Review





Similar Products

◦ c  (ATCC)
95
ATCC ◦ c
◦ C, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm42018440-125-12-7?v=ATCC
Average 95 stars, based on 1 article reviews
◦ c - by Bioz Stars, 2026-07
95/100 stars
  Buy from Supplier

99
New England Biolabs tcagcccgggatccggccagcttctctgagacgag noti c myc 266 fw 5
Tcagcccgggatccggccagcttctctgagacgag Noti C Myc 266 Fw 5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pmc12209437-435-21-48?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
tcagcccgggatccggccagcttctctgagacgag noti c myc 266 fw 5 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

86
Huafukang Technology male balb c 266 nude mice
Male Balb C 266 Nude Mice, supplied by Huafukang Technology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm41530756-140-1-9?v=Huafukang+Technology
Average 86 stars, based on 1 article reviews
male balb c 266 nude mice - by Bioz Stars, 2026-07
86/100 stars
  Buy from Supplier

99
New England Biolabs tcagcccgggatccggccagcttctctg agacgag noti c myc 266 fw 5
Tcagcccgggatccggccagcttctctg Agacgag Noti C Myc 266 Fw 5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm40588481-358-23-53?v=New+England+Biolabs
Average 99 stars, based on 1 article reviews
tcagcccgggatccggccagcttctctg agacgag noti c myc 266 fw 5 - by Bioz Stars, 2026-07
99/100 stars
  Buy from Supplier

93
ATCC 11 266 299 1xg2 pdb pectin methylesterase solanum lycopersicum
11 266 299 1xg2 Pdb Pectin Methylesterase Solanum Lycopersicum, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pmc11532411__41467_2024_53923_MOESM1_ESM-28-22-61?v=ATCC
Average 93 stars, based on 1 article reviews
11 266 299 1xg2 pdb pectin methylesterase solanum lycopersicum - by Bioz Stars, 2026-07
93/100 stars
  Buy from Supplier

90
Changchun New Industries Optoelectronics uv-c laser mpl-f-266-1μj
Uv C Laser Mpl F 266 1μj, supplied by Changchun New Industries Optoelectronics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm38497596-169-27-38?v=Changchun+New+Industries+Optoelectronics
Average 90 stars, based on 1 article reviews
uv-c laser mpl-f-266-1μj - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

94
Santa Cruz Biotechnology antiiκb α c 21
Antiiκb α C 21, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm34767656-77-55-93?v=Santa+Cruz+Biotechnology
Average 94 stars, based on 1 article reviews
antiiκb α c 21 - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

94
ATCC 266 1017 bp blt amplicons
266 1017 Bp Blt Amplicons, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm36098629-109-10-31?v=ATCC
Average 94 stars, based on 1 article reviews
266 1017 bp blt amplicons - by Bioz Stars, 2026-07
94/100 stars
  Buy from Supplier

90
Biocare Medical primary antibody for d2-40 cat# 266 a, b, c, clone d2-40
Primary Antibody For D2 40 Cat# 266 A, B, C, Clone D2 40, supplied by Biocare Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm35914631-44-6-15?v=Biocare+Medical
Average 90 stars, based on 1 article reviews
primary antibody for d2-40 cat# 266 a, b, c, clone d2-40 - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

90
FUJIFILM zein polymer (melting point ~ 266–283 °c)
Zein Polymer (Melting Point ~ 266–283 °C), supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/c-266/pm34338982-32-1-11?v=FUJIFILM
Average 90 stars, based on 1 article reviews
zein polymer (melting point ~ 266–283 °c) - by Bioz Stars, 2026-07
90/100 stars
  Buy from Supplier

Image Search Results