Structured Review

TaKaRa bspei
Bspei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bspei/product/TaKaRa
Average 94 stars, based on 9 article reviews
Price from $9.99 to $1999.99
bspei - by Bioz Stars, 2020-02
94/100 stars

Images

Related Articles

Clone Assay:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA). .. The PCR product was digested with EcoRI, and directionality of cloning was confirmed by digestion with SalI. pBMN-IP-UL21 was used to construct a UL21-expressing retrovirus.

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Amplification:

Article Title: DIRECT INDUCTION OF APOPTOSIS USING AN OPTIMAL MITOCHONDRIALLY TARGETED P53
Article Snippet: The DNA encoding p53 was amplified through PCR from pCMV-p53 wt (a generous gift from Dr. S. J. Baker, Addgene, Cambridge, MA) using the primers 5′-GCGCGCGCGCTCCGGAGCCATGGAGGAGCCGCAGT-3′ and 5′-GCGCGCGCGCGGTACCTCAGTCTGAGTCAGGCCCTTCTGTC-3′. .. This was subcloned into the BspEI and KpnI restriction enzyme sites in pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: Plasmids and hormones Full length rat MR was obtained by PCR amplification of plasmid 6RMR [ ] (kind gift from Prof. David Pearce, University of California, San Francisco). .. The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR.

Article Title: Upregulation of CREB-Mediated Transcription Enhances Both Short- and Long-Term Memory
Article Snippet: The KIX domain of CBP and one copy of the nuclear localization signal (nls) was amplified by PCR using RSV-human CBP (kindly provided by R. H. Goodman, Oregon Health and Science University, Portland, OR) as a template and the primers (sense, gggaagctttccggaggcggcggaattcaaaacacaatt; antisense, ggggaatccttagccgtcctccaccttgcgcttcttcttgggcccttgagaaacctgcat). .. To generate a plasmid expressing ECFP-KIXnls (pECFP-KIXnls), the resulting PCR fragment was subcloned into the BspEI and BamHI sites of pECFP-C1 (Clontech).

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The FPs were amplified with a 5' primer encoding an AgeI site and a 3' primer encoding either a BspEI (C1) or Not1 (N1) site. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: To fuse enhanced green fluorescent protein (EGFP) to the C terminus of HSV-2 UL21 (pUL21-GFP), the full-length HSV-2 UL21 DNA sequence was obtained by PCR amplification using primers 5′-TCA TCA GAA TTC ATG GAG CTC AGC TAT GCC A-3′ and 5′-TCA TCA CTC GAG TCA CAC AGA CTG GCC GTG-3′ with HSV-2 strain 186 viral DNA as the template. .. The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Neutralization:

Article Title: ADAM17-dependent signaling is required for oncogenic human papillomavirus entry platform assembly
Article Snippet: Neutralization antibody for EGFR (Cetuximab) was purchased from Merck, control mouse IgG antibody (cat# I5381) was from Sigma-Aldrich, human amphiregulin (cat# AF262) and transforming growth factor α (cat# AF-239) were purchased from R and D Systems (Minneapolis, MN, Canada). .. Cyan fluorescent protein (CFP)-tagged CD151 (CFP-CD151) was generated by isolating the CD151 gene from pEGFP-C1/CD151 with BspEI and XmaI and inserted into pECFP-C1 (Clontech) ( ).

Construct:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). .. Primers used to create the NheI site were 5’-GAGACCGGAAGCTAGCTACCGAGCTCCGGAGG-3 ’ and 5’-CCTCCGGAGCTCGGTAGCTAGCTTCCGGTCTC-3’, and primers used to create the BspEI site were 5 ’-GGTACCGAGCTCCGGAGGTCCACTAGTAAC-3 ’ and 5’-GTTACTAGTGGACCTCCGGAGCTCGGTACC-3’.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: All of the other mTFP1 and mWasabi vectors were constructed using C1 and N1 (Clontech-style) cloning vectors. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: An N-terminal EGFP fusion (pGFP-UL21) was constructed by using primers 5′-TCA TCA TCC GGA ATG GAG CTC AGC TAT GCC A-3′ and 5′-TCA TCA CTC GAG TCACAC AGA CTG GGC GTG-3′ with viral HSV-2 strain 186 DNA as the template. .. The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Expressing:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: The construct was placed behind a cytomegalovirus (CMV) promoter for expression in mammalian cells and a T7 promoter to facilitate in vitro transcription. .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA).

Article Title: Upregulation of CREB-Mediated Transcription Enhances Both Short- and Long-Term Memory
Article Snippet: .. To generate a plasmid expressing ECFP-KIXnls (pECFP-KIXnls), the resulting PCR fragment was subcloned into the BspEI and BamHI sites of pECFP-C1 (Clontech). .. To generate the plasmids expressing EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML and ECFP-KIXnls (pCKIXnls-YCREB-WT, -S133A, -Y134F, or -DIEDML), the MluI fragment containing the CMV promoter and the coding region of EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML was subcloned into the MluI site of pECFP-KIXnls.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Paragraph title: Mammalian expression vectors ... To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Gel Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To generate fusion vectors, the appropriate cloning vector and an EGFP fusion vector were digested, either sequentially or doubly, with the appropriate enzymes and ligated together after gel purification. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Transfection:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech). .. DNA for mammalian transfection was prepared by either the Plasmid Midi or Maxi kit (QIAGEN).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: Clonal cell lines RepAC (expressing wt pUL34) and CL04AI (expressing CL04) were constructed by transfection of the corresponding plasmid into Vero cells, selection with G418, and isolation of clones by limiting dilution. .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3.

Ligation:

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA). .. An untagged UL21 construct (pUL21) was produced by ligation of the UL21 DNA sequence into the EcoRI restriction site of pCI-neo (Promega, Madison, WI).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Infection:

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Generated:

Article Title: Upregulation of CREB-Mediated Transcription Enhances Both Short- and Long-Term Memory
Article Snippet: These fragments were subcloned into the HindIII–BamHI sites of the pM vector (Clontech). pM - CREB-wild type (WT), pM - CREB-S133A, pEYFP-CREB-WT, and pEYFP-CREB-S133A were generated as described above. .. To generate a plasmid expressing ECFP-KIXnls (pECFP-KIXnls), the resulting PCR fragment was subcloned into the BspEI and BamHI sites of pECFP-C1 (Clontech).

Article Title: ADAM17-dependent signaling is required for oncogenic human papillomavirus entry platform assembly
Article Snippet: .. Cyan fluorescent protein (CFP)-tagged CD151 (CFP-CD151) was generated by isolating the CD151 gene from pEGFP-C1/CD151 with BspEI and XmaI and inserted into pECFP-C1 (Clontech) ( ). ..

Sequencing:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). .. Primers used to create the NheI site were 5’-GAGACCGGAAGCTAGCTACCGAGCTCCGGAGG-3 ’ and 5’-CCTCCGGAGCTCGGTAGCTAGCTTCCGGTCTC-3’, and primers used to create the BspEI site were 5 ’-GGTACCGAGCTCCGGAGGTCCACTAGTAAC-3 ’ and 5’-GTTACTAGTGGACCTCCGGAGCTCGGTACC-3’.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: To fuse enhanced green fluorescent protein (EGFP) to the C terminus of HSV-2 UL21 (pUL21-GFP), the full-length HSV-2 UL21 DNA sequence was obtained by PCR amplification using primers 5′-TCA TCA GAA TTC ATG GAG CTC AGC TAT GCC A-3′ and 5′-TCA TCA CTC GAG TCA CAC AGA CTG GCC GTG-3′ with HSV-2 strain 186 viral DNA as the template. .. The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Immunofluorescence:

Article Title: ADAM17-dependent signaling is required for oncogenic human papillomavirus entry platform assembly
Article Snippet: Secondary antibodies for immunofluorescence detection on Zeiss Axiovert 200 M microscope (goat-derived Alexa Fluor 488, 546 and 647 antibodies) and for STED analyses [donkey anti-rabbit Alexa Fluor 594 (cat# A21207) and donkey anti-mouse Alexa Fluor 647 (cat# A31571)] were from Molecular Probes (Invitrogen, Carlsbad, CA). .. Cyan fluorescent protein (CFP)-tagged CD151 (CFP-CD151) was generated by isolating the CD151 gene from pEGFP-C1/CD151 with BspEI and XmaI and inserted into pECFP-C1 (Clontech) ( ).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Mutagenesis:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). .. Primers used to create the NheI site were 5’-GAGACCGGAAGCTAGCTACCGAGCTCCGGAGG-3 ’ and 5’-CCTCCGGAGCTCGGTAGCTAGCTTCCGGTCTC-3’, and primers used to create the BspEI site were 5 ’-GGTACCGAGCTCCGGAGGTCCACTAGTAAC-3 ’ and 5’-GTTACTAGTGGACCTCCGGAGCTCGGTACC-3’.

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR. .. The linker in the EGFP variant was SGLRS and YKSGLRS in pmCherry-C1-rMR. pEGFP-C1-rGRC656G and pmCherry-C1-rGRC656G were produced by sub-cloning rat GR with a C656G mutation into pEGFP-C1 (linker SGLRSRGAGAGAGAGAISALI ) or pmCherry-C1 (linker LYKSGLRSRGAGAGAGAGA ). pEGFP-rGRwt was produced from pEGFP-C1-rGRC656G by site directed mutagenesis according to the manufacturer’s instructions, correcting the C656G site using a QuikChange XL kit (Agilent, Santa Clara, CA). pEGFP-AR-mCherry (gift from Ty Voss, LRBGE, NCI) contained an androgen receptor tagged at the N-terminal with EGFP and at the C-terminal with mCherry.

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: pRR1072, pRR1072Rep, and pRR1162, which contains the CL04 charge cluster mutation in UL34 on the pRR1072Rep background, were previously described ( , ). pRR1340, used for construction of an infection-inducible CL04-expressing cell line, was constructed by ligation of the 1,820-bp XbaI-PmlI fragment of pRR1162 that contains the CL04 UL34 gene between the XbaI and NruI sites of the pcDNA3 vector. .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3.

Isolation:

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: Clonal cell lines RepAC (expressing wt pUL34) and CL04AI (expressing CL04) were constructed by transfection of the corresponding plasmid into Vero cells, selection with G418, and isolation of clones by limiting dilution. .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3.

Subcloning:

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR. .. The linker in the EGFP variant was SGLRS and YKSGLRS in pmCherry-C1-rMR. pEGFP-C1-rGRC656G and pmCherry-C1-rGRC656G were produced by sub-cloning rat GR with a C656G mutation into pEGFP-C1 (linker SGLRSRGAGAGAGAGAISALI ) or pmCherry-C1 (linker LYKSGLRSRGAGAGAGAGA ). pEGFP-rGRwt was produced from pEGFP-C1-rGRC656G by site directed mutagenesis according to the manufacturer’s instructions, correcting the C656G site using a QuikChange XL kit (Agilent, Santa Clara, CA). pEGFP-AR-mCherry (gift from Ty Voss, LRBGE, NCI) contained an androgen receptor tagged at the N-terminal with EGFP and at the C-terminal with mCherry.

Microscopy:

Article Title: ADAM17-dependent signaling is required for oncogenic human papillomavirus entry platform assembly
Article Snippet: Secondary antibodies for immunofluorescence detection on Zeiss Axiovert 200 M microscope (goat-derived Alexa Fluor 488, 546 and 647 antibodies) and for STED analyses [donkey anti-rabbit Alexa Fluor 594 (cat# A21207) and donkey anti-mouse Alexa Fluor 647 (cat# A31571)] were from Molecular Probes (Invitrogen, Carlsbad, CA). .. Cyan fluorescent protein (CFP)-tagged CD151 (CFP-CD151) was generated by isolating the CD151 gene from pEGFP-C1/CD151 with BspEI and XmaI and inserted into pECFP-C1 (Clontech) ( ).

Purification:

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Polymerase Chain Reaction:

Article Title: DIRECT INDUCTION OF APOPTOSIS USING AN OPTIMAL MITOCHONDRIALLY TARGETED P53
Article Snippet: The DNA encoding p53 was amplified through PCR from pCMV-p53 wt (a generous gift from Dr. S. J. Baker, Addgene, Cambridge, MA) using the primers 5′-GCGCGCGCGCTCCGGAGCCATGGAGGAGCCGCAGT-3′ and 5′-GCGCGCGCGCGGTACCTCAGTCTGAGTCAGGCCCTTCTGTC-3′. .. This was subcloned into the BspEI and KpnI restriction enzyme sites in pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: .. The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR. ..

Article Title: Upregulation of CREB-Mediated Transcription Enhances Both Short- and Long-Term Memory
Article Snippet: .. To generate a plasmid expressing ECFP-KIXnls (pECFP-KIXnls), the resulting PCR fragment was subcloned into the BspEI and BamHI sites of pECFP-C1 (Clontech). .. To generate the plasmids expressing EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML and ECFP-KIXnls (pCKIXnls-YCREB-WT, -S133A, -Y134F, or -DIEDML), the MluI fragment containing the CMV promoter and the coding region of EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML was subcloned into the MluI site of pECFP-KIXnls.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: The purified and digested PCR products were ligated into similarly digested EGFP-C1 and EGFP-N1 cloning vector backbones. .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: .. The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA). .. An untagged UL21 construct (pUL21) was produced by ligation of the UL21 DNA sequence into the EcoRI restriction site of pCI-neo (Promega, Madison, WI).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3. .. PCR primers used for amplification of the CL04 pUL34 coding sequence were 5′-AGGGAGACCCAAGCTCCATGGCGGGACTGGGCAAG-3′ and 5′-TAGATGCATGCTCGATTATAGGCGCGCGCCAGCAC-3′. pRR1330, in which the coding sequences for amino acids 91 to 228 are deleted from the UL34 gene (Fig. , line 3), was constructed by digestion of pRR1238 with SgrAI and HpaI, treatment with Klenow enzyme in the presence of dNTPs to create blunt ends, and religation of the large fragment of the plasmid. pRR1331, in which the same coding sequences are deleted from the CL04 gene (Fig. , line 4), was created in the same way as pRR1330, except that the parent plasmid was pRR1328. pRR1344, in which amino acids 91 to 275 of wt pUL34 expressed from pcDNA3 are deleted and replaced by the emerin transmembrane domain (Fig. , line 5), was constructed by PCR amplification of sequences coding for amino acids 219 to 254 of emerin and ligation of the BspEI- and XbaI-digested PCR product between the SgrAI and XbaI sites of pRR1238.

Plasmid Preparation:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA). .. Primers used to create the NheI site were 5’-GAGACCGGAAGCTAGCTACCGAGCTCCGGAGG-3 ’ and 5’-CCTCCGGAGCTCGGTAGCTAGCTTCCGGTCTC-3’, and primers used to create the BspEI site were 5 ’-GGTACCGAGCTCCGGAGGTCCACTAGTAAC-3 ’ and 5’-GTTACTAGTGGACCTCCGGAGCTCGGTACC-3’.

Article Title: DIRECT INDUCTION OF APOPTOSIS USING AN OPTIMAL MITOCHONDRIALLY TARGETED P53
Article Snippet: Paragraph title: EGFP-p53 Plasmid (pEGFP-p53) ... This was subcloned into the BspEI and KpnI restriction enzyme sites in pEGFP-C1 (Clontech, Mountain View, CA).

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: Plasmids and hormones Full length rat MR was obtained by PCR amplification of plasmid 6RMR [ ] (kind gift from Prof. David Pearce, University of California, San Francisco). .. The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR.

Article Title: Upregulation of CREB-Mediated Transcription Enhances Both Short- and Long-Term Memory
Article Snippet: .. To generate a plasmid expressing ECFP-KIXnls (pECFP-KIXnls), the resulting PCR fragment was subcloned into the BspEI and BamHI sites of pECFP-C1 (Clontech). .. To generate the plasmids expressing EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML and ECFP-KIXnls (pCKIXnls-YCREB-WT, -S133A, -Y134F, or -DIEDML), the MluI fragment containing the CMV promoter and the coding region of EYFP-CREB-WT, -S133A, -Y134F, or -DIEDML was subcloned into the MluI site of pECFP-KIXnls.

Article Title: Hue-shifted monomeric variants of Clavularia cyan fluorescent protein: identification of the molecular determinants of color and applications in fluorescence imaging
Article Snippet: Thus, to prepare mTFP1 and mWasabi N-terminal fusions, the following digests were performed: human non-muscle α-actinin, EcoRI and NotI (vector source, Tom Keller, FSU); human cytochrome C oxidase subunit VIII, BamHI and NotI (mitochondria, Clontech); human zyxin, BamHI and NotI (Clare Waterman-Storer, NIH); rat α-1 connexin-43 and rat β-2 connexin-26, EcoRI and BamHI (Matthias Falk, Lehigh University); human H2B, BamHI and NotI (George Patterson, NIH); N-terminal 81 amino acids of human β-1,4-galactosyltransferase, BamHI and NotI (Golgi, Clontech); human microtubule-associated protein EB3, BamHI and NotI (Lynne Cassimeris, Lehigh University); human vimentin, BamHI and NotI (Robert Goldman, Northwestern University); human keratin 18, EcoRI and NotI (Open Biosystems, Huntsville, AL); chicken paxillin, EcoRI and NotI (Alan Horwitz, University of Virginia); rat lysosomal membrane glycoprotein 1, AgeI and NheI (George Patterson, NIH); endoplasmic reticulum (calreticulin signal sequence and KDEL retention sequence), AgeI and EcoRI (Clontech). .. To prepare mTFP1 and mWasabi C-terminal fusions, the following digests were performed: human β-actin, NheI and BglII (Clontech); human α-tubulin, NheI and BglII (Clontech); human light chain clathrin, NheI and BglII (George Patterson, NIH); human lamin B1, NheI and BglII (George Patterson, NIH); human fibrillarin, AgeI and BglII (Evrogen); human vinculin, NheI and EcoRI (Open Biosystems, Huntsville, AL); peroximal targeting signal 1 (PTS1 – peroxisomes), AgeI and BspEI (Clontech); chicken protein tyrosine kinase 2, AgeI and BglII (Clare Waterman-Storer, NIH); human annexin (A4), AgeI and BspEI (Alen Piljic, EMBL, Heidelberg); human RhoB GTPase with an N-terminal c-Myc epitope tag (endosomes), AgeI and BspEI (Clontech); and the 20-amino acid farnesylation signal from c-Ha-Ras, AgeI and BspEI (membrane, Clontech).

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: Clonal cell lines RepAC (expressing wt pUL34) and CL04AI (expressing CL04) were constructed by transfection of the corresponding plasmid into Vero cells, selection with G418, and isolation of clones by limiting dilution. .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3.

Selection:

Article Title: Analysis of a Charge Cluster Mutation of Herpes Simplex Virus Type 1 UL34 and Its Extragenic Suppressor Suggests a Novel Interaction between pUL34 and pUL31 That Is Necessary for Membrane Curvature around Capsids ▿
Article Snippet: Clonal cell lines RepAC (expressing wt pUL34) and CL04AI (expressing CL04) were constructed by transfection of the corresponding plasmid into Vero cells, selection with G418, and isolation of clones by limiting dilution. .. Expressing cell clones were identified by an immunofluorescence (IF) assay for pUL34 expression 20 h after infection with the UL34-null virus vRR1072(TK+). pRR1238 for constitutive expression of wt pUL34 was constructed by digestion of pRR1072Rep with NcoI and BspEI, treatment with Klenow enzyme in the presence of deoxynucleoside triphosphates (dNTPs) to create blunt ends, and ligation of the UL34-containing fragment into EcoRV-digested pcDNA3. pRR1328 for constitutive expression of CL04 pUL34 was constructed by InFusion (Clontech) cloning of a PCR fragment containing the CL04 pUL34 coding sequence amplified from pRR1162 between the HindIII and XhoI sites of pcDNA3.

In Vitro:

Article Title: Role of the Terminal Domains in Sodium Channel Localization
Article Snippet: The construct was placed behind a cytomegalovirus (CMV) promoter for expression in mammalian cells and a T7 promoter to facilitate in vitro transcription. .. To generate Nav 1.2-EGFP, the EGFP sequence between NheI and BspEI was cut from the pEGFP-C1 plasmid (Clontech Laboratories, Palo Alto, CA), and the construct was inserted in frame into the 5’ noncoding sequence of the Nav 1.2-FLAG clone behind the promoters and between NheI and BspEI sites created with the QuikChange site-directed mutagenesis kit (Stratagene, La Jolla, CA).

Produced:

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR. .. The linker in the EGFP variant was SGLRS and YKSGLRS in pmCherry-C1-rMR. pEGFP-C1-rGRC656G and pmCherry-C1-rGRC656G were produced by sub-cloning rat GR with a C656G mutation into pEGFP-C1 (linker SGLRSRGAGAGAGAGAISALI ) or pmCherry-C1 (linker LYKSGLRSRGAGAGAGAGA ). pEGFP-rGRwt was produced from pEGFP-C1-rGRC656G by site directed mutagenesis according to the manufacturer’s instructions, correcting the C656G site using a QuikChange XL kit (Agilent, Santa Clara, CA). pEGFP-AR-mCherry (gift from Ty Voss, LRBGE, NCI) contained an androgen receptor tagged at the N-terminal with EGFP and at the C-terminal with mCherry.

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA). .. An untagged UL21 construct (pUL21) was produced by ligation of the UL21 DNA sequence into the EcoRI restriction site of pCI-neo (Promega, Madison, WI).

CTG Assay:

Article Title: The Herpes Simplex Virus 2 UL21 Protein Is Essential for Virus Propagation
Article Snippet: An N-terminal EGFP fusion (pGFP-UL21) was constructed by using primers 5′-TCA TCA TCC GGA ATG GAG CTC AGC TAT GCC A-3′ and 5′-TCA TCA CTC GAG TCACAC AGA CTG GGC GTG-3′ with viral HSV-2 strain 186 DNA as the template. .. The PCR product was digested with BspEI and XhoI and ligated into similarly digested pEGFP-C1 (Clontech, Mountain View, CA).

Variant Assay:

Article Title: Beyond the heterodimer model for mineralocorticoid and glucocorticoid receptor interactions in nuclei and at DNA
Article Snippet: The PCR product was inserted into the BspEI and SacII sites of pEGFP-C1 or pmCherry-C1 (Clontech, Mountain View, CA) to obtain pEGFP-C1-rMR or pmCherry-C1-rMR. .. The linker in the EGFP variant was SGLRS and YKSGLRS in pmCherry-C1-rMR. pEGFP-C1-rGRC656G and pmCherry-C1-rGRC656G were produced by sub-cloning rat GR with a C656G mutation into pEGFP-C1 (linker SGLRSRGAGAGAGAGAISALI ) or pmCherry-C1 (linker LYKSGLRSRGAGAGAGAGA ). pEGFP-rGRwt was produced from pEGFP-C1-rGRC656G by site directed mutagenesis according to the manufacturer’s instructions, correcting the C656G site using a QuikChange XL kit (Agilent, Santa Clara, CA). pEGFP-AR-mCherry (gift from Ty Voss, LRBGE, NCI) contained an androgen receptor tagged at the N-terminal with EGFP and at the C-terminal with mCherry.

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94
    TaKaRa bspei
    Bspei, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 9 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bspei/product/TaKaRa
    Average 94 stars, based on 9 article reviews
    Price from $9.99 to $1999.99
    bspei - by Bioz Stars, 2020-02
    94/100 stars
      Buy from Supplier

    81
    TaKaRa bspei bamhi sites
    Bspei Bamhi Sites, supplied by TaKaRa, used in various techniques. Bioz Stars score: 81/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bspei bamhi sites/product/TaKaRa
    Average 81 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bspei bamhi sites - by Bioz Stars, 2020-02
    81/100 stars
      Buy from Supplier

    78
    TaKaRa second bspei site
    Second Bspei Site, supplied by TaKaRa, used in various techniques. Bioz Stars score: 78/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/second bspei site/product/TaKaRa
    Average 78 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    second bspei site - by Bioz Stars, 2020-02
    78/100 stars
      Buy from Supplier

    Image Search Results