695, HeLa cultures were infected for 1 hr with CMPTX-labeled C . trachomatis L2 at an MOI of ca.

    Clone Assay:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: Paragraph title: CSP, TRAP, AMA, MSP2 and EBA-175 cloning, sequencing, expression and purification of their recombinant fragments ... All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA).

    Amplification:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: The EBA-175-rII amplified region (forward primer: 5’- ATGAAAATGAAAGGAAATGATAC—3’ and reverse 5’-TTCCCTTTTCGTACAATTAT—3’) encoded amino acids 1146 to 1406, including EBA-175-Ct 1815 cHABP. .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA).

    Fluorescence:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Paragraph title: Fluorescence microscopy localization assays ... His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Staining:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Microscopy:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Paragraph title: Fluorescence microscopy localization assays ... His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Purification:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA). ..

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Plasmid Preparation:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: The coding sequence for C . trachomatis L2 CT695 was amplified using Q5 DNA polymerase and primers sets (5’-GGGGACAAGTTTGTACAAAAAA GCAGGCTTCAG TAGCATAAGCCCTATAGGGGGG-3’ and 5’-GGGGACCACTT TGTACAAGAAAGCTGG GTCCTATTAGATATTCCCAACCGAAGAAGG-3’) for transfer into the GATEWAY (Life Technologies) entry vector pDONR-221. .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: The products were cloned in pEXP-5-CT/TOPO vector (Invitrogen). .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA).

    Affinity Chromatography:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Construct:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ). .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Expressing:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: Paragraph title: CSP, TRAP, AMA, MSP2 and EBA-175 cloning, sequencing, expression and purification of their recombinant fragments ... All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA).

    BIA-KA:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Sequencing:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ). .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: Paragraph title: CSP, TRAP, AMA, MSP2 and EBA-175 cloning, sequencing, expression and purification of their recombinant fragments ... All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA).

    Western Blot:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Recombinant:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: .. All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    Immunofluorescence:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Fluorescence microscopy localization assays Localization of CT695 and TarP was determined via indirect immunofluorescence using CT695-specific antibodies or α-TarP [ ]. .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Molecular Weight:

    Article Title: IMPIPS: The Immune Protection- Inducing Protein Structure Concept in the Search for Steric-Electron and Topochemical Principles for Complete Fully-Protective Chemically Synthesised Vaccine Development
    Article Snippet: All recombinant proteins were expressed in E . coli BL21-Al (Invitrogen), following the manufacturer’s recommendations, purified by affinity chromatography and the fractions were pooled and quantified using a Micro BCA protein assay kit (Thermo Scientific, Meridian, USA). .. Expected protein molecular weight bands were observed in Coomassie blue staining and Western blot (CSP-rI 10.0 kDa, CSP-rII 11.0 kDa, TRAP-rII 8.5 kDa, AMA-1 38 kDa, MSP-2-rI 14.5kDa, EBA-175-rI 26.1 kDa and EBA-175- rII 31.5 kDa).

    DNA Sequencing:

    Article Title: Application of β-Lactamase Reporter Fusions as an Indicator of Effector Protein Secretion during Infections with the Obligate Intracellular Pathogen Chlamydia trachomatis
    Article Snippet: Donor sequence was mobilized into pDEST-17 and constructs were verified via DNA sequencing (GENEWIZ). .. His-Tagged CT695 was expressed in E . coli BL21-Al (Invitrogen), and protein was purified to homogeneity via passage of lysates over TALON affinity resin (Clontech, Mountain View, CA).

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    Thermo Fisher shot bl21
    Shot Bl21, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 94/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/shot bl21/product/Thermo Fisher
    Average 94 stars, based on 14 article reviews
    Price from $9.99 to $1999.99
    shot bl21 - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    Image Search Results