Structured Review

Nacalai chemiluminescence reagents
Chemiluminescence Reagents, supplied by Nacalai, used in various techniques. Bioz Stars score: 91/100, based on 2 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/chemiluminescence reagents/product/Nacalai
Average 91 stars, based on 2 article reviews
Price from $9.99 to $1999.99
chemiluminescence reagents - by Bioz Stars, 2020-08
91/100 stars

Images

Related Articles

Antibody Labeling:

Article Title: Early Reperfusion Following Ischemic Stroke Provides Beneficial Effects, Even After Lethal Ischemia with Mature Neural Cell Death
Article Snippet: .. Antibody labeling of protein bands was detected with enhanced chemiluminescence reagents (Chemi-Lumi One, Nacalai, Tesque, Kyoto, Japan) according to the manufacturer’s instructions. .. Albumin levels were normalized to β-actin using Image J analysis software as previously described [ , ].

Article Title: Leptomeningeal-Derived Doublecortin-Expressing Cells in Poststroke Brain
Article Snippet: .. Antibody labeling of protein bands was detected using enhanced chemiluminescence reagents (Chemi-Lumi One; Nacalai Tesque) according to the manufacturer's instructions. ..

Activity Assay:

Article Title: Establishment of pten knockout medaka with transcription activator–like effector nucleases (TALENs) as a model of PTEN deficiency disease
Article Snippet: .. Peroxidase activity was detected with chemiluminescence reagents (Chemi-Lumi One, Nacalai tesque). .. The intensity of immunoreactive bands was measured with the use of an LAS-3000 Mini instrument and Multi Gauge version 3.0 software (Fujifilm, Tokyo, Japan).

other:

Article Title: Epidermal growth factor receptor promotes glioma progression by regulating xCT and GluN2B‐containing N‐methyl‐d‐aspartate–sensitive glutamate receptor signaling, et al. Epidermal growth factor receptor promotes glioma progression by regulating xCT and GluN2B‐containing N‐methyl‐d‐aspartate–sensitive glutamate receptor signaling
Article Snippet: Immune complexes were detected with HRP‐conjugated secondary antibodies and enhanced chemiluminescence reagents (Nacalai).

Positive Control:

Article Title: Tumor‐suppressive roles of ΔNp63β‐miR‐205 axis in epithelial–mesenchymal transition of oral squamous cell carcinoma via targeting ZEB1 and ZEB2, et al. Tumor‐suppressive roles of ΔNp63β‐miR‐205 axis in epithelial–mesenchymal transition of oral squamous cell carcinoma via targeting ZEB1 and ZEB2
Article Snippet: .. The detection of specific proteins was carried out with enhanced chemiluminescence reagents (Chemi‐Lumi One Super, Nacalai Tesque) and visualized using ImageQuant LAS 4000 (Fuji Film, Tokyo, Japan). β‐actin was used as a positive control. .. 2.8 Small interfering RNA (siRNA) transfection The sequences of the siRNAs used in this study were as follows: ΔNp63 siRNA, 5′‐GGACAGCAGCATTGATCAATT‐3′, scrambled siRNA, 5′‐CAGTCGCGTTTGCGACTGG‐3′ (Sigma–Aldrich, St. Louis, MO).

Software:

Article Title: Regulation of HGF-induced hepatocyte proliferation by the small GTPase Arf6 through the PIP2-producing enzyme PIP5K1A
Article Snippet: .. Chemiluminescence reagents (Nacalai and Thermo Scientific) were used for detection, and the level of PIP3 was quantified by the Image J software. .. Immunocytochemistry HepG2 cells or primary hepatocytes at 5 × 104 cells/12/dish were seeded on gelatin-coated coverslips in the dish and transfected with siRNAs.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 85
    Nacalai chemiluminescence reagents chemi lumi one super
    Chemiluminescence Reagents Chemi Lumi One Super, supplied by Nacalai, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chemiluminescence reagents chemi lumi one super/product/Nacalai
    Average 85 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    chemiluminescence reagents chemi lumi one super - by Bioz Stars, 2020-08
    85/100 stars
      Buy from Supplier

    91
    Nacalai chemiluminescence reagents
    Chemiluminescence Reagents, supplied by Nacalai, used in various techniques. Bioz Stars score: 91/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/chemiluminescence reagents/product/Nacalai
    Average 91 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    chemiluminescence reagents - by Bioz Stars, 2020-08
    91/100 stars
      Buy from Supplier

    Image Search Results