Structured Review

TaKaRa cmv promoter
Orientation of the <t>3′-CMV</t> promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the <t>CMV-KLF16-CMV</t> construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )
Cmv Promoter, supplied by TaKaRa, used in various techniques. Bioz Stars score: 92/100, based on 340 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/cmv promoter/product/TaKaRa
Average 92 stars, based on 340 article reviews
Price from $9.99 to $1999.99
cmv promoter - by Bioz Stars, 2020-07
92/100 stars

Images

1) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )
Figure Legend Snippet: Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )

Techniques Used: Expressing, Construct, Western Blot, Plasmid Preparation

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

2) Product Images from "Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation"

Article Title: Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1005422

Plasmids used for expressing the mobile Ll.LtrB group II intron in human cells and their effect on cell viability. (A) Mobile group II intron expression plasmids. phLtrA uses a CMV promoter to express a humanized LtrA protein (hLtrA) with a C-terminal SV40 NLS followed by a human growth hormone polyadenylation signal (pA). pLl.LtrB uses a minimal T7 promoter to express the Ll.LtrB-ΔORF intron with flanking 5’ and 3’ ltrB exons (E1 and E2, respectively). pT7-NLS uses a CMV promoter to express T7 RNAP with an N-terminal SV40 NLS followed by the same polyadenylation signal as above. (B) Cytotoxicity assays. HEK-293 cells were transfected with the indicated plasmids. After 48 h in culture, luciferase activity was measured as an indicator of total cellular ATP content and cell viability by using a CellTiter-Glo direct lysis kit. Plasmid pLl.LtrB-HPRT expresses an Ll.LtrB intron targeted to the mouse hprt gene [ 45 ], the vector is pBluescript and the reagent is Lipofectamine 2000. The bar graph shows the average for three separate transfections with the error bars indicating the SEM.
Figure Legend Snippet: Plasmids used for expressing the mobile Ll.LtrB group II intron in human cells and their effect on cell viability. (A) Mobile group II intron expression plasmids. phLtrA uses a CMV promoter to express a humanized LtrA protein (hLtrA) with a C-terminal SV40 NLS followed by a human growth hormone polyadenylation signal (pA). pLl.LtrB uses a minimal T7 promoter to express the Ll.LtrB-ΔORF intron with flanking 5’ and 3’ ltrB exons (E1 and E2, respectively). pT7-NLS uses a CMV promoter to express T7 RNAP with an N-terminal SV40 NLS followed by the same polyadenylation signal as above. (B) Cytotoxicity assays. HEK-293 cells were transfected with the indicated plasmids. After 48 h in culture, luciferase activity was measured as an indicator of total cellular ATP content and cell viability by using a CellTiter-Glo direct lysis kit. Plasmid pLl.LtrB-HPRT expresses an Ll.LtrB intron targeted to the mouse hprt gene [ 45 ], the vector is pBluescript and the reagent is Lipofectamine 2000. The bar graph shows the average for three separate transfections with the error bars indicating the SEM.

Techniques Used: Expressing, Transfection, Luciferase, Activity Assay, Lysis, Plasmid Preparation

3) Product Images from "A Translation Initiation Element Specific to mRNAs with Very Short 5?UTR that Also Regulates Transcription"

Article Title: A Translation Initiation Element Specific to mRNAs with Very Short 5?UTR that Also Regulates Transcription

Journal: PLoS ONE

doi: 10.1371/journal.pone.0003094

TISU is essential for transcription directed by PSMD8 and WBP11 promoters. A. Determination, by primer extension, of the transcription start sites of the endogenous PSMD8 and WBP11 genes using gene specific primers as probes and total RNA prepared from 293T cells. The primer-extension products were run together with sequencing reactions (marked A, C, G and T). The TSSs are numbered and their positions are shown in panel C. B. The effect of TISU mutation on transcription. The promoters of the PSMD8 and WBP11 genes (from −180 to +50 and −150 to +50 of PSMD8 and WBP11 respectively) were cloned in front of a luciferase reporter gene and then subjected to site directed mutagenesis to create TISU mutants. The wild type (WT) or mutated (M or Mut) promoter or the promoter-less parental plasmid (pGL2-basic, B) was co-transfected into 293T cells with CMV-puro-GFP that serves as a reference for transfection efficiency. 24 hours post transfection RNA was extracted and analyzed by primer extension using luciferase and puromycin primers. The primer-extension products were run together with sequencing reactions (marked A, C, G and T). The TSSs were numbered according to the endogenous TSSs shown in A. The graphs on the right show quantification by densitometry of the TSSs that correspond to the endogenous ones from 3 independent experiments (average ±SD). C. The DNA sequences and the positions of TSSs of the PSMD8 and WBP11 promoters. The TSSs are indicated by arrows and numbers correspond to the numbered TSS bands shown in A B. An asterisk marks the TSS assigned by the database. Lower case letters indicate the sequence of the TISU mutation. D. The effect of TISU mutation on mRNA stability. Wild type (WT) and TISU-mutated PSMD8 (Mut) luciferase reporter genes were transfected into 293T cells. 24 hours after transfection, transcription was halted by actinomycin D and RNA extracted at different time intervals. To measure the decay of the luciferase mRNA, semi-quantitative PCR was applied using a 5′ primer containing either the wild type or mutated TISU sequence and a luciferase primer as 3′ primer. The results shown are the average ±SD of 4 independent experiments.
Figure Legend Snippet: TISU is essential for transcription directed by PSMD8 and WBP11 promoters. A. Determination, by primer extension, of the transcription start sites of the endogenous PSMD8 and WBP11 genes using gene specific primers as probes and total RNA prepared from 293T cells. The primer-extension products were run together with sequencing reactions (marked A, C, G and T). The TSSs are numbered and their positions are shown in panel C. B. The effect of TISU mutation on transcription. The promoters of the PSMD8 and WBP11 genes (from −180 to +50 and −150 to +50 of PSMD8 and WBP11 respectively) were cloned in front of a luciferase reporter gene and then subjected to site directed mutagenesis to create TISU mutants. The wild type (WT) or mutated (M or Mut) promoter or the promoter-less parental plasmid (pGL2-basic, B) was co-transfected into 293T cells with CMV-puro-GFP that serves as a reference for transfection efficiency. 24 hours post transfection RNA was extracted and analyzed by primer extension using luciferase and puromycin primers. The primer-extension products were run together with sequencing reactions (marked A, C, G and T). The TSSs were numbered according to the endogenous TSSs shown in A. The graphs on the right show quantification by densitometry of the TSSs that correspond to the endogenous ones from 3 independent experiments (average ±SD). C. The DNA sequences and the positions of TSSs of the PSMD8 and WBP11 promoters. The TSSs are indicated by arrows and numbers correspond to the numbered TSS bands shown in A B. An asterisk marks the TSS assigned by the database. Lower case letters indicate the sequence of the TISU mutation. D. The effect of TISU mutation on mRNA stability. Wild type (WT) and TISU-mutated PSMD8 (Mut) luciferase reporter genes were transfected into 293T cells. 24 hours after transfection, transcription was halted by actinomycin D and RNA extracted at different time intervals. To measure the decay of the luciferase mRNA, semi-quantitative PCR was applied using a 5′ primer containing either the wild type or mutated TISU sequence and a luciferase primer as 3′ primer. The results shown are the average ±SD of 4 independent experiments.

Techniques Used: Sequencing, Mutagenesis, Clone Assay, Luciferase, Plasmid Preparation, Transfection, Real-time Polymerase Chain Reaction

TISU drives translation initiation in a native context. A. PSMD8 and RPA39 promoters and part of the coding sequences were fused in frame to the GFP gene, instead of the CMV promoter. The constructs were transfected into 293T cells and 24 hours post transfection total RNA was extracted and the TSSs, determined by primer extension. The primer-extension products were run together with sequencing ladders (A, C, G, left panel) and the TSSs are indicated by arrowheads. B. The DNA and protein sequences and the positions of TSSs of the PSMD8 and RPA39 sequences. The TSSs are indicated by arrows, the expected translation start sites are marked with bold letters and the translation start site of the GFP is indicated. C. Representative western blot of the translation from mRNA directed by PSMD8 and RPA39 genes. GFP reporter gene driven by PSMD8 and RPA39 promoters bearing wild type and mutated TISU, and the parental CMV promoter were co-transfected into 293T cells together with the luciferase reporter gene pGL3-promoter to normalize transfection efficiency. Normalized cell lysate was subjected to western blot using anti-GFP to determine which AUG initiated translation. D. The intensity of the translation products was quantified. The results represent the average ±S.D of 3 independent experiments. * p
Figure Legend Snippet: TISU drives translation initiation in a native context. A. PSMD8 and RPA39 promoters and part of the coding sequences were fused in frame to the GFP gene, instead of the CMV promoter. The constructs were transfected into 293T cells and 24 hours post transfection total RNA was extracted and the TSSs, determined by primer extension. The primer-extension products were run together with sequencing ladders (A, C, G, left panel) and the TSSs are indicated by arrowheads. B. The DNA and protein sequences and the positions of TSSs of the PSMD8 and RPA39 sequences. The TSSs are indicated by arrows, the expected translation start sites are marked with bold letters and the translation start site of the GFP is indicated. C. Representative western blot of the translation from mRNA directed by PSMD8 and RPA39 genes. GFP reporter gene driven by PSMD8 and RPA39 promoters bearing wild type and mutated TISU, and the parental CMV promoter were co-transfected into 293T cells together with the luciferase reporter gene pGL3-promoter to normalize transfection efficiency. Normalized cell lysate was subjected to western blot using anti-GFP to determine which AUG initiated translation. D. The intensity of the translation products was quantified. The results represent the average ±S.D of 3 independent experiments. * p

Techniques Used: Construct, Transfection, Sequencing, Western Blot, Luciferase

4) Product Images from "Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *"

Article Title: Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.289546

HEK cells expressing α4β2 nAChRs were transiently transfected with plasmid DNA containing the firefly luciferase gene that is expressed from a CMV promoter. Cells were treated with 1 μ m nicotine ( Nic ), 1 m m carbachol ( Carb ), 1
Figure Legend Snippet: HEK cells expressing α4β2 nAChRs were transiently transfected with plasmid DNA containing the firefly luciferase gene that is expressed from a CMV promoter. Cells were treated with 1 μ m nicotine ( Nic ), 1 m m carbachol ( Carb ), 1

Techniques Used: Expressing, Transfection, Plasmid Preparation, Luciferase

5) Product Images from "The CMV early enhancer/chicken ? actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors"

Article Title: The CMV early enhancer/chicken ? actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors

Journal: BMC Cell Biology

doi: 10.1186/1471-2121-9-2

The CMV and chicken β-actin promoters cannot drive gene expression in bicistronic vectors transfected into CCE cells . CCE cells (A) or rat embryo fibroblasts (B) were transfected with the bicistronic vectors pIRES2-EGFP and pIRES-EGFP(β-actin) in which the CMV promoter had been substituted with the chicken β-actin promoter. GFP expression was not evident in CCE cells transfected with these vectors; GFP + cells were only obtained when cells were transfected with pEGFP-N1. In contrast GFP expression was apparent in fibroblasts transfected with all three constructs (B). Micrographs were obtained 24 hours after transfection.
Figure Legend Snippet: The CMV and chicken β-actin promoters cannot drive gene expression in bicistronic vectors transfected into CCE cells . CCE cells (A) or rat embryo fibroblasts (B) were transfected with the bicistronic vectors pIRES2-EGFP and pIRES-EGFP(β-actin) in which the CMV promoter had been substituted with the chicken β-actin promoter. GFP expression was not evident in CCE cells transfected with these vectors; GFP + cells were only obtained when cells were transfected with pEGFP-N1. In contrast GFP expression was apparent in fibroblasts transfected with all three constructs (B). Micrographs were obtained 24 hours after transfection.

Techniques Used: Expressing, Transfection, Construct

6) Product Images from "A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector"

Article Title: A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector

Journal: Oncology Reports

doi: 10.3892/or.2013.2958

(A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.
Figure Legend Snippet: (A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.

Techniques Used: Expressing, Sequencing, Plasmid Preparation, Transfection, Western Blot

7) Product Images from "Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity"

Article Title: Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity

Journal: PLoS ONE

doi: 10.1371/journal.pone.0096941

Effect of selected compounds on the induction of the luciferase signal at the CMV-luc construct in KG-1 cells. (A) CMV-luc construct to detect changes in methylation at the CMV promoter in KG-1 cells. (B) Modulation of induction of luciferase expression of CMV-luc after treatment with different doses of 1 , 4 , 10 , 13 and 14 . SGI-1027 was used as a reference drug. Values are means of at least two experiments. Cytotoxicity of DNMT inhibitors in KG-1 cells causes a decrease or loss of luciferase induction.
Figure Legend Snippet: Effect of selected compounds on the induction of the luciferase signal at the CMV-luc construct in KG-1 cells. (A) CMV-luc construct to detect changes in methylation at the CMV promoter in KG-1 cells. (B) Modulation of induction of luciferase expression of CMV-luc after treatment with different doses of 1 , 4 , 10 , 13 and 14 . SGI-1027 was used as a reference drug. Values are means of at least two experiments. Cytotoxicity of DNMT inhibitors in KG-1 cells causes a decrease or loss of luciferase induction.

Techniques Used: Luciferase, Construct, Methylation, Expressing

8) Product Images from "Fluorescence detection of DNA mismatch repair in human cells"

Article Title: Fluorescence detection of DNA mismatch repair in human cells

Journal: Scientific Reports

doi: 10.1038/s41598-018-30733-x

Dual detection to prevent false-negative results. ( a ) The plasmid used in this study. The tdTomato gene to be transcribed from the CMV promoter was inserted into pBSII EGFP, as shown in Fig. 4 , and a C/A mismatch was produced in the EGFP gene, in the same manner as in pBSII EGFP C/A. ( b ) Expected results of the experiments using pBSII EGFP-tdTomato C/A. When the cells are transformed with this plasmid, the tdTomato gene will be expressed, and the red fluorescence would be detected, regardless of the cellular MMR ability. The observation of this red signal indicates the successful transformation, and can be used to prevent false-negative results.
Figure Legend Snippet: Dual detection to prevent false-negative results. ( a ) The plasmid used in this study. The tdTomato gene to be transcribed from the CMV promoter was inserted into pBSII EGFP, as shown in Fig. 4 , and a C/A mismatch was produced in the EGFP gene, in the same manner as in pBSII EGFP C/A. ( b ) Expected results of the experiments using pBSII EGFP-tdTomato C/A. When the cells are transformed with this plasmid, the tdTomato gene will be expressed, and the red fluorescence would be detected, regardless of the cellular MMR ability. The observation of this red signal indicates the successful transformation, and can be used to prevent false-negative results.

Techniques Used: Plasmid Preparation, Produced, Transformation Assay, Fluorescence

Fluorescence detection of DNA repair in cells. ( a ) Detection of base excision repair developed in our previous study 22 . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b ) Detection of nucleotide excision repair developed in our previous study 23 . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.
Figure Legend Snippet: Fluorescence detection of DNA repair in cells. ( a ) Detection of base excision repair developed in our previous study 22 . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b ) Detection of nucleotide excision repair developed in our previous study 23 . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.

Techniques Used: Fluorescence, Binding Assay, Plasmid Preparation, Transformation Assay, Produced

9) Product Images from "Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿"

Article Title: Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿

Journal:

doi: 10.1128/MCB.01120-07

Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.
Figure Legend Snippet: Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.

Techniques Used: DNA Methylation Assay, In Vitro, Methylation, Plasmid Preparation, Transfection

RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A
Figure Legend Snippet: RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A

Techniques Used: Methylation, In Vitro, Transfection

10) Product Images from "Optimization of the Tet-On System for Inducible Expression of RAGE"

Article Title: Optimization of the Tet-On System for Inducible Expression of RAGE

Journal: Journal of Biomolecular Techniques : JBT

doi:

Cloning strategies used to construct the Tet-On system. A : Schematic representation of the cloning steps used to make the regulatory plasmids pCMV-rtTA and pNSE-rtTA. in PCMV-rtTA, expression of rtTA is driven by the CMV promoter, whereas in pNSE-rtTA, the CMV promoter of the pIRES2-EGFP plasmid was replaced with the NSE promoter and the rtTA fragment subcloned downstream of the NSE promoter after removing the EGFP fragment. B : Schematic illustration of the subcloning steps involved in the construction of the response plasmid. The CMV promoter was replaced with TREtight in the pIRES2-EGFP, and the gene RAGE subcloned downstream of the TREtight.
Figure Legend Snippet: Cloning strategies used to construct the Tet-On system. A : Schematic representation of the cloning steps used to make the regulatory plasmids pCMV-rtTA and pNSE-rtTA. in PCMV-rtTA, expression of rtTA is driven by the CMV promoter, whereas in pNSE-rtTA, the CMV promoter of the pIRES2-EGFP plasmid was replaced with the NSE promoter and the rtTA fragment subcloned downstream of the NSE promoter after removing the EGFP fragment. B : Schematic illustration of the subcloning steps involved in the construction of the response plasmid. The CMV promoter was replaced with TREtight in the pIRES2-EGFP, and the gene RAGE subcloned downstream of the TREtight.

Techniques Used: Clone Assay, Construct, Expressing, Plasmid Preparation, Subcloning

11) Product Images from "Transcriptional activity regulates alternative cleavage and polyadenylation"

Article Title: Transcriptional activity regulates alternative cleavage and polyadenylation

Journal: Molecular Systems Biology

doi: 10.1038/msb.2011.69

Reporter assays indicate regulation of polyA site choice by transcriptional activity. ( A ) Constructs used in this study. P CMV , P TAL , P CRE , P NFκB , P GRE , P HSE , P SRE , P E2F , and P MyoG are various promoters (see Materials and methods for details). RFP, IRES, EGFP, and Kan r are sequences encoding red fluorescent protein, internal ribosome entry site, enhanced green fluorescent protein, and kanamycin resistance gene, respectively. Kan r has its own promoter and polyA site. As shown in the graph, two polyA sites (pA) resulted in two transcript isoforms (1 and 2). Isoform 1 encodes RFP, IRES, and EGFP; and isoform 2 encodes RFP only. AAA n , poly(A) tail. qRT–PCR primers and RNase protection assay (RPA) probes are indicated in the graph, which were used to examine relative expression of the two isoforms. ( B ) RPA analysis of the isoforms expressed from the construct with P CMV or P TAL . Top, a representative autoradiograph of RPA results. The RPA probe is 249 nt in length. The 200-nt fragment corresponds to isoform 1 and the 142-nt fragment to isoform 2. The amount of sample loaded in each lane was adjusted to make the overall signal similar across samples. Bottom, normalized molar ratios of isoform 2 to isoform 1. The molar ratio of isoform 2 to isoform 1 was based on the amount of each RPA fragment quantified by PhosphorImager and the number of uracils in each fragment (UTP was used for probe labeling). The value for P CMV was set to 1, and error bars are standard deviation based on two experiments. ( C ) qRT–PCR analysis of expression level versus isoform ratio using cells transfected with constructs containing indicated promoters. Some of the transfected cells were treated with forskolin and/or TNFα as indicated in the graph. Expression level was measured by RFP/Kan r , and isoform ratio was measured by EGFP/RFP. R 2 of linear regression is indicated. ( D ) qRT–PCR analysis of expression level and isoform ratio for constructs with P GRE , P HSE , and P SRE which were induced with dexamethasone, heat shock, and serum, respectively (see Materials and methods for details). R/K is RFP/Kan r and E/R is EGFP/RFP. Error bars are standard error of mean (s.e.m.) based on two experiments. ( E ) Percent of genes with 3′UTRs lengthened or shortened in three gene groups with different expression changes during differentiation of C2C12 cells. DN, downregulated; NC, no change; UP, upregulated. Error bars are standard deviation based on two samples; P -value is based on the Fisher's exact test comparing gene numbers in three groups. ( F ) qRT–PCR analysis of isoforms expressed from constructs with P E2F or P MyoG in proliferating and differentiating C2C12 cells. Isoform ratio was measured by EGFP/RFP. Error bars are standard error of mean (s.e.m.) based on two experiments. See Materials and methods for more technical details. Source data is available for this figure in the Supplementary Information .
Figure Legend Snippet: Reporter assays indicate regulation of polyA site choice by transcriptional activity. ( A ) Constructs used in this study. P CMV , P TAL , P CRE , P NFκB , P GRE , P HSE , P SRE , P E2F , and P MyoG are various promoters (see Materials and methods for details). RFP, IRES, EGFP, and Kan r are sequences encoding red fluorescent protein, internal ribosome entry site, enhanced green fluorescent protein, and kanamycin resistance gene, respectively. Kan r has its own promoter and polyA site. As shown in the graph, two polyA sites (pA) resulted in two transcript isoforms (1 and 2). Isoform 1 encodes RFP, IRES, and EGFP; and isoform 2 encodes RFP only. AAA n , poly(A) tail. qRT–PCR primers and RNase protection assay (RPA) probes are indicated in the graph, which were used to examine relative expression of the two isoforms. ( B ) RPA analysis of the isoforms expressed from the construct with P CMV or P TAL . Top, a representative autoradiograph of RPA results. The RPA probe is 249 nt in length. The 200-nt fragment corresponds to isoform 1 and the 142-nt fragment to isoform 2. The amount of sample loaded in each lane was adjusted to make the overall signal similar across samples. Bottom, normalized molar ratios of isoform 2 to isoform 1. The molar ratio of isoform 2 to isoform 1 was based on the amount of each RPA fragment quantified by PhosphorImager and the number of uracils in each fragment (UTP was used for probe labeling). The value for P CMV was set to 1, and error bars are standard deviation based on two experiments. ( C ) qRT–PCR analysis of expression level versus isoform ratio using cells transfected with constructs containing indicated promoters. Some of the transfected cells were treated with forskolin and/or TNFα as indicated in the graph. Expression level was measured by RFP/Kan r , and isoform ratio was measured by EGFP/RFP. R 2 of linear regression is indicated. ( D ) qRT–PCR analysis of expression level and isoform ratio for constructs with P GRE , P HSE , and P SRE which were induced with dexamethasone, heat shock, and serum, respectively (see Materials and methods for details). R/K is RFP/Kan r and E/R is EGFP/RFP. Error bars are standard error of mean (s.e.m.) based on two experiments. ( E ) Percent of genes with 3′UTRs lengthened or shortened in three gene groups with different expression changes during differentiation of C2C12 cells. DN, downregulated; NC, no change; UP, upregulated. Error bars are standard deviation based on two samples; P -value is based on the Fisher's exact test comparing gene numbers in three groups. ( F ) qRT–PCR analysis of isoforms expressed from constructs with P E2F or P MyoG in proliferating and differentiating C2C12 cells. Isoform ratio was measured by EGFP/RFP. Error bars are standard error of mean (s.e.m.) based on two experiments. See Materials and methods for more technical details. Source data is available for this figure in the Supplementary Information .

Techniques Used: Activity Assay, Construct, Quantitative RT-PCR, Rnase Protection Assay, Recombinase Polymerase Amplification, Expressing, Autoradiography, Labeling, Standard Deviation, Transfection

12) Product Images from "A Method for Producing Transgenic Cells Using a Multi-Integrase System on a Human Artificial Chromosome Vector"

Article Title: A Method for Producing Transgenic Cells Using a Multi-Integrase System on a Human Artificial Chromosome Vector

Journal: PLoS ONE

doi: 10.1371/journal.pone.0017267

Comparison of the efficiency in generating transgenic cells. (A) Schematic diagram of the insertion of the plasmid containing the CMV promoter and the EGFP gene in the multi-integrase HAC vector or host chromosome. Under both conditions, cells were incubated with the reagent/DNA mixture for 24 h and selected with G418 until drug-resistant cell pools were obtained. (B) Flow cytometry analysis of the fluorescent profile of transfected CHO cells on day 12 following selection by G418 after transfection. The bars indicate the GFP-expressing cell population. (C) Expression of the inserted EGFP gene was tracked in cells by fluorescence microscopy. Typical images (bright field, upper panels; fluorescence, lower panels) of cells obtained by the multi-integrase HAC vector with integrases and random integration are shown. Scale bar, 100 µm.
Figure Legend Snippet: Comparison of the efficiency in generating transgenic cells. (A) Schematic diagram of the insertion of the plasmid containing the CMV promoter and the EGFP gene in the multi-integrase HAC vector or host chromosome. Under both conditions, cells were incubated with the reagent/DNA mixture for 24 h and selected with G418 until drug-resistant cell pools were obtained. (B) Flow cytometry analysis of the fluorescent profile of transfected CHO cells on day 12 following selection by G418 after transfection. The bars indicate the GFP-expressing cell population. (C) Expression of the inserted EGFP gene was tracked in cells by fluorescence microscopy. Typical images (bright field, upper panels; fluorescence, lower panels) of cells obtained by the multi-integrase HAC vector with integrases and random integration are shown. Scale bar, 100 µm.

Techniques Used: Transgenic Assay, Plasmid Preparation, HAC Assay, Incubation, Flow Cytometry, Cytometry, Transfection, Selection, Expressing, Fluorescence, Microscopy

13) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )
Figure Legend Snippet: Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )

Techniques Used: Expressing, Construct, Western Blot, Plasmid Preparation

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

14) Product Images from "A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector"

Article Title: A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector

Journal: Oncology Reports

doi: 10.3892/or.2013.2958

(A) The REIC/Dkk-3 expression levels after transfection at 100 MOI with CMV promoter-driven adenoviral vectors (Ad-CMV-REIC and Ad-SGE-REIC) were compared by western blot analysis in PC3 and KPK1 human cancer cells. (B) The REIC/Dkk-3 expression levels after transfection at 10 MOI and 100 MOI with Ad-CAG-REIC and Ad-SGE-REIC were compared by western blot analysis in 211H, PC3 and KPK1 human cancer cells. SGE, super gene expression; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3; MOI, multiplicity of infection.
Figure Legend Snippet: (A) The REIC/Dkk-3 expression levels after transfection at 100 MOI with CMV promoter-driven adenoviral vectors (Ad-CMV-REIC and Ad-SGE-REIC) were compared by western blot analysis in PC3 and KPK1 human cancer cells. (B) The REIC/Dkk-3 expression levels after transfection at 10 MOI and 100 MOI with Ad-CAG-REIC and Ad-SGE-REIC were compared by western blot analysis in 211H, PC3 and KPK1 human cancer cells. SGE, super gene expression; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3; MOI, multiplicity of infection.

Techniques Used: Expressing, Transfection, Western Blot, Infection

(A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.
Figure Legend Snippet: (A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.

Techniques Used: Expressing, Sequencing, Plasmid Preparation, Transfection, Western Blot

(A) The induction of apoptosis after Ad-REIC treatment is shown by Hoechst 33342 staining in 211H human malignant mesothelioma cells. Apoptotic cells can be clearly observed as bright cells under fluorescence microscopy (left panel). The appearance of the cells by phase contrast microscopy is also shown (right panel). (B) The apoptotic cell rate (%) was examined after the indicated treatments (no treatment, Ad-LacZ, Ad-CMV-REIC, Ad-CAG-REIC and Ad-SGE-REIC at 50 MOI for 48 h) in normal human cells (HC, hepatocytes; OUMS24, fibroblasts) and various human cancer cell lines (211H, PC3, KPK1 and HeLa). The apoptotic cell rate was determined in five different fields under microscopic observations. * A significant difference was observed between the Ad-SGE-REIC group and the other treatment groups. (C) The apoptotic cell rate (%) was examined under different experimental conditions (Ad-LacZ, Ad-CMV-REIC, Ad-CAG-REIC or Ad-SGE-REIC at a 100 MOI for 72 h) in the human cancer cells (211H, PC3 and KPK1). * A significant difference was observed between the Ad-SGE-REIC group and the other treatment groups. SGE, super gene expression; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; MOI, multiplicity of infection.
Figure Legend Snippet: (A) The induction of apoptosis after Ad-REIC treatment is shown by Hoechst 33342 staining in 211H human malignant mesothelioma cells. Apoptotic cells can be clearly observed as bright cells under fluorescence microscopy (left panel). The appearance of the cells by phase contrast microscopy is also shown (right panel). (B) The apoptotic cell rate (%) was examined after the indicated treatments (no treatment, Ad-LacZ, Ad-CMV-REIC, Ad-CAG-REIC and Ad-SGE-REIC at 50 MOI for 48 h) in normal human cells (HC, hepatocytes; OUMS24, fibroblasts) and various human cancer cell lines (211H, PC3, KPK1 and HeLa). The apoptotic cell rate was determined in five different fields under microscopic observations. * A significant difference was observed between the Ad-SGE-REIC group and the other treatment groups. (C) The apoptotic cell rate (%) was examined under different experimental conditions (Ad-LacZ, Ad-CMV-REIC, Ad-CAG-REIC or Ad-SGE-REIC at a 100 MOI for 72 h) in the human cancer cells (211H, PC3 and KPK1). * A significant difference was observed between the Ad-SGE-REIC group and the other treatment groups. SGE, super gene expression; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; MOI, multiplicity of infection.

Techniques Used: Staining, Fluorescence, Microscopy, Expressing, Infection

15) Product Images from "Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿"

Article Title: Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿

Journal:

doi: 10.1128/MCB.01120-07

Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.
Figure Legend Snippet: Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.

Techniques Used: DNA Methylation Assay, In Vitro, Methylation, Plasmid Preparation, Transfection

RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A
Figure Legend Snippet: RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A

Techniques Used: Methylation, In Vitro, Transfection

16) Product Images from "Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿"

Article Title: Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿

Journal:

doi: 10.1128/MCB.01120-07

Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.
Figure Legend Snippet: Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.

Techniques Used: DNA Methylation Assay, In Vitro, Methylation, Plasmid Preparation, Transfection

RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A
Figure Legend Snippet: RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A

Techniques Used: Methylation, In Vitro, Transfection

17) Product Images from "Fluorescence detection of DNA mismatch repair in human cells"

Article Title: Fluorescence detection of DNA mismatch repair in human cells

Journal: Scientific Reports

doi: 10.1038/s41598-018-30733-x

Fluorescence detection of DNA repair in cells. ( a . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.
Figure Legend Snippet: Fluorescence detection of DNA repair in cells. ( a . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.

Techniques Used: Fluorescence, Binding Assay, Plasmid Preparation, Transformation Assay, Produced

18) Product Images from "A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells"

Article Title: A lentiviral microRNA-based system for single-copy polymerase II-regulated RNA interference in mammalian cells

Journal: Proceedings of the National Academy of Sciences of the United States of America

doi: 10.1073/pnas.0506306102

Tet-regulatable pPRIME vectors generate highly penetrant knockdown at single copy. ( A ) Schematic representation of the TREX system. In the absence of DOX, the Tet repressor (TetR) binds to the Tet-operator binding sites located downstream of CMV's TATA box, thereby preventing transcription. Binding of DOX to TetR causes its displacement from the CMV promoter, thus allowing for transcription of the GFP–miR30–shRNA transcript. ( B ) 293 TREX cells were transduced with the indicated lentiviruses (MOI
Figure Legend Snippet: Tet-regulatable pPRIME vectors generate highly penetrant knockdown at single copy. ( A ) Schematic representation of the TREX system. In the absence of DOX, the Tet repressor (TetR) binds to the Tet-operator binding sites located downstream of CMV's TATA box, thereby preventing transcription. Binding of DOX to TetR causes its displacement from the CMV promoter, thus allowing for transcription of the GFP–miR30–shRNA transcript. ( B ) 293 TREX cells were transduced with the indicated lentiviruses (MOI

Techniques Used: Binding Assay, shRNA, Transduction

pPRIME vectors can accommodate a variety of reporter genes. ( A ) Schematic representation of pPRIME–CMV derivatives. For more detailed vector information see Fig. 6. PGK, phosphoglycerate kinase promoter; IRES, internal ribosome entry site. ( B ) U2OS cells were transduced with the indicated lentiviruses (MOI
Figure Legend Snippet: pPRIME vectors can accommodate a variety of reporter genes. ( A ) Schematic representation of pPRIME–CMV derivatives. For more detailed vector information see Fig. 6. PGK, phosphoglycerate kinase promoter; IRES, internal ribosome entry site. ( B ) U2OS cells were transduced with the indicated lentiviruses (MOI

Techniques Used: Plasmid Preparation, Transduction

19) Product Images from "Double conditional human embryonic kidney cell line based on FLP and ?C31 mediated transgene integration"

Article Title: Double conditional human embryonic kidney cell line based on FLP and ?C31 mediated transgene integration

Journal: BMC Research Notes

doi: 10.1186/1756-0500-4-420

Scheme of the two independent integration systems used . A : FRT docking site is used as in the Flp-In T-Rex™ system (Invitrogen). The FRT sequence is placed downstream and in frame of the translational initiation codon ATG from the lacZ-zeocin fusion protein. After FLP mediated recombination with the FRT sequence of the integration vector, lacZ-zeocin expression is turned off and hygromycin resistance is activated. The GOI (gene-of-interest) is placed downstream of the hygromycin resistance cassette and controlled by the tetracyclin inducible CMV promoter containing the two tetracycline operators (2xtetO). B : attP docking site for ΦC31 integrase mediated integration. The attP sequence is placed downstream and in frame of the translational initiation codon ATG from the ECFP-Neo fusion protein. After ΦC31 mediated recombination with the attB sequence of the integration vector, ECFP-Neo expression is turned off and puromycin resistance is activated. The GOI is placed downstream of the puromycin resistance cassette and controlled by the CMV promoter. The N-terminal destabilizing domain (DD) is linked to the GOI to allow regulation by Shld1.
Figure Legend Snippet: Scheme of the two independent integration systems used . A : FRT docking site is used as in the Flp-In T-Rex™ system (Invitrogen). The FRT sequence is placed downstream and in frame of the translational initiation codon ATG from the lacZ-zeocin fusion protein. After FLP mediated recombination with the FRT sequence of the integration vector, lacZ-zeocin expression is turned off and hygromycin resistance is activated. The GOI (gene-of-interest) is placed downstream of the hygromycin resistance cassette and controlled by the tetracyclin inducible CMV promoter containing the two tetracycline operators (2xtetO). B : attP docking site for ΦC31 integrase mediated integration. The attP sequence is placed downstream and in frame of the translational initiation codon ATG from the ECFP-Neo fusion protein. After ΦC31 mediated recombination with the attB sequence of the integration vector, ECFP-Neo expression is turned off and puromycin resistance is activated. The GOI is placed downstream of the puromycin resistance cassette and controlled by the CMV promoter. The N-terminal destabilizing domain (DD) is linked to the GOI to allow regulation by Shld1.

Techniques Used: Sequencing, Plasmid Preparation, Expressing

20) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

21) Product Images from "Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *"

Article Title: Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *

Journal: The Journal of Biological Chemistry

doi: 10.1074/jbc.M111.289546

HEK cells expressing α4β2 nAChRs were transiently transfected with plasmid DNA containing the firefly luciferase gene that is expressed from a CMV promoter. Cells were treated with 1 μ m nicotine ( Nic ), 1 m m carbachol ( Carb ), 1
Figure Legend Snippet: HEK cells expressing α4β2 nAChRs were transiently transfected with plasmid DNA containing the firefly luciferase gene that is expressed from a CMV promoter. Cells were treated with 1 μ m nicotine ( Nic ), 1 m m carbachol ( Carb ), 1

Techniques Used: Expressing, Transfection, Plasmid Preparation, Luciferase

22) Product Images from "Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿"

Article Title: Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿

Journal:

doi: 10.1128/MCB.01120-07

Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.
Figure Legend Snippet: Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.

Techniques Used: DNA Methylation Assay, In Vitro, Methylation, Plasmid Preparation, Transfection

RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A
Figure Legend Snippet: RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A

Techniques Used: Methylation, In Vitro, Transfection

23) Product Images from "Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿"

Article Title: Acetylation-Induced Transcription Is Required for Active DNA Demethylation in Methylation-Silenced Genes ▿

Journal:

doi: 10.1128/MCB.01120-07

Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.
Figure Legend Snippet: Time course of association of H3K4me3 with the 5′ end of GFP and the DNA methylation status of the associated CMV promoter. In vitro-methylated pCMV-GFP plasmid was transfected into HEK 293 cells, which were treated with TSA at 24 h posttransfection.

Techniques Used: DNA Methylation Assay, In Vitro, Methylation, Plasmid Preparation, Transfection

RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A
Figure Legend Snippet: RNAP II transcribes and binds the methylated CMV promoter. In vitro-methylated pCMV-GFP was transfected into HEK 293 cells, and at 24 h posttransfection, cells were treated with TSA. Cells were harvested at different time periods of TSA treatment. (A

Techniques Used: Methylation, In Vitro, Transfection

24) Product Images from "Distribution, Cleavage and Lipidation of Atg8 Fusion Proteins in Spodoptera litura Sl-HP Cells"

Article Title: Distribution, Cleavage and Lipidation of Atg8 Fusion Proteins in Spodoptera litura Sl-HP Cells

Journal: PLoS ONE

doi: 10.1371/journal.pone.0096059

Construction of plasmids. The commercial plasmids pEGFP-C1 and pEGFP-N1 contain the CMV promoter which acts in mammalian cells, and the promoter of baculovirus ie2 which works in insect cells derives from the plasmid pIZ-V5/His. All the recombinant plasmids contained the promoter of ie2 following the promoter of CMV except pie2/EGFP-Atg8, which had no the promoter of CMV. The EGFP after Atg8 did not express because Atg8 has a stop codon. PCR was used for site-directed mutagenesis and truncation of open reading frames. Atg8 116G has a glycine (G) residue at C terminus (the 116 th amino acid residue). Atg8 62 had 62 amino acid residues of the N terminus of Atg8. F77/79A and F60/62A indicated that tyrosine (F) residues were replaced with alanine (A) residues.
Figure Legend Snippet: Construction of plasmids. The commercial plasmids pEGFP-C1 and pEGFP-N1 contain the CMV promoter which acts in mammalian cells, and the promoter of baculovirus ie2 which works in insect cells derives from the plasmid pIZ-V5/His. All the recombinant plasmids contained the promoter of ie2 following the promoter of CMV except pie2/EGFP-Atg8, which had no the promoter of CMV. The EGFP after Atg8 did not express because Atg8 has a stop codon. PCR was used for site-directed mutagenesis and truncation of open reading frames. Atg8 116G has a glycine (G) residue at C terminus (the 116 th amino acid residue). Atg8 62 had 62 amino acid residues of the N terminus of Atg8. F77/79A and F60/62A indicated that tyrosine (F) residues were replaced with alanine (A) residues.

Techniques Used: Plasmid Preparation, Recombinant, Polymerase Chain Reaction, Mutagenesis

25) Product Images from "A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput"

Article Title: A Simplified Positive-Sense-RNA Virus Construction Approach That Enhances Analysis Throughput

Journal: Journal of Virology

doi: 10.1128/JVI.02261-13

Construction of DENV by Gibson assembly. (A) Assembly schemes of DENV infectious DNA. CMV, CMV promoter; HDV, HDV ribozyme; SV40PA, polyadenylation signal. (Left) Assembly scheme for DENV2-16681 and DENV4-H241; (right) assembly scheme for DENV4-v17. (B) The comparison between the foci of the original virus stocks and the foci of viruses recovered through Gibson assembly. The number of DENV PCR products assembled (# PCR) is shown. (C) PCR products for sequencing of virus recovered from transfected 293T cells were generated from cDNA and not contaminated assembled DNA. +, viral RNA was treated with RNase A during cDNA synthesis. (D) Comparison between sequence heterogeneities of the original v17 strain, v17 recovered by our method, and v17 cultured in C6/36 cells. The heterogeneous positions are highlighted in yellow.
Figure Legend Snippet: Construction of DENV by Gibson assembly. (A) Assembly schemes of DENV infectious DNA. CMV, CMV promoter; HDV, HDV ribozyme; SV40PA, polyadenylation signal. (Left) Assembly scheme for DENV2-16681 and DENV4-H241; (right) assembly scheme for DENV4-v17. (B) The comparison between the foci of the original virus stocks and the foci of viruses recovered through Gibson assembly. The number of DENV PCR products assembled (# PCR) is shown. (C) PCR products for sequencing of virus recovered from transfected 293T cells were generated from cDNA and not contaminated assembled DNA. +, viral RNA was treated with RNase A during cDNA synthesis. (D) Comparison between sequence heterogeneities of the original v17 strain, v17 recovered by our method, and v17 cultured in C6/36 cells. The heterogeneous positions are highlighted in yellow.

Techniques Used: Polymerase Chain Reaction, Sequencing, Transfection, Generated, Cell Culture

26) Product Images from "Fluorescence detection of DNA mismatch repair in human cells"

Article Title: Fluorescence detection of DNA mismatch repair in human cells

Journal: Scientific Reports

doi: 10.1038/s41598-018-30733-x

Fluorescence detection of DNA repair in cells. ( a . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.
Figure Legend Snippet: Fluorescence detection of DNA repair in cells. ( a . The probe contained an oxidatively damaged base in the center and a fluorophore–quencher pair at the end, and the phosphodiester linkages were changed to nuclease-resistant phosphorothioate analogs in the regions that were not required for enzyme binding. Fluorescence was detected when the probe was cleaved by NTH1 in human cells. ( b . A plasmid was used as a scaffold, and the fluorophore and the quencher were attached to the base moieties near a UV-induced lesion. Fluorescence was detected when the dual-incision product was degraded in cells. ( c ) Detection of MMR in this study. Cells are transformed with a plasmid containing a mismatch (shown in red) in the EGFP gene, which is expressed under the control of the CMV promoter. In the absence of MMR, the mRNA transcript contains a stop codon, UAG. However, when the cells are MMR-proficient, the repair of the bottom strand results in the generation of the original EGFP gene, and fluorescence is detected in the cells. We expected that the initial nick required for MMR would be produced in the cells in a random manner. There is a possibility that the top strand is repaired, but the full-length EGFP is not produced in this case.

Techniques Used: Fluorescence, Binding Assay, Plasmid Preparation, Transformation Assay, Produced

27) Product Images from "High-efficiency Transient Transduction of Human Embryonic Stem Cell-derived Neurons With Baculoviral Vectors"

Article Title: High-efficiency Transient Transduction of Human Embryonic Stem Cell-derived Neurons With Baculoviral Vectors

Journal: Molecular Therapy: the Journal of the American Society of Gene Therapy

doi: 10.1038/mt.2009.124

Effects of baculoviral vectors on the survival of HES-1–derived human neurons. Cells were prepared in a 96-well plate and transduced by BV-CMV.eGFP-WPRE or BacPAK6, a baculoviral vector without a mammalian gene expression cassette, at the indicated
Figure Legend Snippet: Effects of baculoviral vectors on the survival of HES-1–derived human neurons. Cells were prepared in a 96-well plate and transduced by BV-CMV.eGFP-WPRE or BacPAK6, a baculoviral vector without a mammalian gene expression cassette, at the indicated

Techniques Used: Derivative Assay, Plasmid Preparation, Expressing

Transgene expression in human neurons mediated by baculoviral vectors. ( a ) Phase contrast and fluorescence images of a group of live human neuron clusters transduced by baculoviral vectors carrying the expression cassette CMV.eGFP at a multiplicity of
Figure Legend Snippet: Transgene expression in human neurons mediated by baculoviral vectors. ( a ) Phase contrast and fluorescence images of a group of live human neuron clusters transduced by baculoviral vectors carrying the expression cassette CMV.eGFP at a multiplicity of

Techniques Used: Expressing, Fluorescence

Transplantation of baculovirus-transduced human neurons into the brain of nude mice. HES-1–derived human neurons were transduced by BV-CMV.eGFP-WPRE at a multiplicity of infection of 100 plaque-forming units per cell. These modified neurons were
Figure Legend Snippet: Transplantation of baculovirus-transduced human neurons into the brain of nude mice. HES-1–derived human neurons were transduced by BV-CMV.eGFP-WPRE at a multiplicity of infection of 100 plaque-forming units per cell. These modified neurons were

Techniques Used: Transplantation Assay, Mouse Assay, Derivative Assay, Infection, Modification

Co-transduction of human neurons using Organelle Lights and baculoviral vectors. HSE-1–derived human neurons were transduced by Organelle Lights ER-OFP or Mito-OFP on day 1 and BV-CMV.eGFP-WPRE on day 2. The expression of both fluorescence proteins
Figure Legend Snippet: Co-transduction of human neurons using Organelle Lights and baculoviral vectors. HSE-1–derived human neurons were transduced by Organelle Lights ER-OFP or Mito-OFP on day 1 and BV-CMV.eGFP-WPRE on day 2. The expression of both fluorescence proteins

Techniques Used: Transduction, Derivative Assay, Expressing, Fluorescence

28) Product Images from "Construction and In Vitro Properties of a Series of Attenuated Simian Immunodeficiency Viruses with All Accessory Genes Deleted"

Article Title: Construction and In Vitro Properties of a Series of Attenuated Simian Immunodeficiency Viruses with All Accessory Genes Deleted

Journal: Journal of Virology

doi: 10.1128/JVI.75.9.4056-4067.2001

Schematic illustration of the SIV constructs generated. All enzyme sites used are indicated, and both deletions ( ) and alternative elements ( ) are shown. (A) Construction of simplified SIVs. All mutants contain two deletions. In the case of the SIVmac239 Δ4 construct, one deletion involves the vpx , vpr , and tat genes (from positions 6241 to 6702), while the other results in inactivation of nef (positions 9500 to 9674). The Δ5 and Δ6 constructs are identical to Δ4 except that the first deletion was extended to also delete the vif gene (positions 5667 to 6702) and both the vif and rev genes (positions 5667 to 6859), respectively. To generate Δ6-CTE, a 173-bp CTE of SRV-1 was inserted into the Δ6 vector at the position of the nef deletion. The Δ6-CTE-CMV construct was derived from Δ6-CTE by replacing both the 5′ and 3′ LTRs with a chimeric LTR containing the CMV IE promoter. The Δ6-CTE-CMV-IRES (Δ6CCI) construct was generated by insertion of an IRES element immediately upstream of the env gene in the Δ6-CTE-CMV vector. The Δ6CCI constructs that contained a poliovirus-derived IRES and an ECMV-derived IRES are designated Δ6CCI-P and Δ6CCI-E, respectively. The Δ5CCI construct is identical to Δ6CCI-P except that the vif gene is retained. WT, wild type. (B) Construction of SIV mutants that retain the rev gene. SIVmac239Δnef-CMV contains both the chimeric CMV-LTR insert and the nef deletion, while the Δ2-CMV construct contains additional mutations in the first exon of tat (which truncates the tat gene). Δ4-CMV and Δ5- CMV are identical to Δ4 and Δ5 except that both the 5′ and 3′ LTRs were replaced with the chimeric CMV-LTR. (C) Construction of the simplified SIV vector, SIVmac239Δ6-CTE-CMV-IRES-GFP (Δ6CCI-GFP), containing the EGFP reporter gene. Similar to the case of Δ6CCI, the Δ6CCI-GFP constructs that contained a poliovirus-derived IRES and an ECMV-derived IRES are termed Δ6CCI-P-GFP and Δ6CCI-E-GFP, respectively.
Figure Legend Snippet: Schematic illustration of the SIV constructs generated. All enzyme sites used are indicated, and both deletions ( ) and alternative elements ( ) are shown. (A) Construction of simplified SIVs. All mutants contain two deletions. In the case of the SIVmac239 Δ4 construct, one deletion involves the vpx , vpr , and tat genes (from positions 6241 to 6702), while the other results in inactivation of nef (positions 9500 to 9674). The Δ5 and Δ6 constructs are identical to Δ4 except that the first deletion was extended to also delete the vif gene (positions 5667 to 6702) and both the vif and rev genes (positions 5667 to 6859), respectively. To generate Δ6-CTE, a 173-bp CTE of SRV-1 was inserted into the Δ6 vector at the position of the nef deletion. The Δ6-CTE-CMV construct was derived from Δ6-CTE by replacing both the 5′ and 3′ LTRs with a chimeric LTR containing the CMV IE promoter. The Δ6-CTE-CMV-IRES (Δ6CCI) construct was generated by insertion of an IRES element immediately upstream of the env gene in the Δ6-CTE-CMV vector. The Δ6CCI constructs that contained a poliovirus-derived IRES and an ECMV-derived IRES are designated Δ6CCI-P and Δ6CCI-E, respectively. The Δ5CCI construct is identical to Δ6CCI-P except that the vif gene is retained. WT, wild type. (B) Construction of SIV mutants that retain the rev gene. SIVmac239Δnef-CMV contains both the chimeric CMV-LTR insert and the nef deletion, while the Δ2-CMV construct contains additional mutations in the first exon of tat (which truncates the tat gene). Δ4-CMV and Δ5- CMV are identical to Δ4 and Δ5 except that both the 5′ and 3′ LTRs were replaced with the chimeric CMV-LTR. (C) Construction of the simplified SIV vector, SIVmac239Δ6-CTE-CMV-IRES-GFP (Δ6CCI-GFP), containing the EGFP reporter gene. Similar to the case of Δ6CCI, the Δ6CCI-GFP constructs that contained a poliovirus-derived IRES and an ECMV-derived IRES are termed Δ6CCI-P-GFP and Δ6CCI-E-GFP, respectively.

Techniques Used: Construct, Generated, Plasmid Preparation, Derivative Assay

Growth curves of viruses containing a chimeric CMV-LTR. Equivalent amounts of viruses were used to infect CEMx174 cells. Viral replication was monitored by RT assay of culture fluids. Mock infection denotes exposure of cells to heat-inactivated wild-type (WT) virus as a negative control.
Figure Legend Snippet: Growth curves of viruses containing a chimeric CMV-LTR. Equivalent amounts of viruses were used to infect CEMx174 cells. Viral replication was monitored by RT assay of culture fluids. Mock infection denotes exposure of cells to heat-inactivated wild-type (WT) virus as a negative control.

Techniques Used: Infection, Negative Control

29) Product Images from "A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines"

Article Title: A Novel Dual-Color Reporter for Identifying Insulin-Producing Beta- Cells and Classifying Heterogeneity of Insulinoma Cell Lines

Journal: PLoS ONE

doi: 10.1371/journal.pone.0035521

Specificity of the human insulin promoter (378-nt region) to identify insulin-producing cells and a direct dual-color reporter system. (a) Schematic picture of the proximal 378-nt region (−363 to +15) of the human insulin promoter containing several regulatory motifs for expression of the insulin gene. (b) The phINS-EGFP construct [6] used to express EGFP in insulin-producing cells. (c) phINS-EGFP was transfected into HIT-T15 or NT-2 cells. After 2 days, some HIT-T15 cells expressed EGFP, but NT-2 cells did not. When pCMV-EGFP was transfected, both cell lines expressed EGFP, suggesting the specificity of the 378-nt region to identify insulin-producing cells. (d) Schematic picture of a direct dual-color reporter that contains a human insulin promoter driving expression of EGFP and a CMV promoter driving expression of dsRed (phINS-EGFP-CMV-dsRed). (e) Stable transfection of phINS-EGFP-CMV-dsRed into HIT-T15. Many cells displayed red or yellow fluorescence, but a small population of cells unexpectedly appeared to express primarily green fluorescence (white arrows).
Figure Legend Snippet: Specificity of the human insulin promoter (378-nt region) to identify insulin-producing cells and a direct dual-color reporter system. (a) Schematic picture of the proximal 378-nt region (−363 to +15) of the human insulin promoter containing several regulatory motifs for expression of the insulin gene. (b) The phINS-EGFP construct [6] used to express EGFP in insulin-producing cells. (c) phINS-EGFP was transfected into HIT-T15 or NT-2 cells. After 2 days, some HIT-T15 cells expressed EGFP, but NT-2 cells did not. When pCMV-EGFP was transfected, both cell lines expressed EGFP, suggesting the specificity of the 378-nt region to identify insulin-producing cells. (d) Schematic picture of a direct dual-color reporter that contains a human insulin promoter driving expression of EGFP and a CMV promoter driving expression of dsRed (phINS-EGFP-CMV-dsRed). (e) Stable transfection of phINS-EGFP-CMV-dsRed into HIT-T15. Many cells displayed red or yellow fluorescence, but a small population of cells unexpectedly appeared to express primarily green fluorescence (white arrows).

Techniques Used: Expressing, Construct, Transfection, Stable Transfection, Fluorescence

“Indirect
Figure Legend Snippet: “Indirect" dual-color design of the reporter construct. (a) Transfection of cells with CMV-L-mCherry-L-EGFP. Without Cre recombinase in the construct, all cells exhibited red fluorescence. (b) Schematic and anticipated behavior of pA-Cre-phIns-CMV-L-mCherry-L-EGFP. INS + beta-cells transfected by this plasmid should activate Cre recombinase expression and excise the mCherry reporter by Cre-LoxP recombination, thus converting red fluorescence to green. In contrast, transfected INS − non-beta-cells should only exhibit red fluorescence. (c) After transfection of cells with pA-Cre-phIns-CMV-L-mCherry-L-EGFP, HIT-T15 and INS-1 expressed EGFP, indicating that mCherry was excised by Cre recombinase expressed under the human insulin promoter. This demonstrates the reporter's specificity to produce EGFP in only INS + cells. (d) Highly magnified (63×) projection images of two yellow cells marked as the white square with a white arrow in Fig. 2c from Z-stacks (10×), illustrating both red and green fluorescence. In the middle panel, the 3D picture shows co-localization of both colors (B, bottom; T, top). (e) Stable HIT-T15 cell population containing the “indirect" dual-color construct (Neo r ). ∼70% of the stably transfected cells were green, indicating mCherry excision. Another ∼10% were red, indicating the absence of mCherry excision and suggesting that the insulin promoter was never activated. The remaining ∼20% of cells exhibited no fluorescence, suggesting transcriptional inactivation of the CMV promoter. The right panel depicts the cells after more than 6 days in culture, compared to cells at 1 day after splitting shown in the left panel. No yellow fluorescent cells were observed. These results suggest that at least two phenotypically heterogeneous cells arise in the HIT-T15 cell culture model.

Techniques Used: Construct, Transfection, Fluorescence, Plasmid Preparation, Expressing, Stable Transfection, Cell Culture

30) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )
Figure Legend Snippet: Orientation of the 3′-CMV promoter-independent gene expression. a Orientation of the 3′-CMV promoter in the CMV-KLF16-CMV construct was flipped, termed CMV-KLF16-CMV (flipped), and then expression of KLF16 protein was assessed by Western blot analysis after transfecting the plasmid including indicated comparative vectors in HEK293. Tubulin was used as a control for loaded amounts of protein. b Primers were designed to the indicated locations of the CMV-KLF16-CMV and the CMV-KLF16-CMV (flipped) constructs (see Materials and Methods )

Techniques Used: Expressing, Construct, Western Blot, Plasmid Preparation

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

31) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

32) Product Images from "A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector"

Article Title: A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector

Journal: Oncology Reports

doi: 10.3892/or.2013.2958

(A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.
Figure Legend Snippet: (A) A schematic diagram of the conventional gene expression system and the SGE system. In the SGE system, triple translational enhancer sequences (hTERT, SV40 and CMV) were inserted downstream of the BGH polyA sequence. (B) The pShuttle plasmid vector with the conventional system and SGE system encoding the REIC/Dkk-3 gene were termed pShuttle-REIC and pShuttle-SGE-REIC, respectively. The REIC/Dkk-3 expression levels after transfection with the pShuttle-REIC and pShuttle-SGE-REIC plasmids were compared by western blot analysis in HEK293 cells. SGE, super gene expression; hTERT, human telomerase reverse transcriptase; SV40, Simian virus 40; REIC, reduced expression in immortalized cells; CMV, cytomegalovirus; Dkk-3, Dickkopf-3.

Techniques Used: Expressing, Sequencing, Plasmid Preparation, Transfection, Western Blot

33) Product Images from "Tissue-Specific Transcriptional Targeting of a Replication-Competent Retroviral Vector"

Article Title: Tissue-Specific Transcriptional Targeting of a Replication-Competent Retroviral Vector

Journal: Journal of Virology

doi: 10.1128/JVI.76.24.12783-12791.2002

Constructs used in this study. (A) Sequences used in generating hybrid LTRs. The proximal rat PB promoter (left) contains CAAT and TATA box homologies and an ARR (shown as a hatched box) important for androgen induction of transcription. ARR 2 PB (center) is a synthetic variant of the PB promoter and contains two copies of the ARR. The MLV LTR (right) comprises the U3, R, and U5 regions. The transcriptional control sequences of MLV are located primarily in the U3 region, which also contains CAAT and TATA box sequences. (B) Hybrid LTRs containing the wt PB promoter. LTRs Pr, Pt, and Pc contain PB promoter sequences from position −383 to the transcription start site (TSS), TATA box, and CAAT box, respectively. (C) Hybrid LTRs containing ARR 2 PB. LTRs Ar, At, and Ac contain ARR 2 PB sequences from the 5′ end of the upstream ARR to the TSS, TATA box, and CAAT box, respectively. In each of the six hybrid LTRs, MLV U3 sequences from the Nhe I site to the TSS, TATA box, or CAAT box were replaced with the corresponding PB or ARR 2 PB sequences. (D) Sequence details of the hybrid LTRs. Shown are the nucleotide sequences at the 3′ borders between the PB and MLV sequences. TATA and CAAT boxes are underlined. TSS, transcription start site. (E) Luciferase reporter constructs containing hybrid LTRs. (F) Structure of replication-competent MLV vectors containing hybrid LTRs. Each vector contains an IRES-GFP cassette positioned immediately downstream of the env gene and a 5′ LTR in which the U3 region was replaced by the CMV immediate-early promoter. The 3′ LTR is used to form the 5′ LTR during MLV replication. We therefore replaced the 3′ LTR of the RCR vector with the hybrid LTRs.
Figure Legend Snippet: Constructs used in this study. (A) Sequences used in generating hybrid LTRs. The proximal rat PB promoter (left) contains CAAT and TATA box homologies and an ARR (shown as a hatched box) important for androgen induction of transcription. ARR 2 PB (center) is a synthetic variant of the PB promoter and contains two copies of the ARR. The MLV LTR (right) comprises the U3, R, and U5 regions. The transcriptional control sequences of MLV are located primarily in the U3 region, which also contains CAAT and TATA box sequences. (B) Hybrid LTRs containing the wt PB promoter. LTRs Pr, Pt, and Pc contain PB promoter sequences from position −383 to the transcription start site (TSS), TATA box, and CAAT box, respectively. (C) Hybrid LTRs containing ARR 2 PB. LTRs Ar, At, and Ac contain ARR 2 PB sequences from the 5′ end of the upstream ARR to the TSS, TATA box, and CAAT box, respectively. In each of the six hybrid LTRs, MLV U3 sequences from the Nhe I site to the TSS, TATA box, or CAAT box were replaced with the corresponding PB or ARR 2 PB sequences. (D) Sequence details of the hybrid LTRs. Shown are the nucleotide sequences at the 3′ borders between the PB and MLV sequences. TATA and CAAT boxes are underlined. TSS, transcription start site. (E) Luciferase reporter constructs containing hybrid LTRs. (F) Structure of replication-competent MLV vectors containing hybrid LTRs. Each vector contains an IRES-GFP cassette positioned immediately downstream of the env gene and a 5′ LTR in which the U3 region was replaced by the CMV immediate-early promoter. The 3′ LTR is used to form the 5′ LTR during MLV replication. We therefore replaced the 3′ LTR of the RCR vector with the hybrid LTRs.

Techniques Used: Construct, Variant Assay, Sequencing, Luciferase, Plasmid Preparation

34) Product Images from "Real-time monitoring of NF-kappaB activity in cultured cells and in animal models"

Article Title: Real-time monitoring of NF-kappaB activity in cultured cells and in animal models

Journal: Molecular imaging

doi:

Monitoring of NFkB activation in culture. (a b) 293T cells were transfected with a plasmid carrying the expression cassette for Gluc under control of the NFkB, CMV or SV40 promoter and treated with TNFα (10 ng/ml). 24 h later, aliquots
Figure Legend Snippet: Monitoring of NFkB activation in culture. (a b) 293T cells were transfected with a plasmid carrying the expression cassette for Gluc under control of the NFkB, CMV or SV40 promoter and treated with TNFα (10 ng/ml). 24 h later, aliquots

Techniques Used: Activation Assay, Transfection, Plasmid Preparation, Expressing

35) Product Images from "Reversible and Rapid Transfer-RNA Deactivation as a Mechanism of Translational Repression in Stress"

Article Title: Reversible and Rapid Transfer-RNA Deactivation as a Mechanism of Translational Repression in Stress

Journal: PLoS Genetics

doi: 10.1371/journal.pgen.1003767

Scanning-independent translation initiation is less influenced by low dose oxidative stress. (A) Polysomal profiles of untreated or arsenite treated HeLa cells. (B) Schematic of the plasmid used to monitor cap-dependent and IRES-dependent translation initiation. Inhibition of cap-dependent, Rluc (C) or IRES-mediated, Fluc (D) translation upon exposure to oxidative stress. HeLa cells expressing the bicistronic construct encoding Rluc under the CMV-promoter (scanning-dependent translation) and Fluc under the CrPV-IRES (non-scanning controlled translation) were exposed to different arsenite concentrations for various times. Addition of DMSO to the cells served as a control. Data in (C) and (D) ± SEM are normalized to the first data point for which the activity was set as 100.
Figure Legend Snippet: Scanning-independent translation initiation is less influenced by low dose oxidative stress. (A) Polysomal profiles of untreated or arsenite treated HeLa cells. (B) Schematic of the plasmid used to monitor cap-dependent and IRES-dependent translation initiation. Inhibition of cap-dependent, Rluc (C) or IRES-mediated, Fluc (D) translation upon exposure to oxidative stress. HeLa cells expressing the bicistronic construct encoding Rluc under the CMV-promoter (scanning-dependent translation) and Fluc under the CrPV-IRES (non-scanning controlled translation) were exposed to different arsenite concentrations for various times. Addition of DMSO to the cells served as a control. Data in (C) and (D) ± SEM are normalized to the first data point for which the activity was set as 100.

Techniques Used: Plasmid Preparation, Inhibition, Expressing, Construct, Activity Assay

36) Product Images from "Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies"

Article Title: Near-infrared fluorescent protein iRFP713 as a reporter protein for optogenetic vectors, a transgenic Cre-reporter rat, and other neuronal studies

Journal: Journal of neuroscience methods

doi: 10.1016/j.jneumeth.2017.03.020

Ectopically expressed iRFP713 does not require exogenously-supplied BV for fluorescence A) Increasing amounts of plasmid DNA encoding iRFP713 (top) or IFP1.4 (bottom) were transfected into SH-SY5Y cells and imaged 48 hours later using the 700nm excitation channel of a Li-Cor Odyssey near-infrared scanner. B) SH-SY5Y cells were transfected with plasmids expressing fluorescent proteins driven by the c-fos promoter or the CMV promoter, and then treated with 1 μM PMA for 24 hours. Fluorescence was measured by Li-Cor Odyssey scanning (top three rows) or epifluorescence using “GFP filter set” (bottom row). The observed increase in infrared fluorescence is specific to the c-fos-iRFP construct.
Figure Legend Snippet: Ectopically expressed iRFP713 does not require exogenously-supplied BV for fluorescence A) Increasing amounts of plasmid DNA encoding iRFP713 (top) or IFP1.4 (bottom) were transfected into SH-SY5Y cells and imaged 48 hours later using the 700nm excitation channel of a Li-Cor Odyssey near-infrared scanner. B) SH-SY5Y cells were transfected with plasmids expressing fluorescent proteins driven by the c-fos promoter or the CMV promoter, and then treated with 1 μM PMA for 24 hours. Fluorescence was measured by Li-Cor Odyssey scanning (top three rows) or epifluorescence using “GFP filter set” (bottom row). The observed increase in infrared fluorescence is specific to the c-fos-iRFP construct.

Techniques Used: Fluorescence, Plasmid Preparation, Transfection, Expressing, Construct

37) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

38) Product Images from "Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene"

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene

Journal: Molecular Biotechnology

doi: 10.1007/s12033-014-9738-0

Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )
Figure Legend Snippet: Construction of the C-TSC cassette. a Expression of KLF16 ( top ) or REIC/Dkk-3 ( bottom ) proteins after transfecting the indicated constructs including a vector containing the CAG promoter in HEK293 cells. Tubulin was used as a control for loaded amounts of protein. b To further improve the expression, 3 promoter sequences of hTERT, SV40, and CMV were tandemly inserted downstream of the REIC cDNA-BGH (bovine growth hormone)-polyA signal. RU5′, a part of the HTLV type 1 LTR inserted for better efficiency of transcription and translation. CMV–CMV and CMV–RU5′–hTERT–SV40–CMV were constructed on the basis of pDNR-1r and pIDT-SMART promoter-less vectors ( top ). The vectors were transfected to HEK293 cells, and levels of inserted REIC protein were determined by Western blot analysis ( top ). Tubulin was used as a control for loaded amounts of protein. Finally, we named the improved high expression cassette C-TSC ( bottom )

Techniques Used: Expressing, Construct, Plasmid Preparation, Transfection, Western Blot

39) Product Images from "GLUCOCORTICOIDS INHIBIT NOTCH TARGET GENE EXPRESSION IN OSTEOBLASTS"

Article Title: GLUCOCORTICOIDS INHIBIT NOTCH TARGET GENE EXPRESSION IN OSTEOBLASTS

Journal: Journal of cellular biochemistry

doi: 10.1002/jcb.26798

Cortisol does not affect RBPJ-mediated Notch signaling in osteoblasts. Primary osteoblast-enriched cells were harvested from the parietal bones of 3 to 5 day old wild-type C57BL/6J mice. In panel A, cells were seeded on BSA (white bars) or DLL1 (black bars) and transiently transfected with the 12xCSL-Luc reporter. In panel B, osteoblasts were transiently transfected with pcDNA3.1(−) (pcDNA) or with pcDNA-NICD (NICD) and co-transfected with the 12xCSL-Luc reporter. A CMV/β-galactosidase expression vector was co-transfected to test for transfection efficiency. Cells were allowed to recover for 16 h and subsequently cultured for 6 h in the absence of serum, exposed to vehicle or cortisol 1 μM, and harvested after 24 h. Data represent luciferase/β-galactosidase activity. Values are means ± SD, panel A n = 4; panel B n = 6. *Significantly different between BSA and DLL1 or pcDNA and NICD, p
Figure Legend Snippet: Cortisol does not affect RBPJ-mediated Notch signaling in osteoblasts. Primary osteoblast-enriched cells were harvested from the parietal bones of 3 to 5 day old wild-type C57BL/6J mice. In panel A, cells were seeded on BSA (white bars) or DLL1 (black bars) and transiently transfected with the 12xCSL-Luc reporter. In panel B, osteoblasts were transiently transfected with pcDNA3.1(−) (pcDNA) or with pcDNA-NICD (NICD) and co-transfected with the 12xCSL-Luc reporter. A CMV/β-galactosidase expression vector was co-transfected to test for transfection efficiency. Cells were allowed to recover for 16 h and subsequently cultured for 6 h in the absence of serum, exposed to vehicle or cortisol 1 μM, and harvested after 24 h. Data represent luciferase/β-galactosidase activity. Values are means ± SD, panel A n = 4; panel B n = 6. *Significantly different between BSA and DLL1 or pcDNA and NICD, p

Techniques Used: Mouse Assay, Transfection, Expressing, Plasmid Preparation, Cell Culture, Luciferase, Activity Assay

40) Product Images from "Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon"

Article Title: Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon

Journal: Virology Journal

doi: 10.1186/1743-422X-6-173

Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.
Figure Legend Snippet: Construction and evaluation of a SAV3 based replicon . A) A SAV3 replicon is launched from the CMV promoter (red arrow) in the pVAX1 backbone, and transcription stops at the BGH polyA signal (red box). A synthetic DNA encoding a hammerhead ribozyme was fused to the SAV3 5'-UTR and a polyadenylated tail was fused to the 3'-UTR. The ORF encoding the SAV3 structural proteins was replaced by an ORF encoding EGFP inserted between introduced AgeI and AscI sites. Position of the EcoRI site used for restriction enzyme analysis is indicated. B) Restriction enzyme analysis by digestion of pmSAV3 with EcoRI, AgeI and AscI. Lane 1: Smartladder (Eurogentec). Lane 2: pmSAV3 after triple digest with EcoRI, AgeI and AscI. Bands corresponding to the pVAX1 backbone, nsP coding sequence and EGFP coding sequence are indicated. C) Expression of EGFP in BF2 cells after transfection with pmSAV3. Both CHSE and BF2 cells facilitated successful expression of the EGFP reporter. EGFP expression became visible from day 2 p.t. in CHSE cells and 3 d.p.t. in BF2 cells.

Techniques Used: Sequencing, Expressing, Transfection

Related Articles

Clone Assay:

Article Title: Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation
Article Snippet: .. Plasmid phLtrA1 is an earlier hLtrA expression plasmid in which the human codon-optimized LtrA ORF with an SV40-NLS fused to its C-terminus is cloned behind a CMV promoter in a pIRES vector (Clontech). .. The LtrA ORF contains a small artificial spliceosomal intron, subsequently found to be unnecessary for hLtrA expression, inserted after the start codon and is followed by an SV40 polyadenylation signal. pLtrA is the same except with the native non-codon optimized LtrA ORF.

Transfection:

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene
Article Snippet: .. A quantitative RT-PCR analysis showed that a detectable amount (7.35 ± 3.25) of transcripts containing KLF16 flanked by the 3′-CMV promoter was observed when CMV/AS primer (Fig. b) was used for reverse transcription in cells transfected with the CMV–CMV vector (Table ). .. On the other hand, a significant amount (400.19 ± 47.20) of transcripts containing KLF-16 without the 3′-CMV promoter was detected when KLF16/AS primer (Fig. b) was used for reverse transcription (Table ).

Article Title: Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity
Article Snippet: .. CMV-luc Assay KG-1 cell line, stably transfected with the luciferase Firefly (Luc+ from pGL3 by Promega) reporter gene under the control of the CMV promoter (from pEGFP-N1 by Clontech) partially methylated (50%), is seeded at 20,000 cell per well in 96-well plate. .. After 24 h of incubation in the presence of the compounds or the solvent DMSO, the induction of the promoter is measured by quantification of luciferase with the Brite-lite assay system (Perkin Elmer) according to the manufacturer protocol.

Article Title: Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *
Article Snippet: .. The expression of α4 and β2 nAChR subunits in stably transfected HEK cells are controlled by a CMV promoter. ..

Amplification:

Article Title: Fluorescence detection of DNA mismatch repair in human cells
Article Snippet: .. Preparation of pBSII EGFP The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

Stable Transfection:

Article Title: Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity
Article Snippet: .. CMV-luc Assay KG-1 cell line, stably transfected with the luciferase Firefly (Luc+ from pGL3 by Promega) reporter gene under the control of the CMV promoter (from pEGFP-N1 by Clontech) partially methylated (50%), is seeded at 20,000 cell per well in 96-well plate. .. After 24 h of incubation in the presence of the compounds or the solvent DMSO, the induction of the promoter is measured by quantification of luciferase with the Brite-lite assay system (Perkin Elmer) according to the manufacturer protocol.

Article Title: Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *
Article Snippet: .. The expression of α4 and β2 nAChR subunits in stably transfected HEK cells are controlled by a CMV promoter. ..

Methylation:

Article Title: Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity
Article Snippet: .. CMV-luc Assay KG-1 cell line, stably transfected with the luciferase Firefly (Luc+ from pGL3 by Promega) reporter gene under the control of the CMV promoter (from pEGFP-N1 by Clontech) partially methylated (50%), is seeded at 20,000 cell per well in 96-well plate. .. After 24 h of incubation in the presence of the compounds or the solvent DMSO, the induction of the promoter is measured by quantification of luciferase with the Brite-lite assay system (Perkin Elmer) according to the manufacturer protocol.

Quantitative RT-PCR:

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene
Article Snippet: .. A quantitative RT-PCR analysis showed that a detectable amount (7.35 ± 3.25) of transcripts containing KLF16 flanked by the 3′-CMV promoter was observed when CMV/AS primer (Fig. b) was used for reverse transcription in cells transfected with the CMV–CMV vector (Table ). .. On the other hand, a significant amount (400.19 ± 47.20) of transcripts containing KLF-16 without the 3′-CMV promoter was detected when KLF16/AS primer (Fig. b) was used for reverse transcription (Table ).

Luciferase:

Article Title: Properly Substituted Analogues of BIX-01294 Lose Inhibition of G9a Histone Methyltransferase and Gain Selective Anti-DNA Methyltransferase 3A Activity
Article Snippet: .. CMV-luc Assay KG-1 cell line, stably transfected with the luciferase Firefly (Luc+ from pGL3 by Promega) reporter gene under the control of the CMV promoter (from pEGFP-N1 by Clontech) partially methylated (50%), is seeded at 20,000 cell per well in 96-well plate. .. After 24 h of incubation in the presence of the compounds or the solvent DMSO, the induction of the promoter is measured by quantification of luciferase with the Brite-lite assay system (Perkin Elmer) according to the manufacturer protocol.

Construct:

Article Title: A Translation Initiation Element Specific to mRNAs with Very Short 5?UTR that Also Regulates Transcription
Article Snippet: .. The PSMD8 and RPA39-EGFP constructs were prepared by removing the CMV promoter from EGFP-N1 (Clontech), using the AseI restriction enzyme and filling in with Klenow, and then digesting with HindIII. .. Then the promoter regions from −180 to +50 (PSMD8) and −150 to +47 (RPA39) were amplified and cloned in-frame to the EGFP ATG.

Expressing:

Article Title: Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation
Article Snippet: .. Plasmid phLtrA1 is an earlier hLtrA expression plasmid in which the human codon-optimized LtrA ORF with an SV40-NLS fused to its C-terminus is cloned behind a CMV promoter in a pIRES vector (Clontech). .. The LtrA ORF contains a small artificial spliceosomal intron, subsequently found to be unnecessary for hLtrA expression, inserted after the start codon and is followed by an SV40 polyadenylation signal. pLtrA is the same except with the native non-codon optimized LtrA ORF.

Article Title: A novel gene expression system strongly enhances the anticancer effects of a REIC/Dkk-3-encoding adenoviral vector
Article Snippet: .. It is conceivable that the transcriptional elements of the hTERT, SV40 and CMV triple enhancers interact individually or synergistically with the CMV promoter that drives the gene transcriptional complexes and upregulates the capacity of the cells for gene expression. ..

Article Title: Endogenously Expressed Muscarinic Receptors in HEK293 Cells Augment Up-regulation of Stably Expressed ?4?2 Nicotinic Receptors *
Article Snippet: .. The expression of α4 and β2 nAChR subunits in stably transfected HEK cells are controlled by a CMV promoter. ..

Polymerase Chain Reaction:

Article Title: Fluorescence detection of DNA mismatch repair in human cells
Article Snippet: .. Preparation of pBSII EGFP The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

Plasmid Preparation:

Article Title: The CMV early enhancer/chicken ? actin (CAG) promoter can be used to drive transgene expression during the differentiation of murine embryonic stem cells into vascular progenitors
Article Snippet: .. The primers were designed to yield a plasmid backbone of the pIRES2-EGFP containing an EcoRV site in place of the CMV promoter (pIRES2-EGFP-CMV). pIRES-EGFP-CMV was then cut with EcoRV, dephosphorylated and ligated to the blunt-ended β-actin fragment to generate pIRES2-EGFP(β-actin). .. To create pLK444-GFP, the EGFP cDNA was amplified by PCR from pEGFP-N1 using the primer pair GFPfor and GFPrev (Table ).

Article Title: Fluorescence detection of DNA mismatch repair in human cells
Article Snippet: .. Preparation of pBSII EGFP The DNA fragment containing the CMV promoter, the EGFP gene, and the SV40 polyadenylation (poly(A)) signal was amplified by PCR, using PrimeSTAR Max DNA polymerase (Takara Bio), the pEGFP-C1 vector (Takara Bio USA), and two primers with the sequences of 5′-d(GGG GCGCGC GGACAAACCACAACTAGAATG)-3′ and 5′-d(CCC GCGCGC TAGTTATTAATAGTAATCAAT)-3′, in which the underlines indicate the Bss HII sites. .. After purification by 1% agarose gel electrophoresis (Supplementary Fig. ), the product was treated with Bss HII (New England Biolabs, 5 units) in buffer (10 μl) containing 20 mM Tris-acetate (pH 7.9), 50 mM potassium acetate, 10 mM magnesium acetate, and 100 μg/ml BSA at 50 °C for 1 h. pBlueScript II SK (−) (Agilent Technologies, 2.8 μg) was treated with Bss HII (5 units) and Antarctic phosphatase (New England Biolabs, 5 units) in the above buffer (30 μl) at 50 °C for 1 h. The Bss HII-treated plasmid and the PCR product were precipitated with ethanol, and dissolved in water (25 μl and 10 μl, respectively).

Article Title: Dramatic Increase in Expression of a Transgene by Insertion of Promoters Downstream of the Cargo Gene
Article Snippet: .. A quantitative RT-PCR analysis showed that a detectable amount (7.35 ± 3.25) of transcripts containing KLF16 flanked by the 3′-CMV promoter was observed when CMV/AS primer (Fig. b) was used for reverse transcription in cells transfected with the CMV–CMV vector (Table ). .. On the other hand, a significant amount (400.19 ± 47.20) of transcripts containing KLF-16 without the 3′-CMV promoter was detected when KLF16/AS primer (Fig. b) was used for reverse transcription (Table ).

Article Title: Retrohoming of a Mobile Group II Intron in Human Cells Suggests How Eukaryotes Limit Group II Intron Proliferation
Article Snippet: .. Plasmid phLtrA1 is an earlier hLtrA expression plasmid in which the human codon-optimized LtrA ORF with an SV40-NLS fused to its C-terminus is cloned behind a CMV promoter in a pIRES vector (Clontech). .. The LtrA ORF contains a small artificial spliceosomal intron, subsequently found to be unnecessary for hLtrA expression, inserted after the start codon and is followed by an SV40 polyadenylation signal. pLtrA is the same except with the native non-codon optimized LtrA ORF.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 91
    TaKaRa cmv promotor driven eukaryotic expression vector dsred n1
    Cmv Promotor Driven Eukaryotic Expression Vector Dsred N1, supplied by TaKaRa, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cmv promotor driven eukaryotic expression vector dsred n1/product/TaKaRa
    Average 91 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cmv promotor driven eukaryotic expression vector dsred n1 - by Bioz Stars, 2020-07
    91/100 stars
      Buy from Supplier

    89
    TaKaRa cmv promotor
    Cmv Promotor, supplied by TaKaRa, used in various techniques. Bioz Stars score: 89/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cmv promotor/product/TaKaRa
    Average 89 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cmv promotor - by Bioz Stars, 2020-07
    89/100 stars
      Buy from Supplier

    85
    TaKaRa cytomegalovirus immediate early promotor
    Cytomegalovirus Immediate Early Promotor, supplied by TaKaRa, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/cytomegalovirus immediate early promotor/product/TaKaRa
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    cytomegalovirus immediate early promotor - by Bioz Stars, 2020-07
    85/100 stars
      Buy from Supplier

    Image Search Results