|
ATCC
◦ c ◦ C, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm42018440-125-12-7?v=ATCC Average 95 stars, based on 1 article reviews
◦ c - by Bioz Stars,
2026-07
95/100 stars
|
Buy from Supplier |
|
New England Biolabs
tcagcccgggatccggccagcttctctgagacgag noti c myc 266 fw 5 Tcagcccgggatccggccagcttctctgagacgag Noti C Myc 266 Fw 5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pmc12209437-435-21-48?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
tcagcccgggatccggccagcttctctgagacgag noti c myc 266 fw 5 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
Huafukang Technology
male balb c 266 nude mice Male Balb C 266 Nude Mice, supplied by Huafukang Technology, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm41530756-140-1-9?v=Huafukang+Technology Average 86 stars, based on 1 article reviews
male balb c 266 nude mice - by Bioz Stars,
2026-07
86/100 stars
|
Buy from Supplier |
|
New England Biolabs
tcagcccgggatccggccagcttctctg agacgag noti c myc 266 fw 5 Tcagcccgggatccggccagcttctctg Agacgag Noti C Myc 266 Fw 5, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm40588481-358-23-53?v=New+England+Biolabs Average 99 stars, based on 1 article reviews
tcagcccgggatccggccagcttctctg agacgag noti c myc 266 fw 5 - by Bioz Stars,
2026-07
99/100 stars
|
Buy from Supplier |
|
ATCC
11 266 299 1xg2 pdb pectin methylesterase solanum lycopersicum 11 266 299 1xg2 Pdb Pectin Methylesterase Solanum Lycopersicum, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pmc11532411__41467_2024_53923_MOESM1_ESM-28-22-61?v=ATCC Average 93 stars, based on 1 article reviews
11 266 299 1xg2 pdb pectin methylesterase solanum lycopersicum - by Bioz Stars,
2026-07
93/100 stars
|
Buy from Supplier |
|
Changchun New Industries Optoelectronics
uv-c laser mpl-f-266-1μj Uv C Laser Mpl F 266 1μj, supplied by Changchun New Industries Optoelectronics, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm38497596-169-27-38?v=Changchun+New+Industries+Optoelectronics Average 90 stars, based on 1 article reviews
uv-c laser mpl-f-266-1μj - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
Santa Cruz Biotechnology
antiiκb α c 21 Antiiκb α C 21, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm34767656-77-55-93?v=Santa+Cruz+Biotechnology Average 94 stars, based on 1 article reviews
antiiκb α c 21 - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
ATCC
266 1017 bp blt amplicons 266 1017 Bp Blt Amplicons, supplied by ATCC, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm36098629-109-10-31?v=ATCC Average 94 stars, based on 1 article reviews
266 1017 bp blt amplicons - by Bioz Stars,
2026-07
94/100 stars
|
Buy from Supplier |
|
Biocare Medical
primary antibody for d2-40 cat# 266 a, b, c, clone d2-40 Primary Antibody For D2 40 Cat# 266 A, B, C, Clone D2 40, supplied by Biocare Medical, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm35914631-44-6-15?v=Biocare+Medical Average 90 stars, based on 1 article reviews
primary antibody for d2-40 cat# 266 a, b, c, clone d2-40 - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |
|
FUJIFILM
zein polymer (melting point ~ 266–283 °c) Zein Polymer (Melting Point ~ 266–283 °C), supplied by FUJIFILM, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/c-266/pm34338982-32-1-11?v=FUJIFILM Average 90 stars, based on 1 article reviews
zein polymer (melting point ~ 266–283 °c) - by Bioz Stars,
2026-07
90/100 stars
|
Buy from Supplier |