bl21 star bacteria  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 80

    Structured Review

    Thermo Fisher bl21 star bacteria
    Bl21 Star Bacteria, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 80/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 star bacteria/product/Thermo Fisher
    Average 80 stars, based on 1 article reviews
    Price from $9.99 to $1999.99
    bl21 star bacteria - by Bioz Stars, 2020-02
    80/100 stars

    Images

    Related Articles

    Clone Assay:

    Article Title: Hsp110 Chaperones Regulate Prion Formation and Propagation in S. cerevisiae by Two Discrete Activities
    Article Snippet: The gene encoding Snl1 lacking the N-terminal transmembrane domain (1-39aa) (Snl1ΔN) was cloned into a pProEX Htb vector (Invitrogen) using standard procedures. .. Snl1ΔN was expressed with a TEV-cleavable N-terminal His6-tag in BL21 Star bacteria (Invitrogen) and purified by Ni-IDA affinity chromatography (Protino, Macherey-Nagel) following standard protocols.

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . ..

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: PCR products were cloned into pET15b (Novagen) and confirmed by sequencing. .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver).

    Transfection:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . ..

    Amplification:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . ..

    Expressing:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . ..

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver). .. On induction of protein with 1 mM isopropyl β- d -thiogalactoside at OD600 = 0.500, 50 μM d -biotin was added to allow biotinylation of proteins in vivo .

    Isolation:

    Article Title: Chaperone network in the yeast cytosol: Hsp110 is revealed as an Hsp70 nucleotide exchange factor
    Article Snippet: Ssa1p and Ssb1p with a TEV-cleavable N-terminal His6 -tag were expressed from pProEX Htb vectors (Invitrogen) in BL21 Star™ bacteria (Invitrogen) and purified as described ( ). .. The protein was isolated as for the N-terminally tagged version, with the exclusion of TEV protease cleavage steps.

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: The full extracellular domain or only the C-type lectin-like domain segment of mouse NKR-P1B were isolated by PCR using the following primers: P1Btet, 5′-CTCGAGCTGAACGACATCTTCGAGGCTCAAAAGATCGAGTGGCACGAAGCGGATGTTCAA; P1Btet, 3′-CTCGAGTCAGGAGTCATTACTCGGGGTTTCATG; and P1Bcrd, 5′-CATATGCTGAACGACATCTTCGAGGCTCAAAAGATCGAGTGGCACGAAGTTAATTTAGAGTGCCCACAAG. .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver).

    In Vivo:

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver). .. On induction of protein with 1 mM isopropyl β- d -thiogalactoside at OD600 = 0.500, 50 μM d -biotin was added to allow biotinylation of proteins in vivo .

    Purification:

    Article Title: Hsp110 Chaperones Regulate Prion Formation and Propagation in S. cerevisiae by Two Discrete Activities
    Article Snippet: .. Snl1ΔN was expressed with a TEV-cleavable N-terminal His6-tag in BL21 Star bacteria (Invitrogen) and purified by Ni-IDA affinity chromatography (Protino, Macherey-Nagel) following standard protocols. .. N-terminally GST-tagged Fes1 was expressed from the pGEX-4T-2 vector (Amersham Biosciences) and purified as described .

    Article Title: Chaperone network in the yeast cytosol: Hsp110 is revealed as an Hsp70 nucleotide exchange factor
    Article Snippet: .. Ssa1p and Ssb1p with a TEV-cleavable N-terminal His6 -tag were expressed from pProEX Htb vectors (Invitrogen) in BL21 Star™ bacteria (Invitrogen) and purified as described ( ). .. Ssa1p with a C-terminal His10 -tag was expressed from the pET20b vector (Novagen).

    Protein Purification:

    Article Title: Hsp110 Chaperones Regulate Prion Formation and Propagation in S. cerevisiae by Two Discrete Activities
    Article Snippet: Paragraph title: Protein purification ... Snl1ΔN was expressed with a TEV-cleavable N-terminal His6-tag in BL21 Star bacteria (Invitrogen) and purified by Ni-IDA affinity chromatography (Protino, Macherey-Nagel) following standard protocols.

    Article Title: Chaperone network in the yeast cytosol: Hsp110 is revealed as an Hsp70 nucleotide exchange factor
    Article Snippet: Paragraph title: Protein purification ... Ssa1p and Ssb1p with a TEV-cleavable N-terminal His6 -tag were expressed from pProEX Htb vectors (Invitrogen) in BL21 Star™ bacteria (Invitrogen) and purified as described ( ).

    Sequencing:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: Cloning and expression The sequence encoding CR-VI+ was PCR amplified using primers that added a C-terminal SGHHHHHH-tag to the translation product, from a synthetic hMPV L gene (hMPV isolate 00-1 , GenBank: AF371337.2), codon optimized for expression in Spodoptera frugiperda (Sf ) cells (Geneart). .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) .

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: PCR products were cloned into pET15b (Novagen) and confirmed by sequencing. .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver).

    Affinity Chromatography:

    Article Title: Hsp110 Chaperones Regulate Prion Formation and Propagation in S. cerevisiae by Two Discrete Activities
    Article Snippet: .. Snl1ΔN was expressed with a TEV-cleavable N-terminal His6-tag in BL21 Star bacteria (Invitrogen) and purified by Ni-IDA affinity chromatography (Protino, Macherey-Nagel) following standard protocols. .. N-terminally GST-tagged Fes1 was expressed from the pGEX-4T-2 vector (Amersham Biosciences) and purified as described .

    Cotransfection:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . ..

    Polymerase Chain Reaction:

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: Cloning and expression The sequence encoding CR-VI+ was PCR amplified using primers that added a C-terminal SGHHHHHH-tag to the translation product, from a synthetic hMPV L gene (hMPV isolate 00-1 , GenBank: AF371337.2), codon optimized for expression in Spodoptera frugiperda (Sf ) cells (Geneart). .. The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) .

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: PCR products were cloned into pET15b (Novagen) and confirmed by sequencing. .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver).

    FACS:

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: Automated magnetic cell sorting was performed by using an autoMACS sorter according to the manufacturer's instructions (Miltenyi Biotec, Auburn, CA). .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver).

    Transformation Assay:

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver). .. On induction of protein with 1 mM isopropyl β- d -thiogalactoside at OD600 = 0.500, 50 μM d -biotin was added to allow biotinylation of proteins in vivo .

    Plasmid Preparation:

    Article Title: Hsp110 Chaperones Regulate Prion Formation and Propagation in S. cerevisiae by Two Discrete Activities
    Article Snippet: The gene encoding Snl1 lacking the N-terminal transmembrane domain (1-39aa) (Snl1ΔN) was cloned into a pProEX Htb vector (Invitrogen) using standard procedures. .. Snl1ΔN was expressed with a TEV-cleavable N-terminal His6-tag in BL21 Star bacteria (Invitrogen) and purified by Ni-IDA affinity chromatography (Protino, Macherey-Nagel) following standard protocols.

    Article Title: X-ray structure and activities of an essential Mononegavirales L-protein domain
    Article Snippet: The amplicon was cloned into pOPIN-E for expression in HEK293T mammalian cells (following transfection using Lipofectamine 2000; Invitrogen), in BL21 Star bacteria (Invitrogen) and in Sf 21 (insect cells) following co-transfection with (flashBACULTRA) baculovirus (Oxford Expression Systems) using Cellfectin II (Invitrogen) . .. For each mutation, the forward primer was combined with a vector-specific reverse primer (5′-AGTGGTATTTGTGAGCCAGG-3′), and, in a second PCR, the reverse primer was used together with a vector-specific forward primer (5′-CCTTTAATTCAACCCAACAC-3′).

    Article Title: Chaperone network in the yeast cytosol: Hsp110 is revealed as an Hsp70 nucleotide exchange factor
    Article Snippet: Ssa1p and Ssb1p with a TEV-cleavable N-terminal His6 -tag were expressed from pProEX Htb vectors (Invitrogen) in BL21 Star™ bacteria (Invitrogen) and purified as described ( ). .. Ssa1p with a C-terminal His10 -tag was expressed from the pET20b vector (Novagen).

    Article Title: Missing self-recognition of Ocil/Clr-b by inhibitory NKR-P1 natural killer cell receptors
    Article Snippet: .. The expression plasmids were transformed into BL21 Star bacteria (Invitrogen) containing an isopropyl β- d -thiogalactoside-inducible BirA vector (Avidity, Denver). .. On induction of protein with 1 mM isopropyl β- d -thiogalactoside at OD600 = 0.500, 50 μM d -biotin was added to allow biotinylation of proteins in vivo .

    Similar Products

  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90
    Thermo Fisher bl21 star de3 plyss one shot chemically competent e coli
    Bl21 Star De3 Plyss One Shot Chemically Competent E Coli, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 4 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/bl21 star de3 plyss one shot chemically competent e coli/product/Thermo Fisher
    Average 90 stars, based on 4 article reviews
    Price from $9.99 to $1999.99
    bl21 star de3 plyss one shot chemically competent e coli - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher one shot bl21 star
    One Shot Bl21 Star, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 15 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/one shot bl21 star/product/Thermo Fisher
    Average 90 stars, based on 15 article reviews
    Price from $9.99 to $1999.99
    one shot bl21 star - by Bioz Stars, 2020-02
    90/100 stars
      Buy from Supplier

    Image Search Results