Structured Review

Millipore bl21
Schematic diagram of mu-IFN-CSP gene in the expression vector mu-IFN-CSP/pET-21b and expression of mu-IFN-CSP protein in recombinant E. coli . a A schematic diagram of mu-IFN-CSP/pET-21b. b SDS-PAGE analysis of mu-IFN-CSP expression. Lane 1 total proteins of recombinant E. coli <t>BL21</t> after IPTG induction. Lanes 2–3 supernatant and precipitation after ultrasonication and centrifugation. Lane M protein molecular weight marker. c Recombinant mu-IFN-CSP was analyzed by western blot analysis. Lanes 1–2 total proteins of E. coli BL21/pET-21b-mu-IFN-CSP before and after induction. Lane M protein molecular weight marker
Bl21, supplied by Millipore, used in various techniques. Bioz Stars score: 79/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bl21/product/Millipore
Average 79 stars, based on 1 article reviews
Price from $9.99 to $1999.99
bl21 - by Bioz Stars, 2020-01
79/100 stars

Related Products / Commonly Used Together

2xyt auto-induction

Images

1) Product Images from "Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression"

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression

Journal: AMB Express

doi: 10.1186/s13568-017-0493-z

Schematic diagram of mu-IFN-CSP gene in the expression vector mu-IFN-CSP/pET-21b and expression of mu-IFN-CSP protein in recombinant E. coli . a A schematic diagram of mu-IFN-CSP/pET-21b. b SDS-PAGE analysis of mu-IFN-CSP expression. Lane 1 total proteins of recombinant E. coli BL21 after IPTG induction. Lanes 2–3 supernatant and precipitation after ultrasonication and centrifugation. Lane M protein molecular weight marker. c Recombinant mu-IFN-CSP was analyzed by western blot analysis. Lanes 1–2 total proteins of E. coli BL21/pET-21b-mu-IFN-CSP before and after induction. Lane M protein molecular weight marker
Figure Legend Snippet: Schematic diagram of mu-IFN-CSP gene in the expression vector mu-IFN-CSP/pET-21b and expression of mu-IFN-CSP protein in recombinant E. coli . a A schematic diagram of mu-IFN-CSP/pET-21b. b SDS-PAGE analysis of mu-IFN-CSP expression. Lane 1 total proteins of recombinant E. coli BL21 after IPTG induction. Lanes 2–3 supernatant and precipitation after ultrasonication and centrifugation. Lane M protein molecular weight marker. c Recombinant mu-IFN-CSP was analyzed by western blot analysis. Lanes 1–2 total proteins of E. coli BL21/pET-21b-mu-IFN-CSP before and after induction. Lane M protein molecular weight marker

Techniques Used: Expressing, Plasmid Preparation, Positron Emission Tomography, Recombinant, SDS Page, Centrifugation, Molecular Weight, Marker, Western Blot

2) Product Images from "Construction of a Novel Liver-Targeting Fusion Interferon by Incorporation of a Plasmodium Region I-Plus Peptide"

Article Title: Construction of a Novel Liver-Targeting Fusion Interferon by Incorporation of a Plasmodium Region I-Plus Peptide

Journal: BioMed Research International

doi: 10.1155/2014/261631

Analysis of fusion protein by SDS-PAGE and Western blot. (a) Expression and purification of IFN-CSP. Lane M: protein molecular weight marker. Lanes 1 and 2: total proteins of E. coli BL21/pET-21b-IFN-CSP before and after induction. Lanes 3 and 4: supernatant and precipitation after ultrasonication and centrifugation. Lane 5: purified IFN-CSP using Ni affinity chromatography. Lane 6: Purified IFN-CSP using HiTrap affinity chromatography. (b) IFN-CSP was analyzed by SDS-PAGE, transferred to PVDF membrane, and detected by goat polyclonal anti-human IFN α antibody. Lane M: protein molecular weight marker. Lanes 1 and 2: total proteins of E. coli BL21/pET-21b-IFN-CSP before and after induction.
Figure Legend Snippet: Analysis of fusion protein by SDS-PAGE and Western blot. (a) Expression and purification of IFN-CSP. Lane M: protein molecular weight marker. Lanes 1 and 2: total proteins of E. coli BL21/pET-21b-IFN-CSP before and after induction. Lanes 3 and 4: supernatant and precipitation after ultrasonication and centrifugation. Lane 5: purified IFN-CSP using Ni affinity chromatography. Lane 6: Purified IFN-CSP using HiTrap affinity chromatography. (b) IFN-CSP was analyzed by SDS-PAGE, transferred to PVDF membrane, and detected by goat polyclonal anti-human IFN α antibody. Lane M: protein molecular weight marker. Lanes 1 and 2: total proteins of E. coli BL21/pET-21b-IFN-CSP before and after induction.

Techniques Used: SDS Page, Western Blot, Expressing, Purification, Molecular Weight, Marker, Positron Emission Tomography, Centrifugation, Affinity Chromatography

3) Product Images from "Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression"

Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression

Journal: Avicenna Journal of Medical Biotechnology

doi:

SDS–PAGE analysis of co-expressed anti-CD20 huscFv with different cytoplasmic molecular chaperones after induction with 0.4 Mm IPTG for 4 hr at 30° C , washed and resuspended in lysis buffer 10 ml of lysis buffer (100 mM NaCl, 50 mM NaH2PO4 at pH=8.0). Lane 1: the standard protein weight marker. Lane 2: whole cell lysate supernatant from uninduced cells without chaperone plasmid set. Lane 3: whole insoluble pellet from uninduced cells without chaperone plasmid set. Lanes 4–6: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pG-KJE8 (Lane 4: supernatant from uninduced cells, Lane 5: supernatant from 4 hr , Lane 6: pellet from 4 hr ). Lanes7–9: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pGro7 (Lane 7: supernatant from uninduced cells, Lane 8: supernatant from 4 hr , Lane 9: pellet from 4 hr ). Lanes 10–12: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pKjE7 (Lane 10: supernatant from uninduced cells, Lane 11: supernatant from 4 hr , Lane 12: pellet from 4 hr ). Lanes 13–15: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pG-Tf2 (Lane 13: supernatant from uninduced cells, Lane 14: supernatant from 4 hr , Lane 15: pellet from 4 hr ). Lanes 16–18: samples of different extracts from E. coli BL21 (DE3)/pET22b-husc Fv/pTf16 (Lane 16: supernatant from uninduced cells, Lane 17: supernatant from 4 hr , Lane 18: pellet from 4 hr ).
Figure Legend Snippet: SDS–PAGE analysis of co-expressed anti-CD20 huscFv with different cytoplasmic molecular chaperones after induction with 0.4 Mm IPTG for 4 hr at 30° C , washed and resuspended in lysis buffer 10 ml of lysis buffer (100 mM NaCl, 50 mM NaH2PO4 at pH=8.0). Lane 1: the standard protein weight marker. Lane 2: whole cell lysate supernatant from uninduced cells without chaperone plasmid set. Lane 3: whole insoluble pellet from uninduced cells without chaperone plasmid set. Lanes 4–6: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pG-KJE8 (Lane 4: supernatant from uninduced cells, Lane 5: supernatant from 4 hr , Lane 6: pellet from 4 hr ). Lanes7–9: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pGro7 (Lane 7: supernatant from uninduced cells, Lane 8: supernatant from 4 hr , Lane 9: pellet from 4 hr ). Lanes 10–12: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pKjE7 (Lane 10: supernatant from uninduced cells, Lane 11: supernatant from 4 hr , Lane 12: pellet from 4 hr ). Lanes 13–15: samples of different extracts from E. coli BL21 (DE3)/pET22b-huscFv/pG-Tf2 (Lane 13: supernatant from uninduced cells, Lane 14: supernatant from 4 hr , Lane 15: pellet from 4 hr ). Lanes 16–18: samples of different extracts from E. coli BL21 (DE3)/pET22b-husc Fv/pTf16 (Lane 16: supernatant from uninduced cells, Lane 17: supernatant from 4 hr , Lane 18: pellet from 4 hr ).

Techniques Used: SDS Page, Lysis, Marker, Plasmid Preparation

SDS-PAGE analysis of the purified recombinant huscFv in BL21 (DE3) after gel filtration chromatography and washing with buffer A (5 mM and 20 mM of imidazole). Lane 1: the standard protein weight marker Lane 2: purified huscFv/pTf16 Lane 3: purified huscFv/pGro7 Lane 4: purified huscFv/pG-KJE8 Lane 5: purified huscFv/pKjE7 Lane 6: purified huscFv/pG-Tf2
Figure Legend Snippet: SDS-PAGE analysis of the purified recombinant huscFv in BL21 (DE3) after gel filtration chromatography and washing with buffer A (5 mM and 20 mM of imidazole). Lane 1: the standard protein weight marker Lane 2: purified huscFv/pTf16 Lane 3: purified huscFv/pGro7 Lane 4: purified huscFv/pG-KJE8 Lane 5: purified huscFv/pKjE7 Lane 6: purified huscFv/pG-Tf2

Techniques Used: SDS Page, Purification, Recombinant, Filtration, Chromatography, Marker

4) Product Images from "Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH"

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH

Journal: Microbial Cell Factories

doi: 10.1186/1475-2859-11-7

Bioreductions of D-xylose catalyzed by whole cells and crude cell extracts of E. coli strains BL21_XR_FDH and Rosetta_XR_2FDH . Type of catalyst is indicated by symbols: ● Rosetta_XR_2FDH crude extract; ○ Rosetta_XR_2FDH whole-cell catalyst; ∇ BL21_XR_FDH crude extract; ▼ BL21_XR_FDH whole-cell catalyst. Reaction conditions: D-xylose (250 mM), sodium formate (300 mM), cells (10 g CDW /L), 30°C.
Figure Legend Snippet: Bioreductions of D-xylose catalyzed by whole cells and crude cell extracts of E. coli strains BL21_XR_FDH and Rosetta_XR_2FDH . Type of catalyst is indicated by symbols: ● Rosetta_XR_2FDH crude extract; ○ Rosetta_XR_2FDH whole-cell catalyst; ∇ BL21_XR_FDH crude extract; ▼ BL21_XR_FDH whole-cell catalyst. Reaction conditions: D-xylose (250 mM), sodium formate (300 mM), cells (10 g CDW /L), 30°C.

Techniques Used:

5) Product Images from "The pCri System: A Vector Collection for Recombinant Protein Expression and Purification"

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification

Journal: PLoS ONE

doi: 10.1371/journal.pone.0112643

Protein expression and purification trials using the pCri System. ( A ) The GFP gene was cloned into pCri-1a, 4a, 6a, 8a, 11a, and 14a, the proteins expressed in E. coli BL21 cells, and subsequently purified by Ni-NTA-affinity chromatography except for MBP, GST, and LSL fusion products, which were purified by their respective specific affinity resins. ( B ) The gene coding for fragilysin was cloned into pCri-1a, 4a, 6a and 8a, and expressed in E. coli Origami 2 cells. Total (T) and soluble (S) fractions of crude protein extracts were further analysed by SDS-PAGE. All expression trials were performed at 20°C except for pCri-1a, which was also performed at 37°C. ( C ) Partially purified MBP-fragilysin before (−) and after (+) TEV proteinase cleavage. Arrows indicate the soluble fraction of fragilysin (white) and the MBP (black) after TEV proteinase cleavage. ( D ) Expression of CPA2 intracellularly (lanes 1 and 2) or periplasmatically (lanes 3 and 4) in E. coli cells, and extracellularly (lanes 5 and 6) in P. pastoris cells. Lanes indicate samples before (1, 3 and 5) and after (2, 4 and 6) tryptic digestion. Arrows indicate the pro-CPA2 (black), the mature form (grey) and the pro-peptide (white) after tryptic cleavage. ( E ) The PNGase F gene was cloned into pCri-4a and 8a and expressed overnight at 20°C in E. coli BL21 and Origami 2 cells. Total (T) and soluble (S) fractions of crude protein extracts were further analysed by SDS-PAGE. ( F ) Activity of affinity-purified TRX-PNGase F against glycosylated RNase B. (+) and (−) indicate presence and absence of PNGase F. Arrows indicate the PNGase F (black), native RNase B (grey) and deglycosylated RNase B (white). ( G ) MecR1 was expressed in E. coli BL21 using pCri-8a or 13a, and soluble fractions were analysed by Western blotting with specific antibodies as detailed in “ Materials and Methods ”. A black arrow indicates the detected MecR1. ( H ) Partially purified MISTIC-MecR1 after Ni-NTA-affinity purification. ( I ) Partially purified MBP-GFP, SUMO-GFP and MISTIC-MecR1 were digested with TEV proteinase, SENP1 or thrombin, respectively. For TEV proteinase and SENP1 digestions various ratios of proteinase∶tagged-protein were tested in overnight incubations at 4°C, whereas for thrombin digestions 2 units of proteinase were used to digest 25 µg of protein for various times at room temperature. Arrows indicate tagged-protein (black), target protein (grey) and fused-tag (white) after proteinase cleavage.
Figure Legend Snippet: Protein expression and purification trials using the pCri System. ( A ) The GFP gene was cloned into pCri-1a, 4a, 6a, 8a, 11a, and 14a, the proteins expressed in E. coli BL21 cells, and subsequently purified by Ni-NTA-affinity chromatography except for MBP, GST, and LSL fusion products, which were purified by their respective specific affinity resins. ( B ) The gene coding for fragilysin was cloned into pCri-1a, 4a, 6a and 8a, and expressed in E. coli Origami 2 cells. Total (T) and soluble (S) fractions of crude protein extracts were further analysed by SDS-PAGE. All expression trials were performed at 20°C except for pCri-1a, which was also performed at 37°C. ( C ) Partially purified MBP-fragilysin before (−) and after (+) TEV proteinase cleavage. Arrows indicate the soluble fraction of fragilysin (white) and the MBP (black) after TEV proteinase cleavage. ( D ) Expression of CPA2 intracellularly (lanes 1 and 2) or periplasmatically (lanes 3 and 4) in E. coli cells, and extracellularly (lanes 5 and 6) in P. pastoris cells. Lanes indicate samples before (1, 3 and 5) and after (2, 4 and 6) tryptic digestion. Arrows indicate the pro-CPA2 (black), the mature form (grey) and the pro-peptide (white) after tryptic cleavage. ( E ) The PNGase F gene was cloned into pCri-4a and 8a and expressed overnight at 20°C in E. coli BL21 and Origami 2 cells. Total (T) and soluble (S) fractions of crude protein extracts were further analysed by SDS-PAGE. ( F ) Activity of affinity-purified TRX-PNGase F against glycosylated RNase B. (+) and (−) indicate presence and absence of PNGase F. Arrows indicate the PNGase F (black), native RNase B (grey) and deglycosylated RNase B (white). ( G ) MecR1 was expressed in E. coli BL21 using pCri-8a or 13a, and soluble fractions were analysed by Western blotting with specific antibodies as detailed in “ Materials and Methods ”. A black arrow indicates the detected MecR1. ( H ) Partially purified MISTIC-MecR1 after Ni-NTA-affinity purification. ( I ) Partially purified MBP-GFP, SUMO-GFP and MISTIC-MecR1 were digested with TEV proteinase, SENP1 or thrombin, respectively. For TEV proteinase and SENP1 digestions various ratios of proteinase∶tagged-protein were tested in overnight incubations at 4°C, whereas for thrombin digestions 2 units of proteinase were used to digest 25 µg of protein for various times at room temperature. Arrows indicate tagged-protein (black), target protein (grey) and fused-tag (white) after proteinase cleavage.

Techniques Used: Expressing, Purification, Clone Assay, Affinity Chromatography, SDS Page, Activity Assay, Affinity Purification, Western Blot

6) Product Images from "Expression, Purification and Characterization of Three Overlapping Immunodominant Recombinant Fragments from Bordetella pertussis Filamentous Hemagglutinin"

Article Title: Expression, Purification and Characterization of Three Overlapping Immunodominant Recombinant Fragments from Bordetella pertussis Filamentous Hemagglutinin

Journal: Avicenna Journal of Medical Biotechnology

doi:

Induction of rFHA1; A), rFHA2; B) and rFHA3; C) proteins expression in E. coli BL21 (DE3). IPTG was added to a logarithmic liquid culture of transformed bacteria at 1 mM concentration when OD 600nm was 0.6. Pre-induction and post-induction samples were collected at different time points and run on 12% SDS-PAGE followed by Coomassie blue staining. The arrow in the middle of the gel shows the expected target protein molecular weight (∼ 40 kDa ); SM: protein size marker
Figure Legend Snippet: Induction of rFHA1; A), rFHA2; B) and rFHA3; C) proteins expression in E. coli BL21 (DE3). IPTG was added to a logarithmic liquid culture of transformed bacteria at 1 mM concentration when OD 600nm was 0.6. Pre-induction and post-induction samples were collected at different time points and run on 12% SDS-PAGE followed by Coomassie blue staining. The arrow in the middle of the gel shows the expected target protein molecular weight (∼ 40 kDa ); SM: protein size marker

Techniques Used: Expressing, Transformation Assay, Concentration Assay, SDS Page, Staining, Molecular Weight, Marker

7) Product Images from "A Molecular Biological and Biochemical Investigation on Mycobacterium tuberculosis MutT Protein"

Article Title: A Molecular Biological and Biochemical Investigation on Mycobacterium tuberculosis MutT Protein

Journal: Jundishapur Journal of Microbiology

doi: 10.5812/jjm.9367

Characterization of the Anti- M. tuberculosis MutT Antisera A. Titers of antisera prepared from the same rabbit immunized with purified M. tuberculosis MutT are examined using total lysate of E. coli strain BL21 (DE3) harboring pET28a (+)-mutT. The batches of antisera were collected on the 6th (1st) and the 7th day (2nd) after the 1st and the 2nd boost immunization, respectively. A prominent signal of the recombinant M. tuberculosis MutT protein was still present (arrowhead) even at high dilution factors. B. The same blots were stripped and probed with anti-His antibody (Clontech, 1:5000) to mark the position of the recombinant M. tuberculosis MutT protein.
Figure Legend Snippet: Characterization of the Anti- M. tuberculosis MutT Antisera A. Titers of antisera prepared from the same rabbit immunized with purified M. tuberculosis MutT are examined using total lysate of E. coli strain BL21 (DE3) harboring pET28a (+)-mutT. The batches of antisera were collected on the 6th (1st) and the 7th day (2nd) after the 1st and the 2nd boost immunization, respectively. A prominent signal of the recombinant M. tuberculosis MutT protein was still present (arrowhead) even at high dilution factors. B. The same blots were stripped and probed with anti-His antibody (Clontech, 1:5000) to mark the position of the recombinant M. tuberculosis MutT protein.

Techniques Used: Purification, Recombinant

Overexpression of the Recombinant M. tuberculosis MutT Protein in BL21 (DE3) Plasmid pET28a (+)-mutT was overexpressed in E. coli strain BL21 (DE3) upon IPTG induction to produce the recombinant M. tuberculosis MutT protein. Lysates of bacteria were fractionated in a SDS-PAGE gel, and stained with Coomassie Blue. The recombinant M. tuberculosis MutT protein of 17.3 kD was found in the fractions.
Figure Legend Snippet: Overexpression of the Recombinant M. tuberculosis MutT Protein in BL21 (DE3) Plasmid pET28a (+)-mutT was overexpressed in E. coli strain BL21 (DE3) upon IPTG induction to produce the recombinant M. tuberculosis MutT protein. Lysates of bacteria were fractionated in a SDS-PAGE gel, and stained with Coomassie Blue. The recombinant M. tuberculosis MutT protein of 17.3 kD was found in the fractions.

Techniques Used: Over Expression, Recombinant, Plasmid Preparation, SDS Page, Staining

Related Articles

Clone Assay:

Article Title: Construction of a Novel Liver-Targeting Fusion Interferon by Incorporation of a Plasmodium Region I-Plus Peptide
Article Snippet: We further investigated whether the fusion protein IFN-CSP reserves anti-HBV activity and liver-targeting function as its parental peptides. .. E. coli strain DH5α (Novagen, USA) and BL21 (DE3; Novagen, USA) were used as the host for gene manipulation and expression of fusion protein, respectively. pMD20-T (Takara, Japan) and pET-21b (Novagen, USA) were applied for gene cloning and expression, respectively. .. Luria-Bertani (LB) medium was employed for bacterial growth and protein production.

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Subsequent to round 6, post-sorted yeast were plated onto SDCAA-agar plates, colonies were picked and cultured in liquid SDCAA medium, and the plasmids encoding the nanobodies were isolated with a ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research) and sequenced. .. Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH
Article Snippet: The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA). .. The Cb FDH gene was amplified from pETDuet_XR_FDH by a PCR using Pfu DNA polymerase and primers providing Pag I (compatible ends to Nco I) and Avr II restriction sites.

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen).

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: Genes of human BOLA1 (residues 30–137), BOLA3 (25–107), GLRX5 (32–157) and NFU1 (57–254) (each lacking its mitochondrial presequence) were inserted into the multiple cloning site I of pET-Duet1 vector (Novagen-Merck, Darmstadt, Germany) with a N-terminal His-tag. .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Centrifugation:

Article Title: HIF-2α-pVHL complex reveals broad genotype-phenotype correlations in HIF-2α-driven disease
Article Snippet: HIS6 -PHD2 (181–426) was expressed in BL21(DE3) E. coli cells (Novagen, Cat. No. 69450) and purified according to a published protocol . .. HIS6 -PHD2 (181–426) was expressed in BL21(DE3) E. coli cells (Novagen, Cat. No. 69450) and purified according to a published protocol .

Article Title: Ebola virus VP30 and nucleoprotein interactions modulate viral RNA synthesis
Article Snippet: All eVP30 and eNP proteins were expressed as maltose-binding protein (MBP) fusion proteins in BL21(DE3) E. coli cells (Novagen) in Lysogeny broth media. .. Cells were harvested and resuspended in lysis buffer containing 25 mM sodium phosphate pH 7.5, 250 mM NaCl, 20 mM imidazole and 5 mM 2-mecaptoethanol.

Amplification:

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH
Article Snippet: The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA). .. The construction of the E. coli BL21 (DE3) (BL21_XR_FDH) harbouring Ct XR and Cb FDH genes on a pETDuet-1 vector (pETDuet_XR_FDH) was described elsewhere [ ].

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Antigen genes were amplified from the genomic DNA of S. pneumoniae strains using primers summarized in table S2. .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen).

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: DNA sequences coding for human α-synuclein sequence (Accession No. NM_000345.3) amino acid residues 1–140 (wildtype) were amplified and ligated into the pET24 vector with an N-terminal His-tag (EMD Biosciences) and sequences were confirmed. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: DNA sequences coding for human α-synuclein sequence (Accession No. ) amino acid residues 1–140 (wildtype) were amplified and ligated into the pET24 vector with an N-terminal His-tag (EMD Biosciences) and sequences were confirmed. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: The DNA encoding for Tc-CTL-1, minus the signal peptide at N-terminus was amplified from T . canis larval cDNA library [ ], subsequently subcloned in-frame into the E . coli expression vector pET41a (Novagen) with fusion Schistosoma japonicum Glutathione S-transferase (GST) deleted and 6 His-tag expressed at C-terminus (NdeI/XhoI). .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight.

Filtration:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: The eluted proteins were treated with 5 mM DTT and isolated by gel filtration on a Superdex 200 16/60 gel filtration column (GE Healthcare) in reconstitution buffer R (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Pyrolysis Gas Chromatography:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. The final samples were prepared in 10mM phosphate (pH=7.0) and 100mM NaCl buffer for fluorescein labeling.

Construct:

Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
Article Snippet: E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen. .. E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen.

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression
Article Snippet: pMD20-T (Takara, Otsu, Japan) was employed to clone gene and pET-21b (Novagen, Madison, USA) was employed to construct expression plasmid. .. E. coli strain DH5α (Novagen, Madison, USA) was employed for gene manipulation and BL21 (DE3; Novagen, Madison, USA) was employed to construct recombinant expression strain. .. Recombinant IFN-CSP/pET-21b expression plasmid was obtained from Guangdong Provincial Key Laboratory of Pharmaceutical Bioactive Substances, Guangzhou, People’s Republic of China.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: HNF4α proteins used in this study reference the NCBI sequence HNF4 NM_178849. .. All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. HNF4α ΔABΔF (human) construct was used in crystallization experiments.

Article Title: Ebola virus VP30 and nucleoprotein interactions modulate viral RNA synthesis
Article Snippet: All eVP30 and eNP proteins were expressed as maltose-binding protein (MBP) fusion proteins in BL21(DE3) E. coli cells (Novagen) in Lysogeny broth media. .. Cells were harvested and resuspended in lysis buffer containing 25 mM sodium phosphate pH 7.5, 250 mM NaCl, 20 mM imidazole and 5 mM 2-mecaptoethanol.

Article Title: Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction
Article Snippet: Numbering and sequences correspond to UniProtKB o76094 (human SRP72), UniProtKB q9uhb9 (human SRP68) and GenBank accession no. X04248.1 (human SRP RNA). .. The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ). .. Sumo-fused human SRP72-PBD and non-tagged SRP68-PBD were co-expressed by auto-induction for 16 h at 25°C.

Incubation:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. The final samples were prepared in 10mM phosphate (pH=7.0) and 100mM NaCl buffer for fluorescein labeling.

Expressing:

Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
Article Snippet: This article is the first report about the application of chaperone plasmids encoding GroEL, DnaJ, Tig, GroES, DnaK and GrpE chaperones to increase the soluble expression of anti-CD20-huscFv in E. coli . .. E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen. .. IPTG, Taq DNA polymerase was obtained from Promega Company.

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression
Article Snippet: pMD20-T (Takara, Otsu, Japan) was employed to clone gene and pET-21b (Novagen, Madison, USA) was employed to construct expression plasmid. .. E. coli strain DH5α (Novagen, Madison, USA) was employed for gene manipulation and BL21 (DE3; Novagen, Madison, USA) was employed to construct recombinant expression strain. .. Recombinant IFN-CSP/pET-21b expression plasmid was obtained from Guangdong Provincial Key Laboratory of Pharmaceutical Bioactive Substances, Guangzhou, People’s Republic of China.

Article Title: Construction of a Novel Liver-Targeting Fusion Interferon by Incorporation of a Plasmodium Region I-Plus Peptide
Article Snippet: We further investigated whether the fusion protein IFN-CSP reserves anti-HBV activity and liver-targeting function as its parental peptides. .. E. coli strain DH5α (Novagen, USA) and BL21 (DE3; Novagen, USA) were used as the host for gene manipulation and expression of fusion protein, respectively. pMD20-T (Takara, Japan) and pET-21b (Novagen, USA) were applied for gene cloning and expression, respectively. .. Luria-Bertani (LB) medium was employed for bacterial growth and protein production.

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Subsequent to round 6, post-sorted yeast were plated onto SDCAA-agar plates, colonies were picked and cultured in liquid SDCAA medium, and the plasmids encoding the nanobodies were isolated with a ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research) and sequenced. .. Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: Paragraph title: Expression, purification and crystallization ... All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen).

Article Title: HIF-2α-pVHL complex reveals broad genotype-phenotype correlations in HIF-2α-driven disease
Article Snippet: Paragraph title: Protein expression and purification ... HIS6 -PHD2 (181–426) was expressed in BL21(DE3) E. coli cells (Novagen, Cat. No. 69450) and purified according to a published protocol .

Article Title: Ebola virus VP30 and nucleoprotein interactions modulate viral RNA synthesis
Article Snippet: Paragraph title: Protein expression and purification ... All eVP30 and eNP proteins were expressed as maltose-binding protein (MBP) fusion proteins in BL21(DE3) E. coli cells (Novagen) in Lysogeny broth media.

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: Paragraph title: K23Q rαSyn expression vector preparation ... The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: The correct open reading frame (ORF) was confirmed by double stranded sequencing using the vector flanking primers (T7 promoter/T7 terminator). .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. The induced cells were collected by centrifugation at 5,000 g for 10 min at 4°C and lyzed with PBS, pH 7.4 containing 1 mg/mL lysozyme, 30 μg/mL DNAse I and 1% Triton-X 100, then sonicated for 60 seconds on 75% power for 3–5 times with 2 minutes interval.

Crystallization Assay:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: Paragraph title: Expression, purification and crystallization ... All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Over Expression:

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: The open reading frame was synthesized (DNA2.0) and inserted into the plasmid pJExpress401 to produce an N-terminally tagged His6 fusion protein (sequence listed in Supplementary Table ). .. This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG. .. After growing cells for 16 h at 37 ˚C, they were harvested and resuspended in 50 mM Tris-Cl (pH 7.5), 500 mM NaCl, 25 mM imidazole, 1 mM ZnSO4 , 1 mM CuSO4 , 250 µg hen egg white lysozyme, one EDTA-free protease inhibitor cocktail tablet (Roche), and ten units DNase I. Resuspended cells were frozen in liquid N2 and stored at −80 ˚C prior to purification.

Transformation Assay:

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: DNA was purified from PCR reactions, enzymatic reactions, agarose gel band extractions, and vector extractions using OMEGA-Biotek purification kits. .. Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method . .. Competent cells of P. pastoris KM71H (Invitrogen) and B. subtilis WB800N (MoBiTec) were prepared according to the manufacturer's instructions.

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Subsequent to round 6, post-sorted yeast were plated onto SDCAA-agar plates, colonies were picked and cultured in liquid SDCAA medium, and the plasmids encoding the nanobodies were isolated with a ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research) and sequenced. .. Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Each polymerase chain reaction (PCR) product was cloned into pET expression plasmids using the flanking restriction sites indicated (designed within the primers). .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Resulting single-colony transformants were cultured in 3 ml of lysogeny broth (LB) at 37°C with shaking before 15% glycerol stock storage at −80°C.

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: The eluted proteins were treated with 5 mM DTT and isolated by gel filtration on a Superdex 200 16/60 gel filtration column (GE Healthcare) in reconstitution buffer R (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3). .. Cells were grown at 37°C in LB or minimal media with (15 NH4 )2 SO4 and/or 13 C-glucose containing 100 μg/mL ampicillin.

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: The α-synuclein K23Q mutation [ ] was engineered using Q5 Site-Directed Mutagenesis (NEB) using the primers CCACACCCTGTTGGGTTTTCTCAG and CAGAAGCAGCAGGAAAGAC. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences). .. Five ml of LB media containing 50 μg/mL kanamycin were inoculated from a glycerol stock of E. coli bacteria containing vectors either for wildtype (WT) or K23Q rαSyn protein expression.

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: The α-synuclein K23Q mutation [ ] was engineered using Q5 Site-Directed Mutagenesis (NEB) using the primers CCACACCCTGTTGGGTTTTCTCAG and CAGAAGCAGCAGGAAAGAC. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences). .. Five ml of LB media containing 50 μg/mL kanamycin were inoculated from a glycerol stock of E. coli bacteria containing vectors either for wildtype (WT) or K23Q rαSyn protein expression.

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: The correct open reading frame (ORF) was confirmed by double stranded sequencing using the vector flanking primers (T7 promoter/T7 terminator). .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. The induced cells were collected by centrifugation at 5,000 g for 10 min at 4°C and lyzed with PBS, pH 7.4 containing 1 mg/mL lysozyme, 30 μg/mL DNAse I and 1% Triton-X 100, then sonicated for 60 seconds on 75% power for 3–5 times with 2 minutes interval.

Chromatography:

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Cell Culture:

Article Title: Expression, Purification and Characterization of Three Overlapping Immunodominant Recombinant Fragments from Bordetella pertussis Filamentous Hemagglutinin
Article Snippet: Our preliminary in vitro results suggest that these recombinant fragments are immunogenic and resemble the native FHA fragments. .. E. coli strains JM109 and BL21 (DE3) were purchased from Novagen (Merck KGaA, Darmstadt, Germany) and cultured in LB agar containing 1% w/v peptone (Merck KGaA, Darmstadt, Germany), 0.5% w/v yeast extract (Merck KGaA, Darmstadt, Germany), 0.6% w/v NaCl and 1.5% w/v agar (Merck KGaA, Darmstadt, Germany). .. LB broth medium constituents were the same as LB agar without agar.

SPR Assay:

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. For crystallography, Nb6B9 was digested overnight with 1:50 (w/w) carboxypeptidase A (Sigma) to remove the His tag, then purified by size exclusion chromatography over a Sephadex S200 size exclusion column.

other:

Article Title: A Molecular Biological and Biochemical Investigation on Mycobacterium tuberculosis MutT Protein
Article Snippet: E. coli isogenic strain MK602 (leu+ mutT ) was provided by Dr. M. Sekiguchi , and BL21 (DE3) was purchased from Novagen (Madison, WI).

Sequencing:

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Subsequent to round 6, post-sorted yeast were plated onto SDCAA-agar plates, colonies were picked and cultured in liquid SDCAA medium, and the plasmids encoding the nanobodies were isolated with a ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research) and sequenced. .. Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: HNF4α proteins used in this study reference the NCBI sequence HNF4 NM_178849. .. All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH
Article Snippet: The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA). .. The Cb FDH gene was amplified from pETDuet_XR_FDH by a PCR using Pfu DNA polymerase and primers providing Pag I (compatible ends to Nco I) and Avr II restriction sites.

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: The open reading frame was synthesized (DNA2.0) and inserted into the plasmid pJExpress401 to produce an N-terminally tagged His6 fusion protein (sequence listed in Supplementary Table ). .. This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG.

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: DNA sequences coding for human α-synuclein sequence (Accession No. NM_000345.3) amino acid residues 1–140 (wildtype) were amplified and ligated into the pET24 vector with an N-terminal His-tag (EMD Biosciences) and sequences were confirmed. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: DNA sequences coding for human α-synuclein sequence (Accession No. ) amino acid residues 1–140 (wildtype) were amplified and ligated into the pET24 vector with an N-terminal His-tag (EMD Biosciences) and sequences were confirmed. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight.

Sonication:

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG. .. After growing cells for 16 h at 37 ˚C, they were harvested and resuspended in 50 mM Tris-Cl (pH 7.5), 500 mM NaCl, 25 mM imidazole, 1 mM ZnSO4 , 1 mM CuSO4 , 250 µg hen egg white lysozyme, one EDTA-free protease inhibitor cocktail tablet (Roche), and ten units DNase I. Resuspended cells were frozen in liquid N2 and stored at −80 ˚C prior to purification.

Affinity Purification:

Article Title: Transformation by the R Enantiomer of 2-Hydroxyglutarate Linked to EglN Activation
Article Snippet: The Km values of EglN1 and EglN2 were determined by adding increasing amounts of R-2HG while the concentration of the substrate and other cofactors were kept constant. .. The HIF1α ODDD substrate, spanning residues 356-603 of human HIF1α, was produced in a BL21(DE3) E. coli strain (Novagen) in the presence of L-[2,3,4,5-3 H]proline (75 Ci/mmol, PerkinElmer Life Sciences) and affinity purified in a chelating Sepharose column charged with Ni2+ (ProBond, Invitrogen) exploiting a C-terminal His-tag . .. Concentration of the purified substrate was measured by RotiQuant (Carl Roth GmbH) and it was used at Km concentrations for the distinct EglNs .

Recombinant:

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression
Article Snippet: pMD20-T (Takara, Otsu, Japan) was employed to clone gene and pET-21b (Novagen, Madison, USA) was employed to construct expression plasmid. .. E. coli strain DH5α (Novagen, Madison, USA) was employed for gene manipulation and BL21 (DE3; Novagen, Madison, USA) was employed to construct recombinant expression strain. .. Recombinant IFN-CSP/pET-21b expression plasmid was obtained from Guangdong Provincial Key Laboratory of Pharmaceutical Bioactive Substances, Guangzhou, People’s Republic of China.

Article Title: Transformation by the R Enantiomer of 2-Hydroxyglutarate Linked to EglN Activation
Article Snippet: Paragraph title: Generation of a recombinant HIF1α substrate ... The HIF1α ODDD substrate, spanning residues 356-603 of human HIF1α, was produced in a BL21(DE3) E. coli strain (Novagen) in the presence of L-[2,3,4,5-3 H]proline (75 Ci/mmol, PerkinElmer Life Sciences) and affinity purified in a chelating Sepharose column charged with Ni2+ (ProBond, Invitrogen) exploiting a C-terminal His-tag .

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: Paragraph title: Purification of recombinant proteins ... For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: The correct open reading frame (ORF) was confirmed by double stranded sequencing using the vector flanking primers (T7 promoter/T7 terminator). .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. The induced cells were collected by centrifugation at 5,000 g for 10 min at 4°C and lyzed with PBS, pH 7.4 containing 1 mg/mL lysozyme, 30 μg/mL DNAse I and 1% Triton-X 100, then sonicated for 60 seconds on 75% power for 3–5 times with 2 minutes interval.

Fluorescence:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Mutagenesis:

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: The α-synuclein K23Q mutation [ ] was engineered using Q5 Site-Directed Mutagenesis (NEB) using the primers CCACACCCTGTTGGGTTTTCTCAG and CAGAAGCAGCAGGAAAGAC. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: The α-synuclein K23Q mutation [ ] was engineered using Q5 Site-Directed Mutagenesis (NEB) using the primers CCACACCCTGTTGGGTTTTCTCAG and CAGAAGCAGCAGGAAAGAC. .. The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Isolation:

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: The eluted proteins were treated with 5 mM DTT and isolated by gel filtration on a Superdex 200 16/60 gel filtration column (GE Healthcare) in reconstitution buffer R (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Size-exclusion Chromatography:

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Periplasmic protein was obtained by osmotic shock and the nanobodies were purified using nickel–nitrilotriacetic acid (Ni-NTA) chromatography .

Labeling:

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. Each protein was purified using a HisTrap™ column, followed by size exclusion chromatography on a HiLoad™ 16/60 Superdex™ 200 column.

Article Title: Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction
Article Snippet: The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ). .. The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ).

Purification:

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: DNA was purified from PCR reactions, enzymatic reactions, agarose gel band extractions, and vector extractions using OMEGA-Biotek purification kits. .. Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method .

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: Paragraph title: Expression, purification and crystallization ... All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen).

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: Paragraph title: Protein synthesis and purification ... This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG.

Article Title: HIF-2α-pVHL complex reveals broad genotype-phenotype correlations in HIF-2α-driven disease
Article Snippet: All peptides were reconstituted to 2 mg/mL, as measured by A280 , using sterile DMSO, aliquoted, and stored at −80 °C. .. HIS6 -PHD2 (181–426) was expressed in BL21(DE3) E. coli cells (Novagen, Cat. No. 69450) and purified according to a published protocol . .. Cell cultures were grown to OD600 = 0.8 and induced with a final concentration of 0.5 mM IPTG for 3.5 h at 37 °C.

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: Paragraph title: Purification of recombinant proteins ... For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Article Title: Ebola virus VP30 and nucleoprotein interactions modulate viral RNA synthesis
Article Snippet: Paragraph title: Protein expression and purification ... All eVP30 and eNP proteins were expressed as maltose-binding protein (MBP) fusion proteins in BL21(DE3) E. coli cells (Novagen) in Lysogeny broth media.

Article Title: Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction
Article Snippet: Paragraph title: Protein/RNA production and purification ... The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ).

Polymerase Chain Reaction:

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: DNA was purified from PCR reactions, enzymatic reactions, agarose gel band extractions, and vector extractions using OMEGA-Biotek purification kits. .. Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method .

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH
Article Snippet: The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA). .. The construction of the E. coli BL21 (DE3) (BL21_XR_FDH) harbouring Ct XR and Cb FDH genes on a pETDuet-1 vector (pETDuet_XR_FDH) was described elsewhere [ ].

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Each polymerase chain reaction (PCR) product was cloned into pET expression plasmids using the flanking restriction sites indicated (designed within the primers). .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Resulting single-colony transformants were cultured in 3 ml of lysogeny broth (LB) at 37°C with shaking before 15% glycerol stock storage at −80°C.

Positron Emission Tomography:

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression
Article Snippet: pMD20-T (Takara, Otsu, Japan) was employed to clone gene and pET-21b (Novagen, Madison, USA) was employed to construct expression plasmid. .. E. coli strain DH5α (Novagen, Madison, USA) was employed for gene manipulation and BL21 (DE3; Novagen, Madison, USA) was employed to construct recombinant expression strain.

Article Title: Construction of a Novel Liver-Targeting Fusion Interferon by Incorporation of a Plasmodium Region I-Plus Peptide
Article Snippet: We further investigated whether the fusion protein IFN-CSP reserves anti-HBV activity and liver-targeting function as its parental peptides. .. E. coli strain DH5α (Novagen, USA) and BL21 (DE3; Novagen, USA) were used as the host for gene manipulation and expression of fusion protein, respectively. pMD20-T (Takara, Japan) and pET-21b (Novagen, USA) were applied for gene cloning and expression, respectively. .. Luria-Bertani (LB) medium was employed for bacterial growth and protein production.

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen).

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: Genes of human BOLA1 (residues 30–137), BOLA3 (25–107), GLRX5 (32–157) and NFU1 (57–254) (each lacking its mitochondrial presequence) were inserted into the multiple cloning site I of pET-Duet1 vector (Novagen-Merck, Darmstadt, Germany) with a N-terminal His-tag. .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

Affinity Column:

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG. .. After growing cells for 16 h at 37 ˚C, they were harvested and resuspended in 50 mM Tris-Cl (pH 7.5), 500 mM NaCl, 25 mM imidazole, 1 mM ZnSO4 , 1 mM CuSO4 , 250 µg hen egg white lysozyme, one EDTA-free protease inhibitor cocktail tablet (Roche), and ten units DNase I. Resuspended cells were frozen in liquid N2 and stored at −80 ˚C prior to purification.

cDNA Library Assay:

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: The DNA encoding for Tc-CTL-1, minus the signal peptide at N-terminus was amplified from T . canis larval cDNA library [ ], subsequently subcloned in-frame into the E . coli expression vector pET41a (Novagen) with fusion Schistosoma japonicum Glutathione S-transferase (GST) deleted and 6 His-tag expressed at C-terminus (NdeI/XhoI). .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight.

SDS Page:

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG. .. This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG.

Plasmid Preparation:

Article Title: Soluble Expression of Humanized Anti-CD20 Single Chain Antibody in Escherichia coli by Cytoplasmic Chaperones Co-expression
Article Snippet: This article is the first report about the application of chaperone plasmids encoding GroEL, DnaJ, Tig, GroES, DnaK and GrpE chaperones to increase the soluble expression of anti-CD20-huscFv in E. coli . .. E. coli DH5α, BL21 (DE3) and expression vector pET22b (+) were purchased from Novagen. .. IPTG, Taq DNA polymerase was obtained from Promega Company.

Article Title: Production of bioactive liver-targeting interferon Mu-IFN-CSP by soluble prokaryotic expression
Article Snippet: pMD20-T (Takara, Otsu, Japan) was employed to clone gene and pET-21b (Novagen, Madison, USA) was employed to construct expression plasmid. .. E. coli strain DH5α (Novagen, Madison, USA) was employed for gene manipulation and BL21 (DE3; Novagen, Madison, USA) was employed to construct recombinant expression strain.

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: Paragraph title: Genetic manipulations and vector preparation ... Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method .

Article Title: Adrenaline-activated structure of the ?2-adrenoceptor stabilized by an engineered nanobody
Article Snippet: Subsequent to round 6, post-sorted yeast were plated onto SDCAA-agar plates, colonies were picked and cultured in liquid SDCAA medium, and the plasmids encoding the nanobodies were isolated with a ZymoPrep Yeast Plasmid Miniprep II kit (Zymo Research) and sequenced. .. Nanobodies were cloned into the periplasmic expression vector pET26b, containing an amino terminal signal sequence and a carboxy-terminal 8×histidine tag and transformed into BL21(DE3) Rosetta2 E. coli (Novagen). .. Cells were induced in Terrific Broth at an OD600 of 0.8 with 1 mM IPTG and incubated with shaking at 22 °C for 24 hours.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: The Kd of each construct and mutants were calculated by fitting the curve in KaleidaGraph 4.1. .. For the study shown in , the AB domain (residues 1-45) and F domain (369-465) of human HNF4α were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. Each protein was purified using a HisTrap™ column, followed by size exclusion chromatography on a HiLoad™ 16/60 Superdex™ 200 column.

Article Title: Multi-Domain Integration in the Structure of the HNF4? Nuclear Receptor Complex
Article Snippet: HNF4α proteins used in this study reference the NCBI sequence HNF4 NM_178849. .. All HNF4α (human) constructs including FL (1-464), ΔABΔF (46-368), ΔF (1-368), ΔAB (46-464), and DBD (46-126), and others were expressed from pET46 Ek/LIC vector in BL21(DE3) E. coli cells (Novagen). .. HNF4α ΔABΔF (human) construct was used in crystallization experiments.

Article Title: Host cell and expression engineering for development of an E. coli ketoreductase catalyst: Enhancement of formate dehydrogenase activity for regeneration of NADH
Article Snippet: The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA). .. The E. coli strains used were JM109 from Promega (Madison, WI, USA), BL21 (DE3) and Rosetta 2 (DE3) from Novagen (VWR International GmbH, Vienna, Austria) and BL21 star (DE3) from Invitrogen (Carlsbad, California, USA).

Article Title: Partially native intermediates mediate misfolding of SOD1 in single-molecule folding trajectories
Article Snippet: The open reading frame was synthesized (DNA2.0) and inserted into the plasmid pJExpress401 to produce an N-terminally tagged His6 fusion protein (sequence listed in Supplementary Table ). .. This plasmid was used to express the protein in BL21(DE3) E. coli (EMD Millipore), adding 50 µM ZnSO4 and CuSO4 to the growth medium (LB with 35 µg ml−1 kanamycin) before overexpression was induced with 1 mM IPTG. .. After growing cells for 16 h at 37 ˚C, they were harvested and resuspended in 50 mM Tris-Cl (pH 7.5), 500 mM NaCl, 25 mM imidazole, 1 mM ZnSO4 , 1 mM CuSO4 , 250 µg hen egg white lysozyme, one EDTA-free protease inhibitor cocktail tablet (Roche), and ten units DNase I. Resuspended cells were frozen in liquid N2 and stored at −80 ˚C prior to purification.

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Paragraph title: Bacterial strains and plasmid generation ... Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen).

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: The eluted proteins were treated with 5 mM DTT and isolated by gel filtration on a Superdex 200 16/60 gel filtration column (GE Healthcare) in reconstitution buffer R (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3). .. Cells were grown at 37°C in LB or minimal media with (15 NH4 )2 SO4 and/or 13 C-glucose containing 100 μg/mL ampicillin.

Article Title: Rapid and ultra-sensitive quantitation of disease-associated α-synuclein seeds in brain and cerebrospinal fluid by αSyn RT-QuIC
Article Snippet: Paragraph title: K23Q rαSyn expression vector preparation ... The plasmids were transformed into BL21(DE3) Escherichia coli (EMD Biosciences).

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight.

Selection:

Article Title: In situ pneumococcal vaccine production and delivery through a hybrid biological-biomaterial vector
Article Snippet: Constructs were verified by colony PCR and restriction digest analysis and were then chemically transformed into the BL21(DE3) E. coli cell line (Novagen). .. Resulting single-colony transformants were cultured in 3 ml of lysogeny broth (LB) at 37°C with shaking before 15% glycerol stock storage at −80°C.

Agarose Gel Electrophoresis:

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: DNA was purified from PCR reactions, enzymatic reactions, agarose gel band extractions, and vector extractions using OMEGA-Biotek purification kits. .. Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method .

Nuclear Magnetic Resonance:

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: The eluted proteins were treated with 5 mM DTT and isolated by gel filtration on a Superdex 200 16/60 gel filtration column (GE Healthcare) in reconstitution buffer R (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5% glycerol). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3). .. Cells were grown at 37°C in LB or minimal media with (15 NH4 )2 SO4 and/or 13 C-glucose containing 100 μg/mL ampicillin.

Affinity Chromatography:

Article Title: Development of a Luminex Bead Based Assay for Diagnosis of Toxocariasis Using Recombinant Antigens Tc-CTL-1 and Tc-TES-26
Article Snippet: For expression of recombinant Tc-CTL-1 in bacteria, the recombinant pET41a was transformed into BL21(DE3) Escherichia coli (Novagen) and recombinant protein was expressed as insoluble inclusion bodies after being induced with 1 mM Isopropyl β-D-1-thiogalactopyranoside ( IPTG) at 30°C overnight. .. The induced cells were collected by centrifugation at 5,000 g for 10 min at 4°C and lyzed with PBS, pH 7.4 containing 1 mg/mL lysozyme, 30 μg/mL DNAse I and 1% Triton-X 100, then sonicated for 60 seconds on 75% power for 3–5 times with 2 minutes interval.

Produced:

Article Title: Transformation by the R Enantiomer of 2-Hydroxyglutarate Linked to EglN Activation
Article Snippet: The Km values of EglN1 and EglN2 were determined by adding increasing amounts of R-2HG while the concentration of the substrate and other cofactors were kept constant. .. The HIF1α ODDD substrate, spanning residues 356-603 of human HIF1α, was produced in a BL21(DE3) E. coli strain (Novagen) in the presence of L-[2,3,4,5-3 H]proline (75 Ci/mmol, PerkinElmer Life Sciences) and affinity purified in a chelating Sepharose column charged with Ni2+ (ProBond, Invitrogen) exploiting a C-terminal His-tag . .. Concentration of the purified substrate was measured by RotiQuant (Carl Roth GmbH) and it was used at Km concentrations for the distinct EglNs .

Article Title: Mitochondrial Bol1 and Bol3 function as assembly factors for specific iron-sulfur proteins
Article Snippet: For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3). .. For NMR the BOLA proteins (BOLA1, 21–137; BOLA3, 27–107) were obtained from BL21(DE3)GOLD Escherichia coli (Novagen) transformed with pETG20A vector (BOLA1) and pET15 vector (BOLA3).

DNA Purification:

Article Title: The pCri System: A Vector Collection for Recombinant Protein Expression and Purification
Article Snippet: When necessary, a second round of digestion was performed before the final DNA purification step. .. Chemically competent E. coli DH5α, BL21 (DE3), and Origami 2 (DE3) cells (Novagen) were prepared and transformed following Hanahan method .

Lysis:

Article Title: Ebola virus VP30 and nucleoprotein interactions modulate viral RNA synthesis
Article Snippet: All eVP30 and eNP proteins were expressed as maltose-binding protein (MBP) fusion proteins in BL21(DE3) E. coli cells (Novagen) in Lysogeny broth media. .. Protein expression was induced at an optical density of 0.6 with 0.5 mM isopropylthiogalactoside and grown for 12–15 h at 18 °C.

Article Title: Structures of human SRP72 complexes provide insights into SRP RNA remodeling and ribosome interaction
Article Snippet: The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ). .. The human SRP72-RBD constructs were transformed into BL21(DE3) E. coli cells (Novagen) and proteins were expressed by auto-induction for 16 h at 25°C ( ).

Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 95
    Millipore e coli strain bl21
    Zymographic detection of the autolytic activity in recombinant His-tagged Atl. Protein extracts from E. coli <t>BL21</t> cells grown with IPTG were used in this study. The protein extract was separated by 12.5% SDS-gel electrophoresis. The SDS gel was impregnated with autoclaved S. aureus RN450 cells. Autolytic activity was detected by renaturing the autolysins by incubation of the gel in 50 mM Tri-HCl buffer, pH 7.5, containing 0.05% Triton X-100. Lane 1: full length His-tagged Atl; lane 2: Atl-1; lane 3: Atl-2; lane 4: Atl-3; lane 5: Atl-4; lane 6: Atl-5; lane 7: Atl-6; lane 8: Atl-7; lane 9: Atl-8.
    E Coli Strain Bl21, supplied by Millipore, used in various techniques. Bioz Stars score: 95/100, based on 117 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/e coli strain bl21/product/Millipore
    Average 95 stars, based on 117 article reviews
    Price from $9.99 to $1999.99
    e coli strain bl21 - by Bioz Stars, 2020-01
    95/100 stars
      Buy from Supplier

    99
    Millipore influenza a virus
    Tetherin has little impact on the release of infectious influenza A virus. (A) HeLa cells, tetracycline (Tetrac.) or PBS induced 293-BST2 cells and transfected 293T cells were stained with anti-tetherin or isotype-matched (Iso.) control antibody and staining was analyzed by FACS. The arithmetic mean channel fluorescence was measured and results are presented as fold increase compared to unstained cells. The average of six independent experiments is shown, error bars indicate standard error of the mean (SEM). (B) A tetherin expression plasmid or empty plasmid was transiently transfected into 293T cells and the cells were infected with the indicated FLUAV strains at an MOI of 1. After 60 min, the viral inocula were removed, the cells washed and incubated for 24 h with fresh medium. Thereafter, the infectivity in cell culture supernatants was determined employing the focus formation assay. The results of a representative experiment performed with triplicate samples are shown, error bars indicate standard deviation (SD). (C) The experiment was carried out as described in (B) but A/PR/8/34 release from PBS or tetracycline induced 293-BST2 cells and from empty plasmid or tetherin plasmid transfected 293T cells (293T transf.) was analyzed. The results represent the average of four independent experiments. Error bars indicate SEM. Release from PBS induced 293-BST2 cells or empty plasmid transfected 293T cells were set as 100% (control). (D–E) HeLa cells were transiently transfected with scrambled, non-sense (ns) siRNA or tetherin siRNA. At 24 h post transfection, the cells were infected with A/WSN/33 at a MOI of 1 or mock infected for 1 h at 37°C. Afterwards, cells were washed with PBS and tetherin expression in cell lysates was determined by Western blot. The results of single blots, from which irrelevant lanes were excised, are shown in panel (D). Tetherin signals are diffuse, due to heterogeneity in glycosylation with major signals in the range from 20–34 kDa (arrows indicate the major tetherin glycoforms). In parallel, the infectivity in the cell culture supernatants was determined employing the focus formation assay at 24 h and 48 h post infection. The results of a representative experiment performed with triplicate samples are shown in panel (E), error bars indicate SD. Similar results were obtained in a separate experiment.
    Influenza A Virus, supplied by Millipore, used in various techniques. Bioz Stars score: 99/100, based on 3 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/influenza a virus/product/Millipore
    Average 99 stars, based on 3 article reviews
    Price from $9.99 to $1999.99
    influenza a virus - by Bioz Stars, 2020-01
    99/100 stars
      Buy from Supplier

    Image Search Results


    Zymographic detection of the autolytic activity in recombinant His-tagged Atl. Protein extracts from E. coli BL21 cells grown with IPTG were used in this study. The protein extract was separated by 12.5% SDS-gel electrophoresis. The SDS gel was impregnated with autoclaved S. aureus RN450 cells. Autolytic activity was detected by renaturing the autolysins by incubation of the gel in 50 mM Tri-HCl buffer, pH 7.5, containing 0.05% Triton X-100. Lane 1: full length His-tagged Atl; lane 2: Atl-1; lane 3: Atl-2; lane 4: Atl-3; lane 5: Atl-4; lane 6: Atl-5; lane 7: Atl-6; lane 8: Atl-7; lane 9: Atl-8.

    Journal: International Journal of Microbiology

    Article Title: High Level Expression and Purification of Atl, the Major Autolytic Protein of Staphylococcus aureus

    doi: 10.1155/2014/615965

    Figure Lengend Snippet: Zymographic detection of the autolytic activity in recombinant His-tagged Atl. Protein extracts from E. coli BL21 cells grown with IPTG were used in this study. The protein extract was separated by 12.5% SDS-gel electrophoresis. The SDS gel was impregnated with autoclaved S. aureus RN450 cells. Autolytic activity was detected by renaturing the autolysins by incubation of the gel in 50 mM Tri-HCl buffer, pH 7.5, containing 0.05% Triton X-100. Lane 1: full length His-tagged Atl; lane 2: Atl-1; lane 3: Atl-2; lane 4: Atl-3; lane 5: Atl-4; lane 6: Atl-5; lane 7: Atl-6; lane 8: Atl-7; lane 9: Atl-8.

    Article Snippet: In addition, E. coli strain BL21 (EMD Millipore) was used for all protein expression studies.

    Techniques: Activity Assay, Recombinant, SDS-Gel, Electrophoresis, Incubation

    Coomassie stained gels showing purity of recombinant His-tagged Atl. Recombinant Atl and Atl-1 proteins were overproduced in E. coli and purified as described in the Materials and Methods section. Lane M: standard protein markers; lanes 1 and 2: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl and grown without and with IPTG, respectively; lane 3: purified His-tagged Atl; lanes 4 and 5: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl1 and grown without and with IPTG, respectively; lane 6: purified His-tagged Atl-1.

    Journal: International Journal of Microbiology

    Article Title: High Level Expression and Purification of Atl, the Major Autolytic Protein of Staphylococcus aureus

    doi: 10.1155/2014/615965

    Figure Lengend Snippet: Coomassie stained gels showing purity of recombinant His-tagged Atl. Recombinant Atl and Atl-1 proteins were overproduced in E. coli and purified as described in the Materials and Methods section. Lane M: standard protein markers; lanes 1 and 2: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl and grown without and with IPTG, respectively; lane 3: purified His-tagged Atl; lanes 4 and 5: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl1 and grown without and with IPTG, respectively; lane 6: purified His-tagged Atl-1.

    Article Snippet: In addition, E. coli strain BL21 (EMD Millipore) was used for all protein expression studies.

    Techniques: Staining, Recombinant, Purification, Transformation Assay

    Zymographic detection of the autolytic activity in purified recombinant His-tagged Atl. Lane 1: total protein extract from S. aureus cells. Lanes 2 and 4: purified His-tagged Atl and Atl-1, respectively; lanes 3 and 5: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl or pRSETA- atl1 and grown with IPTG, respectively.

    Journal: International Journal of Microbiology

    Article Title: High Level Expression and Purification of Atl, the Major Autolytic Protein of Staphylococcus aureus

    doi: 10.1155/2014/615965

    Figure Lengend Snippet: Zymographic detection of the autolytic activity in purified recombinant His-tagged Atl. Lane 1: total protein extract from S. aureus cells. Lanes 2 and 4: purified His-tagged Atl and Atl-1, respectively; lanes 3 and 5: protein extract from E. coli BL21 cells transformed with plasmids pRSETA- atl or pRSETA- atl1 and grown with IPTG, respectively.

    Article Snippet: In addition, E. coli strain BL21 (EMD Millipore) was used for all protein expression studies.

    Techniques: Activity Assay, Purification, Recombinant, Transformation Assay

    Coomassie stained gels demonstrating overexpression of recombinant Atl. The 12.5% SDS-PAGE contains protein extracts of E. coli BL21 cells with pRSETA plasmids expressing either full length or truncated Atl proteins. The odd number labels are cells grown without IPTG and the even number labels are the cells grown with IPTG. Lane M: standard protein markers; lanes 1 and 2 - Atl (full length His-tagged Atl); lanes 3 and 4: Atl-1; lanes 5 and 6: Atl-2; lanes 7 and 8: Atl-3; lanes 9 and 10: Atl-4; lanes 11 and 12: Atl-6; lanes 13 and 14: Atl-5; lanes 15 and 16: Atl-7; lanes 17 and 18: Atl-8. The Atl number suffixes are indicated in Table 1 .

    Journal: International Journal of Microbiology

    Article Title: High Level Expression and Purification of Atl, the Major Autolytic Protein of Staphylococcus aureus

    doi: 10.1155/2014/615965

    Figure Lengend Snippet: Coomassie stained gels demonstrating overexpression of recombinant Atl. The 12.5% SDS-PAGE contains protein extracts of E. coli BL21 cells with pRSETA plasmids expressing either full length or truncated Atl proteins. The odd number labels are cells grown without IPTG and the even number labels are the cells grown with IPTG. Lane M: standard protein markers; lanes 1 and 2 - Atl (full length His-tagged Atl); lanes 3 and 4: Atl-1; lanes 5 and 6: Atl-2; lanes 7 and 8: Atl-3; lanes 9 and 10: Atl-4; lanes 11 and 12: Atl-6; lanes 13 and 14: Atl-5; lanes 15 and 16: Atl-7; lanes 17 and 18: Atl-8. The Atl number suffixes are indicated in Table 1 .

    Article Snippet: In addition, E. coli strain BL21 (EMD Millipore) was used for all protein expression studies.

    Techniques: Staining, Over Expression, Recombinant, SDS Page, Expressing

    Tetherin has little impact on the release of infectious influenza A virus. (A) HeLa cells, tetracycline (Tetrac.) or PBS induced 293-BST2 cells and transfected 293T cells were stained with anti-tetherin or isotype-matched (Iso.) control antibody and staining was analyzed by FACS. The arithmetic mean channel fluorescence was measured and results are presented as fold increase compared to unstained cells. The average of six independent experiments is shown, error bars indicate standard error of the mean (SEM). (B) A tetherin expression plasmid or empty plasmid was transiently transfected into 293T cells and the cells were infected with the indicated FLUAV strains at an MOI of 1. After 60 min, the viral inocula were removed, the cells washed and incubated for 24 h with fresh medium. Thereafter, the infectivity in cell culture supernatants was determined employing the focus formation assay. The results of a representative experiment performed with triplicate samples are shown, error bars indicate standard deviation (SD). (C) The experiment was carried out as described in (B) but A/PR/8/34 release from PBS or tetracycline induced 293-BST2 cells and from empty plasmid or tetherin plasmid transfected 293T cells (293T transf.) was analyzed. The results represent the average of four independent experiments. Error bars indicate SEM. Release from PBS induced 293-BST2 cells or empty plasmid transfected 293T cells were set as 100% (control). (D–E) HeLa cells were transiently transfected with scrambled, non-sense (ns) siRNA or tetherin siRNA. At 24 h post transfection, the cells were infected with A/WSN/33 at a MOI of 1 or mock infected for 1 h at 37°C. Afterwards, cells were washed with PBS and tetherin expression in cell lysates was determined by Western blot. The results of single blots, from which irrelevant lanes were excised, are shown in panel (D). Tetherin signals are diffuse, due to heterogeneity in glycosylation with major signals in the range from 20–34 kDa (arrows indicate the major tetherin glycoforms). In parallel, the infectivity in the cell culture supernatants was determined employing the focus formation assay at 24 h and 48 h post infection. The results of a representative experiment performed with triplicate samples are shown in panel (E), error bars indicate SD. Similar results were obtained in a separate experiment.

    Journal: PLoS ONE

    Article Title: Influenza A Virus Does Not Encode a Tetherin Antagonist with Vpu-Like Activity and Induces IFN-Dependent Tetherin Expression in Infected Cells

    doi: 10.1371/journal.pone.0043337

    Figure Lengend Snippet: Tetherin has little impact on the release of infectious influenza A virus. (A) HeLa cells, tetracycline (Tetrac.) or PBS induced 293-BST2 cells and transfected 293T cells were stained with anti-tetherin or isotype-matched (Iso.) control antibody and staining was analyzed by FACS. The arithmetic mean channel fluorescence was measured and results are presented as fold increase compared to unstained cells. The average of six independent experiments is shown, error bars indicate standard error of the mean (SEM). (B) A tetherin expression plasmid or empty plasmid was transiently transfected into 293T cells and the cells were infected with the indicated FLUAV strains at an MOI of 1. After 60 min, the viral inocula were removed, the cells washed and incubated for 24 h with fresh medium. Thereafter, the infectivity in cell culture supernatants was determined employing the focus formation assay. The results of a representative experiment performed with triplicate samples are shown, error bars indicate standard deviation (SD). (C) The experiment was carried out as described in (B) but A/PR/8/34 release from PBS or tetracycline induced 293-BST2 cells and from empty plasmid or tetherin plasmid transfected 293T cells (293T transf.) was analyzed. The results represent the average of four independent experiments. Error bars indicate SEM. Release from PBS induced 293-BST2 cells or empty plasmid transfected 293T cells were set as 100% (control). (D–E) HeLa cells were transiently transfected with scrambled, non-sense (ns) siRNA or tetherin siRNA. At 24 h post transfection, the cells were infected with A/WSN/33 at a MOI of 1 or mock infected for 1 h at 37°C. Afterwards, cells were washed with PBS and tetherin expression in cell lysates was determined by Western blot. The results of single blots, from which irrelevant lanes were excised, are shown in panel (D). Tetherin signals are diffuse, due to heterogeneity in glycosylation with major signals in the range from 20–34 kDa (arrows indicate the major tetherin glycoforms). In parallel, the infectivity in the cell culture supernatants was determined employing the focus formation assay at 24 h and 48 h post infection. The results of a representative experiment performed with triplicate samples are shown in panel (E), error bars indicate SD. Similar results were obtained in a separate experiment.

    Article Snippet: After incubation with 100 µL/well Quencher (0.5% Triton X-100, 20 mM glycine in PBS) for 10 min, the cells were washed with wash buffer (WB) (0.1% Tween 20 in PBS) and then blocked with 50 µL of blocking buffer (BB) (0.5% Tween, 20% BSA in PBS) at 37°C under 5% CO2 for 30 min. A polyclonal goat antibody raised against influenza A virus (Millipore) served as primary antibody and HRP-conjugated anti-goat antibody (KPL) was used as secondary antibody; both were diluted 1∶1,000 in BB.

    Techniques: Transfection, Staining, FACS, Fluorescence, Expressing, Plasmid Preparation, Infection, Incubation, Cell Culture, Tube Formation Assay, Standard Deviation, Western Blot

    Influenza A virus infection induces tetherin expression at the cell surface in an interferon-dependent manner. (A) A549 cells were treated with 10,000 U/ml IFNβ (left panel) or infected with the indicated viruses at an MOI of 1 (right panel). After 24 h, the expression of tetherin at the cell surface was determined by FACS. The average of two separate experiments is shown, error bars indicate SEM. Similar results were obtained in two separate experiments. (B) A549 and Vero E6 cells, which were not exposed to FLUAV or IFN, were mock treated (filled grey histogram) or incubated with isotype matched control antibody and secondary antibody (black line) or incubated with anti-tetherin antibody and secondary antibody (grey line). Subsequently, staining was analyzed by FACS. (C) The experiment was carried out as described in (A) but Vero E6 cells were used. The average ± SEM of two separate experiments is shown for IFN induction of tetherin expression (left panel), while the average ± SD of a single experiment performed in triplicates are shown for FLUAV infection. Similar results were obtained in a separate experiment. (D) Expression of hemagglutinin (HA) on the cells analyzed in (C) was determined by FACS. The average ± SEM of two separate experiments is shown.

    Journal: PLoS ONE

    Article Title: Influenza A Virus Does Not Encode a Tetherin Antagonist with Vpu-Like Activity and Induces IFN-Dependent Tetherin Expression in Infected Cells

    doi: 10.1371/journal.pone.0043337

    Figure Lengend Snippet: Influenza A virus infection induces tetherin expression at the cell surface in an interferon-dependent manner. (A) A549 cells were treated with 10,000 U/ml IFNβ (left panel) or infected with the indicated viruses at an MOI of 1 (right panel). After 24 h, the expression of tetherin at the cell surface was determined by FACS. The average of two separate experiments is shown, error bars indicate SEM. Similar results were obtained in two separate experiments. (B) A549 and Vero E6 cells, which were not exposed to FLUAV or IFN, were mock treated (filled grey histogram) or incubated with isotype matched control antibody and secondary antibody (black line) or incubated with anti-tetherin antibody and secondary antibody (grey line). Subsequently, staining was analyzed by FACS. (C) The experiment was carried out as described in (A) but Vero E6 cells were used. The average ± SEM of two separate experiments is shown for IFN induction of tetherin expression (left panel), while the average ± SD of a single experiment performed in triplicates are shown for FLUAV infection. Similar results were obtained in a separate experiment. (D) Expression of hemagglutinin (HA) on the cells analyzed in (C) was determined by FACS. The average ± SEM of two separate experiments is shown.

    Article Snippet: After incubation with 100 µL/well Quencher (0.5% Triton X-100, 20 mM glycine in PBS) for 10 min, the cells were washed with wash buffer (WB) (0.1% Tween 20 in PBS) and then blocked with 50 µL of blocking buffer (BB) (0.5% Tween, 20% BSA in PBS) at 37°C under 5% CO2 for 30 min. A polyclonal goat antibody raised against influenza A virus (Millipore) served as primary antibody and HRP-conjugated anti-goat antibody (KPL) was used as secondary antibody; both were diluted 1∶1,000 in BB.

    Techniques: Infection, Expressing, FACS, Incubation, Staining, Hemagglutination Assay

    Influenza A virus infection does not antagonize tetherin. Plasmids encoding HIV-1 Gag and tetherin were cotransfected into 293T cells and the cells were subsequently infected with A/WSN/33 at the indicated MOIs or mock infected. At 24 h post infection the presence of Gag in cell lysates and culture supernatants (sups) as well as the expression of tetherin, FLUAV antigens and β-actin in cell lysates was determined by Western blot. Similar results were obtained in four separate experiments conducted with MOIs of 0.03 and 0.3.

    Journal: PLoS ONE

    Article Title: Influenza A Virus Does Not Encode a Tetherin Antagonist with Vpu-Like Activity and Induces IFN-Dependent Tetherin Expression in Infected Cells

    doi: 10.1371/journal.pone.0043337

    Figure Lengend Snippet: Influenza A virus infection does not antagonize tetherin. Plasmids encoding HIV-1 Gag and tetherin were cotransfected into 293T cells and the cells were subsequently infected with A/WSN/33 at the indicated MOIs or mock infected. At 24 h post infection the presence of Gag in cell lysates and culture supernatants (sups) as well as the expression of tetherin, FLUAV antigens and β-actin in cell lysates was determined by Western blot. Similar results were obtained in four separate experiments conducted with MOIs of 0.03 and 0.3.

    Article Snippet: After incubation with 100 µL/well Quencher (0.5% Triton X-100, 20 mM glycine in PBS) for 10 min, the cells were washed with wash buffer (WB) (0.1% Tween 20 in PBS) and then blocked with 50 µL of blocking buffer (BB) (0.5% Tween, 20% BSA in PBS) at 37°C under 5% CO2 for 30 min. A polyclonal goat antibody raised against influenza A virus (Millipore) served as primary antibody and HRP-conjugated anti-goat antibody (KPL) was used as secondary antibody; both were diluted 1∶1,000 in BB.

    Techniques: Infection, Expressing, Western Blot